Summary information [schematics · tetrads · helices · stems · costacks · homepage]

immune system-RNA
X-ray (2.19 Å)
Crystal structure of an RNA aptamer in complex with fluorophore and fab
Huang, H., Suslov, N.B., Li, N.S., Shelke, S.A., Evans, M.E., Koldobskaya, Y., Rice, P.A., Piccirilli, J.A.: (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691.
Spinach is an in vitro-selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.
G4 notes
2 G-tetrads, 1 G4 helix, 1 G4 stem · 2(-PD+P), (2+2), UUDD

Base-block schematics in six views [summary · tetrads · helices · stems · costacks · homepage]

PyMOL session file PDB file View in 3Dmol.js

List of 2 G-tetrads [summary · schematics · helices · stems · costacks · homepage]

 1 glyco-bond=--s- groove=-wn- planarity=0.220 type=other  nts=4 GGGG R.G22,R.G26,R.G61,R.G57
 2 glyco-bond=--ss groove=-w-n planarity=0.115 type=planar nts=4 GGGG R.G23,R.G27,R.G59,R.G54

List of 1 G4-helix [summary · schematics · tetrads · stems · costacks · homepage]

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 2 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=--s- groove=-wn- WC-->Major nts=4 GGGG R.G22,R.G26,R.G61,R.G57
 2  glyco-bond=--ss groove=-w-n WC-->Major nts=4 GGGG R.G23,R.G27,R.G59,R.G54
  step#1  pm(>>,forward)  area=11.69 rise=3.19 twist=32.4
  strand#1 RNA glyco-bond=-- nts=2 GG R.G22,R.G23
  strand#2 RNA glyco-bond=-- nts=2 GG R.G26,R.G27
  strand#3 RNA glyco-bond=ss nts=2 GG R.G61,R.G59
  strand#4 RNA glyco-bond=-s nts=2 GG R.G57,R.G54

Download PDB file
Interactive view in 3Dmol.js

1 stacking diagram
 1  glyco-bond=--s- groove=-wn- WC-->Major nts=4 GGGG R.G22,R.G26,R.G61,R.G57
2 glyco-bond=--ss groove=-w-n WC-->Major nts=4 GGGG R.G23,R.G27,R.G59,R.G54
step#1 pm(>>,forward) area=11.69 rise=3.19 twist=32.4

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem [summary · schematics · tetrads · helices · costacks · homepage]

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 2 G-tetrad layers, 3 loops, INTRA-molecular, UUDD, anti-parallel, 2(-PD+P), (2+2)

 1  glyco-bond=--s- groove=-wn- WC-->Major nts=4 GGGG R.G22,R.G26,R.G61,R.G57
 2  glyco-bond=--ss groove=-w-n WC-->Major nts=4 GGGG R.G23,R.G27,R.G59,R.G54
  step#1  pm(>>,forward)  area=11.69 rise=3.19 twist=32.4
  strand#1  U RNA glyco-bond=-- nts=2 GG R.G22,R.G23
  strand#2  U RNA glyco-bond=-- nts=2 GG R.G26,R.G27
  strand#3* D RNA glyco-bond=ss nts=2 GG R.G61,R.G59 bulged-nts=1 U R.U60
  strand#4* D RNA glyco-bond=-s nts=2 GG R.G57,R.G54 bulged-nts=2 AU R.A56,R.U55
  loop#1 type=propeller strands=[#1,#2] nts=2 AC R.A24,R.C25
  loop#2 type=diagonal  strands=[#2,#4] nts=26 GUCCAGUGCGAAACACGCACUGUUGA R.G28,R.U29,R.C30,R.C31,R.A32,R.G33,R.U34,R.G35,R.C36,R.G37,R.A38,R.A39,R.A40,R.C41,R.A42,R.C43,R.G44,R.C45,R.A46,R.C47,R.U48,R.G49,R.U50,R.U51,R.G52,R.A53
  loop#3 type=propeller strands=[#4,#3] nts=1 A R.A58

Download PDB file
Interactive view in 3Dmol.js

List of 0 G4 coaxial stacks [summary · schematics · tetrads · helices · stems · homepage]

List of 0 non-stem G4-loops (including the two closing Gs)