Summary information

PDB id
5ob3
Class
RNA
Method
X-ray (2.004 Å)
Summary
Ispinach aptamer
Reference
Fernandez-Millan P, Autour A, Ennifar E, Westhof E, Ryckelynck M (2017): "Crystal structure and fluorescence properties of the iSpinach aptamer in complex with DFHBI." RNA, 23, 1788-1795. doi: 10.1261/rna.063008.117.
Abstract
Fluorogenic RNA aptamers are short nucleic acids able to specifically interact with small molecules and strongly enhance their fluorescence upon complex formation. Among the different systems recently introduced, Spinach, an aptamer forming a fluorescent complex with the 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI), is one of the most promising. Using random mutagenesis and ultrahigh-throughput screening, we recently developed iSpinach, an improved version of the aptamer, endowed with an increased folding efficiency and thermal stability. iSpinach is a shorter version of Spinach comprising five mutations whom the exact role was not deciphered yet. In this work, we co-crystallized a re-engineered version of iSpinach in complex with the DFHBI and solved the x-ray structure of the complex at 2 Å resolution. Only a few mutations were required to optimize iSpinach production and crystallization, underlying the good folding capacity of the molecule. The measured fluorescence half-lives in the crystal were 60% higher than in solution. Comparisons with structures previously reported for Spinach allows shedding some light on the possible function of the different beneficial mutations carried by iSpinach.
G4 notes
2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD

Base-block schematics in six views

PyMOL session file PDB file View in 3Dmol.js

List of 2 G-tetrads

 1 glyco-bond=--s- sugar=-33. groove=-wn- planarity=0.297 type=other  nts=4 GGGG A.G15,A.G19,A.G53,A.G49
 2 glyco-bond=--ss sugar=-3-3 groove=-w-n planarity=0.194 type=other  nts=4 GGGG A.G16,A.G20,A.G51,A.G46

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 2 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=--s- sugar=-33. groove=-wn- WC-->Major nts=4 GGGG A.G15,A.G19,A.G53,A.G49
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major nts=4 GGGG A.G16,A.G20,A.G51,A.G46
  step#1  pm(>>,forward)  area=9.66  rise=3.33 twist=33.4
  strand#1 RNA glyco-bond=-- sugar=-- nts=2 GG A.G15,A.G16
  strand#2 RNA glyco-bond=-- sugar=33 nts=2 GG A.G19,A.G20
  strand#3 RNA glyco-bond=ss sugar=3- nts=2 GG A.G53,A.G51
  strand#4 RNA glyco-bond=-s sugar=.3 nts=2 GG A.G49,A.G46

Download PDB file
Interactive view in 3Dmol.js
1 stacking diagram 
 1  glyco-bond=--s- sugar=-33. groove=-wn- WC-->Major nts=4 GGGG A.G15,A.G19,A.G53,A.G49
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major nts=4 GGGG A.G16,A.G20,A.G51,A.G46
  step#1  pm(>>,forward)  area=9.66  rise=3.33 twist=33.4

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 2 G-tetrad layers, 3 loops, INTRA-molecular, UUDD, anti-parallel, 2(-PD+P), (2+2)

 1  glyco-bond=--s- sugar=-33. groove=-wn- WC-->Major nts=4 GGGG A.G15,A.G19,A.G53,A.G49
 2  glyco-bond=--ss sugar=-3-3 groove=-w-n WC-->Major nts=4 GGGG A.G16,A.G20,A.G51,A.G46
  step#1  pm(>>,forward)  area=9.66  rise=3.33 twist=33.4
  strand#1  U RNA glyco-bond=-- sugar=-- nts=2 GG A.G15,A.G16
  strand#2  U RNA glyco-bond=-- sugar=33 nts=2 GG A.G19,A.G20
  strand#3* D RNA glyco-bond=ss sugar=3- nts=2 GG A.G53,A.G51 bulged-nts=1 U A.U52
  strand#4* D RNA glyco-bond=-s sugar=.3 nts=2 GG A.G49,A.G46 bulged-nts=2 AU A.A48,A.U47
  loop#1 type=propeller strands=[#1,#2] nts=2 UC A.U17,A.C18
  loop#2 type=diagonal  strands=[#2,#4] nts=25 GUCCAGUAGGUACGCCUACUGUUGA A.G21,A.U22,A.C23,A.C24,A.A25,A.G26,A.U27,A.A28,A.G29,A.G30,A.U31,A.A32,A.C33,A.G34,A.C35,A.C36,A.U37,A.A38,A.C39,A.U40,A.G41,A.U42,A.U43,A.G44,A.A45
  loop#3 type=propeller strands=[#4,#3] nts=1 A A.A50

Download PDB file
Interactive view in 3Dmol.js