Summary information [schematics · tetrads · helices · stems · costacks · homepage]

PDB-id
4h29
Class
DNA
Method
X-ray (1.99 Å)
Summary
B-raf dimer DNA quadruplex
Reference
Wei, D., Todd, A.K., Zloh, M., Gunaratnam, M., Parkinson, G.N., Neidle, S.: (2013) "Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex." J.Am.Chem.Soc., 135, 19319-19329.
Abstract
The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G·C·G·C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3' and 5' ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.
G4 notes
7 G-tetrads, 1 G4 helix, 3 G4 stems, 1 G4 coaxial stack · (2+2), UDUD; parallel(4+0), UUUU · coaxial interfaces: mixed; 3'/5'

Base-block schematics in six views [summary · tetrads · helices · stems · costacks · homepage]

PyMOL session file PDB file View in 3Dmol.js

List of 7 G-tetrads [summary · schematics · helices · stems · costacks · homepage]

 1 glyco-bond=s-s- groove=wnwn planarity=0.391 type=saddle nts=4 GGGG A.DG1,A.DG6,B.DG1,B.DG6
 2 glyco-bond=-s-s groove=wnwn planarity=0.468 type=bowl-2 nts=4 GGGG A.DG2,A.DG5,B.DG2,B.DG5
 3 glyco-bond=---- groove=---- planarity=0.159 type=planar nts=4 GGGG A.DG7,A.DG10,B.DG7,B.DG10
 4 glyco-bond=---- groove=---- planarity=0.177 type=bowl-2 nts=4 GGGG A.DG8,A.DG11,B.DG8,B.DG11
 5 glyco-bond=---- groove=---- planarity=0.187 type=bowl-2 nts=4 GGGG A.DG12,A.DG17,B.DG12,B.DG17
 6 glyco-bond=---- groove=---- planarity=0.161 type=other  nts=4 GGGG A.DG13,A.DG18,B.DG13,B.DG18
 7 glyco-bond=---- groove=---- planarity=0.311 type=bowl   nts=4 GGGG A.DG14,A.DG19,B.DG14,B.DG19

List of 1 G4-helix [summary · schematics · tetrads · stems · costacks · homepage]

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 7 G-tetrad layers, inter-molecular, with 3 stems

 1  glyco-bond=-s-s groove=wnwn WC-->Major nts=4 GGGG A.DG2,A.DG5,B.DG2,B.DG5
 2* glyco-bond=s-s- groove=wnwn Major-->WC nts=4 GGGG A.DG1,A.DG6,B.DG1,B.DG6
 3  glyco-bond=---- groove=---- Major-->WC nts=4 GGGG A.DG10,A.DG7,B.DG10,B.DG7
 4* glyco-bond=---- groove=---- Major-->WC nts=4 GGGG A.DG11,A.DG8,B.DG11,B.DG8
 5  glyco-bond=---- groove=---- Major-->WC nts=4 GGGG A.DG12,B.DG17,B.DG12,A.DG17
 6  glyco-bond=---- groove=---- Major-->WC nts=4 GGGG A.DG13,B.DG18,B.DG13,A.DG18
 7  glyco-bond=---- groove=---- Major-->WC nts=4 GGGG A.DG14,B.DG19,B.DG14,A.DG19
  step#1  mm(<>,outward)  area=13.40 rise=3.52 twist=17.6
  step#2  pm(>>,forward)  area=9.35  rise=3.46 twist=32.8
  step#3  pm(>>,forward)  area=9.52  rise=3.37 twist=33.0
  step#4  pm(>>,forward)  area=14.57 rise=3.44 twist=25.6
  step#5  pm(>>,forward)  area=9.99  rise=3.42 twist=31.2
  step#6  pm(>>,forward)  area=12.24 rise=3.50 twist=26.8
  strand#1 DNA glyco-bond=-s----- nts=7 GGGGGGG A.DG2,A.DG1,A.DG10,A.DG11,A.DG12,A.DG13,A.DG14
  strand#2 DNA glyco-bond=s------ nts=7 GGGGGGG A.DG5,A.DG6,A.DG7,A.DG8,B.DG17,B.DG18,B.DG19
  strand#3 DNA glyco-bond=-s----- nts=7 GGGGGGG B.DG2,B.DG1,B.DG10,B.DG11,B.DG12,B.DG13,B.DG14
  strand#4 DNA glyco-bond=s------ nts=7 GGGGGGG B.DG5,B.DG6,B.DG7,B.DG8,A.DG17,A.DG18,A.DG19

Download PDB file
Interactive view in 3Dmol.js

6 stacking diagrams
 1  glyco-bond=-s-s groove=wnwn WC-->Major nts=4 GGGG A.DG2,A.DG5,B.DG2,B.DG5
2* glyco-bond=s-s- groove=wnwn Major-->WC nts=4 GGGG A.DG1,A.DG6,B.DG1,B.DG6
step#1 mm(<>,outward) area=13.40 rise=3.52 twist=17.6

Download PDB file
Interactive view in 3Dmol.js

 2* glyco-bond=s-s- groove=wnwn Major-->WC nts=4 GGGG A.DG1,A.DG6,B.DG1,B.DG6
3 glyco-bond=---- groove=---- Major-->WC nts=4 GGGG A.DG10,A.DG7,B.DG10,B.DG7
step#2 pm(>>,forward) area=9.35 rise=3.46 twist=32.8

