Summary information

PDB id
2m93
Class
DNA
Method
NMR
Summary
Structure of d[ttgggtgggcgcgaagcattcgcggggtgggt] quadruplex-duplex hybrid
Reference
Lim KW, Phan AT (2013): "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995.
Abstract
 
G4 notes
3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU

Base-block schematics in six views

PyMOL session file PDB file View in 3Dmol.js

List of 3 G-tetrads

 1 glyco-bond=---- sugar=---. groove=---- planarity=0.119 type=planar nts=4 GGGG A.DG3,A.DG7,A.DG25,A.DG29
 2 glyco-bond=---- sugar=---- groove=---- planarity=0.061 type=planar nts=4 GGGG A.DG4,A.DG8,A.DG26,A.DG30
 3 glyco-bond=---- sugar=---- groove=---- planarity=0.034 type=planar nts=4 GGGG A.DG5,A.DG9,A.DG27,A.DG31

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 3 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=---- sugar=---. groove=---- WC-->Major nts=4 GGGG A.DG3,A.DG7,A.DG25,A.DG29
 2  glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG4,A.DG8,A.DG26,A.DG30
 3  glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG5,A.DG9,A.DG27,A.DG31
  step#1  pm(>>,forward)  area=13.75 rise=3.28 twist=29.4
  step#2  pm(>>,forward)  area=11.75 rise=3.19 twist=31.5
  strand#1 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG3,A.DG4,A.DG5
  strand#2 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG7,A.DG8,A.DG9
  strand#3 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG25,A.DG26,A.DG27
  strand#4 DNA glyco-bond=--- sugar=.-- nts=3 GGG A.DG29,A.DG30,A.DG31

Download PDB file
Interactive view in 3Dmol.js

2 stacking diagrams
 1  glyco-bond=---- sugar=---. groove=---- WC-->Major nts=4 GGGG A.DG3,A.DG7,A.DG25,A.DG29
2 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG4,A.DG8,A.DG26,A.DG30
step#1 pm(>>,forward) area=13.75 rise=3.28 twist=29.4

Download PDB file
Interactive view in 3Dmol.js

 2  glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG4,A.DG8,A.DG26,A.DG30
3 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG5,A.DG9,A.DG27,A.DG31
step#2 pm(>>,forward) area=11.75 rise=3.19 twist=31.5

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 3 G-tetrad layers, 3 loops, INTRA-molecular, UUUU, parallel, 3(-P-P-P), parallel(4+0)

 1  glyco-bond=---- sugar=---. groove=---- WC-->Major nts=4 GGGG A.DG3,A.DG7,A.DG25,A.DG29
 2  glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG4,A.DG8,A.DG26,A.DG30
 3  glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG5,A.DG9,A.DG27,A.DG31
  step#1  pm(>>,forward)  area=13.75 rise=3.28 twist=29.4
  step#2  pm(>>,forward)  area=11.75 rise=3.19 twist=31.5
  strand#1  U DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG3,A.DG4,A.DG5
  strand#2  U DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG7,A.DG8,A.DG9
  strand#3  U DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG25,A.DG26,A.DG27
  strand#4  U DNA glyco-bond=--- sugar=.-- nts=3 GGG A.DG29,A.DG30,A.DG31
  loop#1 type=propeller strands=[#1,#2] nts=1 T A.DT6
  loop#2 type=propeller strands=[#2,#3] nts=15 CGCGAAGCATTCGCG A.DC10,A.DG11,A.DC12,A.DG13,A.DA14,A.DA15,A.DG16,A.DC17,A.DA18,A.DT19,A.DT20,A.DC21,A.DG22,A.DC23,A.DG24
  loop#3 type=propeller strands=[#3,#4] nts=1 T A.DT28

Download PDB file
Interactive view in 3Dmol.js