Summary information

PDB id
2m91
Class
DNA
Method
NMR
Summary
Structure of d[gggaagggcgcgaagcattcgcgaggtagg] quadruplex-duplex hybrid
Reference
Lim KW, Phan AT (2013): "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995.
Abstract
 
G4 notes
2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU

Base-block schematics in six views

PyMOL session file PDB file View in 3Dmol.js

List of 2 G-tetrads

 1 glyco-bond=s--s sugar=---- groove=w-n- planarity=0.105 type=planar nts=4 GGGG A.DG1,A.DG7,A.DG30,A.DG25
 2 glyco-bond=-ss- sugar=---- groove=w-n- planarity=0.168 type=other  nts=4 GGGG A.DG2,A.DG6,A.DG29,A.DG26

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 2 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=s--s sugar=---- groove=w-n- Major-->WC nts=4 GGGG A.DG1,A.DG7,A.DG30,A.DG25
 2  glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major nts=4 GGGG A.DG2,A.DG6,A.DG29,A.DG26
  step#1  mm(<>,outward)  area=12.85 rise=3.95 twist=19.4
  strand#1 DNA glyco-bond=s- sugar=-- nts=2 GG A.DG1,A.DG2
  strand#2 DNA glyco-bond=-s sugar=-- nts=2 GG A.DG7,A.DG6
  strand#3 DNA glyco-bond=-s sugar=-- nts=2 GG A.DG30,A.DG29
  strand#4 DNA glyco-bond=s- sugar=-- nts=2 GG A.DG25,A.DG26

Download PDB file
Interactive view in 3Dmol.js

1 stacking diagram
 1  glyco-bond=s--s sugar=---- groove=w-n- Major-->WC nts=4 GGGG A.DG1,A.DG7,A.DG30,A.DG25
2 glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major nts=4 GGGG A.DG2,A.DG6,A.DG29,A.DG26
step#1 mm(<>,outward) area=12.85 rise=3.95 twist=19.4

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 2 G-tetrad layers, 3 loops, INTRA-molecular, UDDU, anti-parallel, 2(-LwD+Ln), basket(2+2)

 1  glyco-bond=s--s sugar=---- groove=w-n- Major-->WC nts=4 GGGG A.DG1,A.DG7,A.DG30,A.DG25
 2  glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major nts=4 GGGG A.DG2,A.DG6,A.DG29,A.DG26
  step#1  mm(<>,outward)  area=12.85 rise=3.95 twist=19.4
  strand#1  U DNA glyco-bond=s- sugar=-- nts=2 GG A.DG1,A.DG2
  strand#2  D DNA glyco-bond=-s sugar=-- nts=2 GG A.DG7,A.DG6
  strand#3  D DNA glyco-bond=-s sugar=-- nts=2 GG A.DG30,A.DG29
  strand#4  U DNA glyco-bond=s- sugar=-- nts=2 GG A.DG25,A.DG26
  loop#1 type=lateral   strands=[#1,#2] nts=3 GAA A.DG3,A.DA4,A.DA5
  loop#2 type=diagonal  strands=[#2,#4] nts=17 GCGCGAAGCATTCGCGA A.DG8,A.DC9,A.DG10,A.DC11,A.DG12,A.DA13,A.DA14,A.DG15,A.DC16,A.DA17,A.DT18,A.DT19,A.DC20,A.DG21,A.DC22,A.DG23,A.DA24
  loop#3 type=lateral   strands=[#4,#3] nts=2 TA A.DT27,A.DA28

Download PDB file
Interactive view in 3Dmol.js