Summary information

PDB id
5j05
Class
DNA
Method
NMR
Summary
Diy g-quadruplexes: solution structure of d(gggtttgggttttgggaggg) in sodium
Reference
Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018): "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007.
Abstract
The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
G4 notes
3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-LwD+Ln), basket(2+2), UDDU

Base-block schematics in six views

PyMOL session file PDB file View in 3Dmol.js

List of 3 G-tetrads

 1 glyco-bond=s--s sugar=--.- groove=w-n- planarity=0.145 type=planar nts=4 GGGG A.DG1,A.DG9,A.DG20,A.DG14
 2 glyco-bond=-ss- sugar=---- groove=w-n- planarity=0.151 type=planar nts=4 GGGG A.DG2,A.DG8,A.DG19,A.DG15
 3 glyco-bond=s--s sugar=33-3 groove=w-n- planarity=0.255 type=other  nts=4 GGGG A.DG3,A.DG7,A.DG18,A.DG16

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 3 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=s--s sugar=--.- groove=w-n- Major-->WC nts=4 GGGG A.DG1,A.DG9,A.DG20,A.DG14
 2  glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major nts=4 GGGG A.DG2,A.DG8,A.DG19,A.DG15
 3  glyco-bond=s--s sugar=33-3 groove=w-n- Major-->WC nts=4 GGGG A.DG3,A.DG7,A.DG18,A.DG16
  step#1  mm(<>,outward)  area=13.62 rise=3.18 twist=15.1
  step#2  pp(><,inward)   area=9.19  rise=3.13 twist=24.6
  strand#1 DNA glyco-bond=s-s sugar=--3 nts=3 GGG A.DG1,A.DG2,A.DG3
  strand#2 DNA glyco-bond=-s- sugar=--3 nts=3 GGG A.DG9,A.DG8,A.DG7
  strand#3 DNA glyco-bond=-s- sugar=.-- nts=3 GGG A.DG20,A.DG19,A.DG18
  strand#4 DNA glyco-bond=s-s sugar=--3 nts=3 GGG A.DG14,A.DG15,A.DG16

Download PDB file
Interactive view in 3Dmol.js
2 stacking diagrams 
 1  glyco-bond=s--s sugar=--.- groove=w-n- Major-->WC nts=4 GGGG A.DG1,A.DG9,A.DG20,A.DG14
 2  glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major nts=4 GGGG A.DG2,A.DG8,A.DG19,A.DG15
  step#1  mm(<>,outward)  area=13.62 rise=3.18 twist=15.1

Download PDB file
Interactive view in 3Dmol.js

 
 2  glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major nts=4 GGGG A.DG2,A.DG8,A.DG19,A.DG15
 3  glyco-bond=s--s sugar=33-3 groove=w-n- Major-->WC nts=4 GGGG A.DG3,A.DG7,A.DG18,A.DG16
  step#2  pp(><,inward)   area=9.19  rise=3.13 twist=24.6

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 3 G-tetrad layers, 3 loops, INTRA-molecular, UDDU, anti-parallel, 3(-LwD+Ln), basket(2+2)

 1  glyco-bond=s--s sugar=--.- groove=w-n- Major-->WC nts=4 GGGG A.DG1,A.DG9,A.DG20,A.DG14
 2  glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major nts=4 GGGG A.DG2,A.DG8,A.DG19,A.DG15
 3  glyco-bond=s--s sugar=33-3 groove=w-n- Major-->WC nts=4 GGGG A.DG3,A.DG7,A.DG18,A.DG16
  step#1  mm(<>,outward)  area=13.62 rise=3.18 twist=15.1
  step#2  pp(><,inward)   area=9.19  rise=3.13 twist=24.6
  strand#1  U DNA glyco-bond=s-s sugar=--3 nts=3 GGG A.DG1,A.DG2,A.DG3
  strand#2  D DNA glyco-bond=-s- sugar=--3 nts=3 GGG A.DG9,A.DG8,A.DG7
  strand#3  D DNA glyco-bond=-s- sugar=.-- nts=3 GGG A.DG20,A.DG19,A.DG18
  strand#4  U DNA glyco-bond=s-s sugar=--3 nts=3 GGG A.DG14,A.DG15,A.DG16
  loop#1 type=lateral   strands=[#1,#2] nts=3 TTT A.DT4,A.DT5,A.DT6
  loop#2 type=diagonal  strands=[#2,#4] nts=4 TTTT A.DT10,A.DT11,A.DT12,A.DT13
  loop#3 type=lateral   strands=[#4,#3] nts=1 A A.DA17

Download PDB file
Interactive view in 3Dmol.js