Summary information

PDB id
2m8z
Class
DNA
Method
NMR
Summary
Structure of d[ggttggcgcgaagcattcgcgggttgg] quadruplex-duplex hybrid
Reference
Lim KW, Phan AT (2013): "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995.
Abstract
 
G4 notes
2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD

Base-block schematics in six views

PyMOL session file PDB file View in 3Dmol.js

List of 2 G-tetrads

 1 glyco-bond=s-s- sugar=---- groove=wnwn planarity=0.095 type=planar nts=4 GGGG A.DG1,A.DG27,A.DG22,A.DG6
 2 glyco-bond=-s-s sugar=---- groove=wnwn planarity=0.181 type=other  nts=4 GGGG A.DG2,A.DG26,A.DG23,A.DG5

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 2 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=s-s- sugar=---- groove=wnwn Major-->WC nts=4 GGGG A.DG1,A.DG27,A.DG22,A.DG6
 2  glyco-bond=-s-s sugar=---- groove=wnwn WC-->Major nts=4 GGGG A.DG2,A.DG26,A.DG23,A.DG5
  step#1  mm(<>,outward)  area=14.08 rise=3.90 twist=18.9
  strand#1 DNA glyco-bond=s- sugar=-- nts=2 GG A.DG1,A.DG2
  strand#2 DNA glyco-bond=-s sugar=-- nts=2 GG A.DG27,A.DG26
  strand#3 DNA glyco-bond=s- sugar=-- nts=2 GG A.DG22,A.DG23
  strand#4 DNA glyco-bond=-s sugar=-- nts=2 GG A.DG6,A.DG5

Download PDB file
Interactive view in 3Dmol.js

1 stacking diagram
 1  glyco-bond=s-s- sugar=---- groove=wnwn Major-->WC nts=4 GGGG A.DG1,A.DG27,A.DG22,A.DG6
2 glyco-bond=-s-s sugar=---- groove=wnwn WC-->Major nts=4 GGGG A.DG2,A.DG26,A.DG23,A.DG5
step#1 mm(<>,outward) area=14.08 rise=3.90 twist=18.9

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 2 G-tetrad layers, 3 loops, INTRA-molecular, UDUD, anti-parallel, 2(+Ln+Lw+Ln), chair(2+2)

 1  glyco-bond=s-s- sugar=---- groove=wnwn Major-->WC nts=4 GGGG A.DG1,A.DG27,A.DG22,A.DG6
 2  glyco-bond=-s-s sugar=---- groove=wnwn WC-->Major nts=4 GGGG A.DG2,A.DG26,A.DG23,A.DG5
  step#1  mm(<>,outward)  area=14.08 rise=3.90 twist=18.9
  strand#1  U DNA glyco-bond=s- sugar=-- nts=2 GG A.DG1,A.DG2
  strand#2  D DNA glyco-bond=-s sugar=-- nts=2 GG A.DG27,A.DG26
  strand#3  U DNA glyco-bond=s- sugar=-- nts=2 GG A.DG22,A.DG23
  strand#4  D DNA glyco-bond=-s sugar=-- nts=2 GG A.DG6,A.DG5
  loop#1 type=lateral   strands=[#1,#4] nts=2 TT A.DT3,A.DT4
  loop#2 type=lateral   strands=[#4,#3] nts=15 CGCGAAGCATTCGCG A.DC7,A.DG8,A.DC9,A.DG10,A.DA11,A.DA12,A.DG13,A.DC14,A.DA15,A.DT16,A.DT17,A.DC18,A.DG19,A.DC20,A.DG21
  loop#3 type=lateral   strands=[#3,#2] nts=2 TT A.DT24,A.DT25

Download PDB file
Interactive view in 3Dmol.js