Download PDB file
Interactive view in 3Dmol.js

 3  glyco-bond=---- groove=---- Major-->WC nts=4 GGGG A.DG10,A.DG7,B.DG10,B.DG7
4* glyco-bond=---- groove=---- Major-->WC nts=4 GGGG A.DG11,A.DG8,B.DG11,B.DG8
step#3 pm(>>,forward) area=9.52 rise=3.37 twist=33.0

Download PDB file
Interactive view in 3Dmol.js

 4* glyco-bond=---- groove=---- Major-->WC nts=4 GGGG A.DG11,A.DG8,B.DG11,B.DG8
5 glyco-bond=---- groove=---- Major-->WC nts=4 GGGG A.DG12,B.DG17,B.DG12,A.DG17
step#4 pm(>>,forward) area=14.57 rise=3.44 twist=25.6

Download PDB file
Interactive view in 3Dmol.js

 5  glyco-bond=---- groove=---- Major-->WC nts=4 GGGG A.DG12,B.DG17,B.DG12,A.DG17
6 glyco-bond=---- groove=---- Major-->WC nts=4 GGGG A.DG13,B.DG18,B.DG13,A.DG18
step#5 pm(>>,forward) area=9.99 rise=3.42 twist=31.2

Download PDB file
Interactive view in 3Dmol.js

 6  glyco-bond=---- groove=---- Major-->WC nts=4 GGGG A.DG13,B.DG18,B.DG13,A.DG18
7 glyco-bond=---- groove=---- Major-->WC nts=4 GGGG A.DG14,B.DG19,B.DG14,A.DG19
step#6 pm(>>,forward) area=12.24 rise=3.50 twist=26.8

Download PDB file
Interactive view in 3Dmol.js

List of 3 G4-stems [summary · schematics · tetrads · helices · costacks · homepage]

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 2 G-tetrad layers, 2 loops, inter-molecular, UDUD, anti-parallel, (2+2)

 1  glyco-bond=s-s- groove=wnwn Major-->WC nts=4 GGGG A.DG1,A.DG6,B.DG1,B.DG6
 2  glyco-bond=-s-s groove=wnwn WC-->Major nts=4 GGGG A.DG2,A.DG5,B.DG2,B.DG5
  step#1  mm(<>,outward)  area=13.40 rise=3.52 twist=17.6
  strand#1  U DNA glyco-bond=s- nts=2 GG A.DG1,A.DG2
  strand#2  D DNA glyco-bond=-s nts=2 GG A.DG6,A.DG5
  strand#3  U DNA glyco-bond=s- nts=2 GG B.DG1,B.DG2
  strand#4  D DNA glyco-bond=-s nts=2 GG B.DG6,B.DG5
  loop#1 type=lateral   strands=[#1,#2] nts=2 GC A.DG3,A.DC4
  loop#2 type=lateral   strands=[#3,#4] nts=2 GC B.DG3,B.DC4

Download PDB file
Interactive view in 3Dmol.js

Stem#2, 2 G-tetrad layers, 2 loops, inter-molecular, UUUU, parallel, parallel(4+0)

 1  glyco-bond=---- groove=---- WC-->Major nts=4 GGGG A.DG7,A.DG10,B.DG7,B.DG10
 2  glyco-bond=---- groove=---- WC-->Major nts=4 GGGG A.DG8,A.DG11,B.DG8,B.DG11
  step#1  pm(>>,forward)  area=9.52  rise=3.37 twist=33.0
  strand#1  U DNA glyco-bond=-- nts=2 GG A.DG7,A.DG8
  strand#2  U DNA glyco-bond=-- nts=2 GG A.DG10,A.DG11
  strand#3  U DNA glyco-bond=-- nts=2 GG B.DG7,B.DG8
  strand#4  U DNA glyco-bond=-- nts=2 GG B.DG10,B.DG11
  loop#1 type=propeller strands=[#1,#2] nts=1 A A.DA9
  loop#2 type=propeller strands=[#3,#4] nts=1 A B.DA9

Download PDB file
Interactive view in 3Dmol.js

Stem#3, 3 G-tetrad layers, 2 loops, inter-molecular, UUUU, parallel, parallel(4+0)

 1  glyco-bond=---- groove=---- WC-->Major nts=4 GGGG A.DG12,A.DG17,B.DG12,B.DG17
 2  glyco-bond=---- groove=---- WC-->Major nts=4 GGGG A.DG13,A.DG18,B.DG13,B.DG18
 3  glyco-bond=---- groove=---- WC-->Major nts=4 GGGG A.DG14,A.DG19,B.DG14,B.DG19
  step#1  pm(>>,forward)  area=9.99  rise=3.42 twist=31.2
  step#2  pm(>>,forward)  area=12.24 rise=3.50 twist=26.8
  strand#1  U DNA glyco-bond=--- nts=3 GGG A.DG12,A.DG13,A.DG14
  strand#2  U DNA glyco-bond=--- nts=3 GGG A.DG17,A.DG18,A.DG19
  strand#3  U DNA glyco-bond=--- nts=3 GGG B.DG12,B.DG13,B.DG14
  strand#4  U DNA glyco-bond=--- nts=3 GGG B.DG17,B.DG18,B.DG19
  loop#1 type=propeller strands=[#1,#2] nts=2 AA A.DA15,A.DA16
  loop#2 type=propeller strands=[#3,#4] nts=2 AA B.DA15,B.DA16

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4 coaxial stack [summary · schematics · tetrads · helices · stems · homepage]

 1 G4 helix#1 contains 3 G4 stems: [#1,#2,#3]  [mixed,3'/5']

List of 0 non-stem G4-loops (including the two closing Gs)