Summary information

PDB id
4kze
Class
immune system-RNA
Method
X-ray (2.404 Å)
Summary
Crystal structure of an RNA aptamer in complex with fab
Reference
Huang H, Suslov NB, Li NS, Shelke SA, Evans ME, Koldobskaya Y, Rice PA, Piccirilli JA (2014): "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. doi: 10.1038/nchembio.1561.
Abstract
Spinach is an in vitro-selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.
G4 notes
2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD

Base-block schematics in six views

PyMOL session file PDB file View in 3Dmol.js

List of 2 G-tetrads

 1 glyco-bond=--s- sugar=-3-- groove=-wn- planarity=0.157 type=planar nts=4 GGGG R.G22,R.G26,R.G61,R.G57
 2 glyco-bond=--ss sugar=-3-3 groove=-w-n planarity=0.225 type=other  nts=4 GGGG R.G23,R.G27,R.G59,R.G54

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 2 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=--s- sugar=-3-- groove=-wn- WC-->Major nts=4 GGGG R.G22,R.G26,R.G61,R.G57
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major nts=4 GGGG R.G23,R.G27,R.G59,R.G54
  step#1  pm(>>,forward)  area=11.89 rise=3.28 twist=36.9
  strand#1 RNA glyco-bond=-- sugar=-- nts=2 GG R.G22,R.G23
  strand#2 RNA glyco-bond=-- sugar=33 nts=2 GG R.G26,R.G27
  strand#3 RNA glyco-bond=ss sugar=-- nts=2 GG R.G61,R.G59
  strand#4 RNA glyco-bond=-s sugar=-3 nts=2 GG R.G57,R.G54

Download PDB file
Interactive view in 3Dmol.js
1 stacking diagram 
 1  glyco-bond=--s- sugar=-3-- groove=-wn- WC-->Major nts=4 GGGG R.G22,R.G26,R.G61,R.G57
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major nts=4 GGGG R.G23,R.G27,R.G59,R.G54
  step#1  pm(>>,forward)  area=11.89 rise=3.28 twist=36.9

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 2 G-tetrad layers, 3 loops, INTRA-molecular, UUDD, anti-parallel, 2(-PD+P), (2+2)

 1  glyco-bond=--s- sugar=-3-- groove=-wn- WC-->Major nts=4 GGGG R.G22,R.G26,R.G61,R.G57
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major nts=4 GGGG R.G23,R.G27,R.G59,R.G54
  step#1  pm(>>,forward)  area=11.89 rise=3.28 twist=36.9
  strand#1  U RNA glyco-bond=-- sugar=-- nts=2 GG R.G22,R.G23
  strand#2  U RNA glyco-bond=-- sugar=33 nts=2 GG R.G26,R.G27
  strand#3* D RNA glyco-bond=ss sugar=-- nts=2 GG R.G61,R.G59 bulged-nts=1 U R.U60
  strand#4* D RNA glyco-bond=-s sugar=-3 nts=2 GG R.G57,R.G54 bulged-nts=2 AU R.A56,R.U55
  loop#1 type=propeller strands=[#1,#2] nts=2 AC R.A24,R.C25
  loop#2 type=diagonal  strands=[#2,#4] nts=26 GUCCAGUGCGAAACACGCACUGUUGA R.G28,R.U29,R.C30,R.C31,R.A32,R.G33,R.U34,R.G35,R.C36,R.G37,R.A38,R.A39,R.A40,R.C41,R.A42,R.C43,R.G44,R.C45,R.A46,R.C47,R.U48,R.G49,R.U50,R.U51,R.G52,R.A53
  loop#3 type=propeller strands=[#4,#3] nts=1 A R.A58

Download PDB file
Interactive view in 3Dmol.js