Summary information

PDB id
2m92
Class
DNA
Method
NMR
Summary
Structure of d[agggtgggtgctggggcgcgaagcattcgcgagg] quadruplex-duplex hybrid
Reference
Lim KW, Phan AT (2013): "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995.
Abstract
 
G4 notes
3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PX+P), parallel(4+0), UUUU

Base-block schematics in six views

PyMOL session file PDB file View in 3Dmol.js

List of 3 G-tetrads

 1 glyco-bond=---- sugar=---- groove=---- planarity=0.068 type=planar nts=4 GGGG A.DG2,A.DG6,A.DG10,A.DG13
 2 glyco-bond=---- sugar=--3- groove=---- planarity=0.141 type=planar nts=4 GGGG A.DG3,A.DG7,A.DG33,A.DG14
 3 glyco-bond=---- sugar=---- groove=---- planarity=0.100 type=planar nts=4 GGGG A.DG4,A.DG8,A.DG34,A.DG15

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 3 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG2,A.DG6,A.DG10,A.DG13
 2  glyco-bond=---- sugar=--3- groove=---- WC-->Major nts=4 GGGG A.DG3,A.DG7,A.DG33,A.DG14
 3  glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG4,A.DG8,A.DG34,A.DG15
  step#1  pm(>>,forward)  area=12.43 rise=3.19 twist=29.1
  step#2  pm(>>,forward)  area=12.59 rise=3.28 twist=29.9
  strand#1 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG2,A.DG3,A.DG4
  strand#2 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG6,A.DG7,A.DG8
  strand#3 DNA glyco-bond=--- sugar=-3- nts=3 GGG A.DG10,A.DG33,A.DG34
  strand#4 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG13,A.DG14,A.DG15

Download PDB file
Interactive view in 3Dmol.js
2 stacking diagrams 
 1  glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG2,A.DG6,A.DG10,A.DG13
 2  glyco-bond=---- sugar=--3- groove=---- WC-->Major nts=4 GGGG A.DG3,A.DG7,A.DG33,A.DG14
  step#1  pm(>>,forward)  area=12.43 rise=3.19 twist=29.1

Download PDB file
Interactive view in 3Dmol.js

 
 2  glyco-bond=---- sugar=--3- groove=---- WC-->Major nts=4 GGGG A.DG3,A.DG7,A.DG33,A.DG14
 3  glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG4,A.DG8,A.DG34,A.DG15
  step#2  pm(>>,forward)  area=12.59 rise=3.28 twist=29.9

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 2 G-tetrad layers, 3 loops, INTRA-molecular, UUUU, parallel, 2(-PX+P), parallel(4+0)

 1  glyco-bond=---- sugar=--3- groove=---- WC-->Major nts=4 GGGG A.DG3,A.DG7,A.DG33,A.DG14
 2  glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG4,A.DG8,A.DG34,A.DG15
  step#1  pm(>>,forward)  area=12.59 rise=3.28 twist=29.9
  strand#1  U DNA glyco-bond=-- sugar=-- nts=2 GG A.DG3,A.DG4
  strand#2  U DNA glyco-bond=-- sugar=-- nts=2 GG A.DG7,A.DG8
  strand#3  U DNA glyco-bond=-- sugar=3- nts=2 GG A.DG33,A.DG34
  strand#4  U DNA glyco-bond=-- sugar=-- nts=2 GG A.DG14,A.DG15
  loop#1 type=propeller strands=[#1,#2] nts=2 TG A.DT5,A.DG6
  loop#2 type=diag-prop strands=[#2,#4] nts=5 TGCTG A.DT9,A.DG10,A.DC11,A.DT12,A.DG13
  loop#3 type=propeller strands=[#4,#3] nts=17 GCGCGAAGCATTCGCGA A.DG16,A.DC17,A.DG18,A.DC19,A.DG20,A.DA21,A.DA22,A.DG23,A.DC24,A.DA25,A.DT26,A.DT27,A.DC28,A.DG29,A.DC30,A.DG31,A.DA32

Download PDB file
Interactive view in 3Dmol.js

List of 2 non-stem G4-loops (including the two closing Gs)

 1* type=V-shaped  helix=#1 nts=5 GGGTG A.DG6,A.DG7,A.DG8,A.DT9,A.DG10
 2 type=lateral   helix=#1 nts=4 GCTG A.DG10,A.DC11,A.DT12,A.DG13