Summary information [schematics · tetrads · helices · stems · costacks · homepage]

PDB-id
2m6w
Class
DNA
Method
NMR
Summary
Solution NMR structure of the d(ggggttggggttttggggaagggg) quadruplex in sodium conditions
Reference
Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.: (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007-eaat3007.
Abstract
The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
G4 notes
4 G-tetrads, 1 G4 helix, 1 G4 stem · 4(-LwD+Ln), basket(2+2), UDDU

Base-block schematics in six views [summary · tetrads · helices · stems · costacks · homepage]

PyMOL session file PDB file View in 3Dmol.js

List of 4 G-tetrads [summary · schematics · helices · stems · costacks · homepage]

 1 glyco-bond=s--s groove=w-n- planarity=0.146 type=planar nts=4 GGGG A.DG1,A.DG10,A.DG24,A.DG15
 2 glyco-bond=-ss- groove=w-n- planarity=0.209 type=other  nts=4 GGGG A.DG2,A.DG9,A.DG23,A.DG16
 3 glyco-bond=s--s groove=w-n- planarity=0.260 type=other  nts=4 GGGG A.DG3,A.DG8,A.DG22,A.DG17
 4 glyco-bond=-ss- groove=w-n- planarity=0.222 type=other  nts=4 GGGG A.DG4,A.DG7,A.DG21,A.DG18

List of 1 G4-helix [summary · schematics · tetrads · stems · costacks · homepage]

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 4 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=s--s groove=w-n- Major-->WC nts=4 GGGG A.DG1,A.DG10,A.DG24,A.DG15
 2  glyco-bond=-ss- groove=w-n- WC-->Major nts=4 GGGG A.DG2,A.DG9,A.DG23,A.DG16
 3  glyco-bond=s--s groove=w-n- Major-->WC nts=4 GGGG A.DG3,A.DG8,A.DG22,A.DG17
 4  glyco-bond=-ss- groove=w-n- WC-->Major nts=4 GGGG A.DG4,A.DG7,A.DG21,A.DG18
  step#1  mm(<>,outward)  area=9.79  rise=3.06 twist=24.9
  step#2  pp(><,inward)   area=13.88 rise=3.39 twist=30.2
  step#3  mm(<>,outward)  area=17.43 rise=3.05 twist=13.8
  strand#1 DNA glyco-bond=s-s- nts=4 GGGG A.DG1,A.DG2,A.DG3,A.DG4
  strand#2 DNA glyco-bond=-s-s nts=4 GGGG A.DG10,A.DG9,A.DG8,A.DG7
  strand#3 DNA glyco-bond=-s-s nts=4 GGGG A.DG24,A.DG23,A.DG22,A.DG21
  strand#4 DNA glyco-bond=s-s- nts=4 GGGG A.DG15,A.DG16,A.DG17,A.DG18

Download PDB file
Interactive view in 3Dmol.js

3 stacking diagrams
 1  glyco-bond=s--s groove=w-n- Major-->WC nts=4 GGGG A.DG1,A.DG10,A.DG24,A.DG15
2 glyco-bond=-ss- groove=w-n- WC-->Major nts=4 GGGG A.DG2,A.DG9,A.DG23,A.DG16
step#1 mm(<>,outward) area=9.79 rise=3.06 twist=24.9

Download PDB file
Interactive view in 3Dmol.js

 2  glyco-bond=-ss- groove=w-n- WC-->Major nts=4 GGGG A.DG2,A.DG9,A.DG23,A.DG16
3 glyco-bond=s--s groove=w-n- Major-->WC nts=4 GGGG A.DG3,A.DG8,A.DG22,A.DG17
step#2 pp(><,inward) area=13.88 rise=3.39 twist=30.2

Download PDB file
Interactive view in 3Dmol.js

 3  glyco-bond=s--s groove=w-n- Major-->WC nts=4 GGGG A.DG3,A.DG8,A.DG22,A.DG17
4 glyco-bond=-ss- groove=w-n- WC-->Major nts=4 GGGG A.DG4,A.DG7,A.DG21,A.DG18
step#3 mm(<>,outward) area=17.43 rise=3.05 twist=13.8

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem [summary · schematics · tetrads · helices · costacks · homepage]

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 4 G-tetrad layers, 3 loops, INTRA-molecular, UDDU, anti-parallel, 4(-LwD+Ln), basket(2+2)

 1  glyco-bond=s--s groove=w-n- Major-->WC nts=4 GGGG A.DG1,A.DG10,A.DG24,A.DG15
 2  glyco-bond=-ss- groove=w-n- WC-->Major nts=4 GGGG A.DG2,A.DG9,A.DG23,A.DG16
 3  glyco-bond=s--s groove=w-n- Major-->WC nts=4 GGGG A.DG3,A.DG8,A.DG22,A.DG17
 4  glyco-bond=-ss- groove=w-n- WC-->Major nts=4 GGGG A.DG4,A.DG7,A.DG21,A.DG18
  step#1  mm(<>,outward)  area=9.79  rise=3.06 twist=24.9
  step#2  pp(><,inward)   area=13.88 rise=3.39 twist=30.2
  step#3  mm(<>,outward)  area=17.43 rise=3.05 twist=13.8
  strand#1  U DNA glyco-bond=s-s- nts=4 GGGG A.DG1,A.DG2,A.DG3,A.DG4
  strand#2  D DNA glyco-bond=-s-s nts=4 GGGG A.DG10,A.DG9,A.DG8,A.DG7
  strand#3  D DNA glyco-bond=-s-s nts=4 GGGG A.DG24,A.DG23,A.DG22,A.DG21
  strand#4  U DNA glyco-bond=s-s- nts=4 GGGG A.DG15,A.DG16,A.DG17,A.DG18
  loop#1 type=lateral   strands=[#1,#2] nts=2 TT A.DT5,A.DT6
  loop#2 type=diagonal  strands=[#2,#4] nts=4 TTTT A.DT11,A.DT12,A.DT13,A.DT14
  loop#3 type=lateral   strands=[#4,#3] nts=2 AA A.DA19,A.DA20

Download PDB file
Interactive view in 3Dmol.js

List of 0 G4 coaxial stacks [summary · schematics · tetrads · helices · stems · homepage]

List of 0 non-stem G4-loops (including the two closing Gs)