Summary information [schematics · tetrads · helices · stems · costacks · homepage]

PDB-id
4q9q
Class
RNA
Method
X-ray (2.45 Å)
Summary
Crystal structure of an RNA aptamer bound to bromo-ligand analog in complex with fab
Reference
Huang, H., Suslov, N.B., Li, N.S., Shelke, S.A., Evans, M.E., Koldobskaya, Y., Rice, P.A., Piccirilli, J.A.: (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691.
Abstract
Spinach is an in vitro-selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.
G4 notes
2 G-tetrads, 1 G4 helix, 1 G4 stem · 2(-PD+P), (2+2), UUDD

Base-block schematics in six views [summary · tetrads · helices · stems · costacks · homepage]

PyMOL session file PDB file View in 3Dmol.js

List of 2 G-tetrads [summary · schematics · helices · stems · costacks · homepage]

 1 glyco-bond=--s- groove=-wn- planarity=0.232 type=other  nts=4 GGGG R.G22,R.G26,R.G61,R.G57
 2 glyco-bond=--ss groove=-w-n planarity=0.154 type=planar nts=4 GGGG R.G23,R.G27,R.G59,R.G54

List of 1 G4-helix [summary · schematics · tetrads · stems · costacks · homepage]

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 2 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=--s- groove=-wn- WC-->Major nts=4 GGGG R.G22,R.G26,R.G61,R.G57
 2  glyco-bond=--ss groove=-w-n WC-->Major nts=4 GGGG R.G23,R.G27,R.G59,R.G54
  step#1  pm(>>,forward)  area=10.68 rise=3.19 twist=32.9
  strand#1 RNA glyco-bond=-- nts=2 GG R.G22,R.G23
  strand#2 RNA glyco-bond=-- nts=2 GG R.G26,R.G27
  strand#3 RNA glyco-bond=ss nts=2 GG R.G61,R.G59
  strand#4 RNA glyco-bond=-s nts=2 GG R.G57,R.G54

Download PDB file
Interactive view in 3Dmol.js

1 stacking diagram
 1  glyco-bond=--s- groove=-wn- WC-->Major nts=4 GGGG R.G22,R.G26,R.G61,R.G57
2 glyco-bond=--ss groove=-w-n WC-->Major nts=4 GGGG R.G23,R.G27,R.G59,R.G54
step#1 pm(>>,forward) area=10.68 rise=3.19 twist=32.9

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem [summary · schematics · tetrads · helices · costacks · homepage]

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 2 G-tetrad layers, 3 loops, INTRA-molecular, UUDD, anti-parallel, 2(-PD+P), (2+2)

 1  glyco-bond=--s- groove=-wn- WC-->Major nts=4 GGGG R.G22,R.G26,R.G61,R.G57
 2  glyco-bond=--ss groove=-w-n WC-->Major nts=4 GGGG R.G23,R.G27,R.G59,R.G54
  step#1  pm(>>,forward)  area=10.68 rise=3.19 twist=32.9
  strand#1  U RNA glyco-bond=-- nts=2 GG R.G22,R.G23
  strand#2  U RNA glyco-bond=-- nts=2 GG R.G26,R.G27
  strand#3* D RNA glyco-bond=ss nts=2 GG R.G61,R.G59 bulged-nts=1 U R.U60
  strand#4* D RNA glyco-bond=-s nts=2 GG R.G57,R.G54 bulged-nts=2 AU R.A56,R.U55
  loop#1 type=propeller strands=[#1,#2] nts=2 AC R.A24,R.C25
  loop#2 type=diagonal  strands=[#2,#4] nts=26 GUCCAGUGCGAAACACGCACUGUUGA R.G28,R.U29,R.C30,R.C31,R.A32,R.G33,R.U34,R.G35,R.C36,R.G37,R.A38,R.A39,R.A40,R.C41,R.A42,R.C43,R.G44,R.C45,R.A46,R.C47,R.U48,R.G49,R.U50,R.U51,R.G52,R.A53
  loop#3 type=propeller strands=[#4,#3] nts=1 A R.A58

Download PDB file
Interactive view in 3Dmol.js

List of 0 G4 coaxial stacks [summary · schematics · tetrads · helices · stems · homepage]

List of 0 non-stem G4-loops (including the two closing Gs)