Summary information

PDB id
2m90
Class
DNA
Method
NMR
Summary
Structure of d[gcgcgaagcattcgcggggaggtggggaaggg] quadruplex-duplex hybrid
Reference
Lim KW, Phan AT (2013): "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995.
Abstract
 
G4 notes
3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU

Base-block schematics in six views

PyMOL session file PDB file View in 3Dmol.js

List of 3 G-tetrads

 1 glyco-bond=s--- sugar=---- groove=w--n planarity=0.089 type=planar nts=4 GGGG A.DG1,A.DG17,A.DG30,A.DG24
 2 glyco-bond=---- sugar=-.-- groove=---- planarity=0.095 type=planar nts=4 GGGG A.DG18,A.DG21,A.DG25,A.DG31
 3 glyco-bond=---- sugar=---- groove=---- planarity=0.043 type=planar nts=4 GGGG A.DG19,A.DG22,A.DG26,A.DG32

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 3 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=s--- sugar=---- groove=w--n Major-->WC nts=4 GGGG A.DG1,A.DG17,A.DG30,A.DG24
 2  glyco-bond=---- sugar=.--- groove=---- Major-->WC nts=4 GGGG A.DG21,A.DG18,A.DG31,A.DG25
 3  glyco-bond=---- sugar=---- groove=---- Major-->WC nts=4 GGGG A.DG22,A.DG19,A.DG32,A.DG26
  step#1  pm(>>,forward)  area=10.57 rise=3.51 twist=31.8
  step#2  pm(>>,forward)  area=10.82 rise=3.34 twist=31.4
  strand#1 DNA glyco-bond=s-- sugar=-.- nts=3 GGG A.DG1,A.DG21,A.DG22
  strand#2 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG17,A.DG18,A.DG19
  strand#3 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG30,A.DG31,A.DG32
  strand#4 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG24,A.DG25,A.DG26

Download PDB file
Interactive view in 3Dmol.js

2 stacking diagrams
 1  glyco-bond=s--- sugar=---- groove=w--n Major-->WC nts=4 GGGG A.DG1,A.DG17,A.DG30,A.DG24
2 glyco-bond=---- sugar=.--- groove=---- Major-->WC nts=4 GGGG A.DG21,A.DG18,A.DG31,A.DG25
step#1 pm(>>,forward) area=10.57 rise=3.51 twist=31.8

Download PDB file
Interactive view in 3Dmol.js

 2  glyco-bond=---- sugar=.--- groove=---- Major-->WC nts=4 GGGG A.DG21,A.DG18,A.DG31,A.DG25
3 glyco-bond=---- sugar=---- groove=---- Major-->WC nts=4 GGGG A.DG22,A.DG19,A.DG32,A.DG26
step#2 pm(>>,forward) area=10.82 rise=3.34 twist=31.4

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 2 G-tetrad layers, 3 loops, INTRA-molecular, UUUU, parallel, 2(-P-P-P), parallel(4+0)

 1  glyco-bond=---- sugar=-.-- groove=---- WC-->Major nts=4 GGGG A.DG18,A.DG21,A.DG25,A.DG31
 2  glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG19,A.DG22,A.DG26,A.DG32
  step#1  pm(>>,forward)  area=10.82 rise=3.34 twist=31.4
  strand#1  U DNA glyco-bond=-- sugar=-- nts=2 GG A.DG18,A.DG19
  strand#2  U DNA glyco-bond=-- sugar=.- nts=2 GG A.DG21,A.DG22
  strand#3  U DNA glyco-bond=-- sugar=-- nts=2 GG A.DG25,A.DG26
  strand#4  U DNA glyco-bond=-- sugar=-- nts=2 GG A.DG31,A.DG32
  loop#1 type=propeller strands=[#1,#2] nts=1 A A.DA20
  loop#2 type=propeller strands=[#2,#3] nts=2 TG A.DT23,A.DG24
  loop#3 type=propeller strands=[#3,#4] nts=4 GAAG A.DG27,A.DA28,A.DA29,A.DG30

Download PDB file
Interactive view in 3Dmol.js

List of 1 non-stem G4-loop (including the two closing Gs)

 1 type=lateral   helix=#1 nts=17 GCGCGAAGCATTCGCGG A.DG1,A.DC2,A.DG3,A.DC4,A.DG5,A.DA6,A.DA7,A.DG8,A.DC9,A.DA10,A.DT11,A.DT12,A.DC13,A.DG14,A.DC15,A.DG16,A.DG17