Summary information [schematics · tetrads · helices · stems · costacks · homepage]

PDB-id
6gh0
Class
DNA
Method
NMR
Summary
Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure
Reference
Kotar, A., Rigo, R., Sissi, C., Plavec, J.: (2019) "Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure." Nucleic Acids Res., 47, 2641-2653.
Abstract
In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.
G4 notes
2 G-tetrads, 1 G4 helix, 1 G4 stem · 2(-Lw-Ln-Lw), chair(2+2), UDUD

Base-block schematics in six views [summary · tetrads · helices · stems · costacks · homepage]

PyMOL session file PDB file View in 3Dmol.js

List of 2 G-tetrads [summary · schematics · helices · stems · costacks · homepage]

 1 glyco-bond=s-s- groove=wnwn planarity=0.237 type=other  nts=4 GGGG A.DG1,A.DG7,A.DG11,A.DG17
 2 glyco-bond=-s-s groove=wnwn planarity=0.231 type=other  nts=4 GGGG A.DG2,A.DG6,A.DG12,A.DG16

List of 1 G4-helix [summary · schematics · tetrads · stems · costacks · homepage]

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 2 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=s-s- groove=wnwn Major-->WC nts=4 GGGG A.DG1,A.DG7,A.DG11,A.DG17
 2  glyco-bond=-s-s groove=wnwn WC-->Major nts=4 GGGG A.DG2,A.DG6,A.DG12,A.DG16
  step#1  mm(<>,outward)  area=10.18 rise=3.44 twist=19.1
  strand#1 DNA glyco-bond=s- nts=2 GG A.DG1,A.DG2
  strand#2 DNA glyco-bond=-s nts=2 GG A.DG7,A.DG6
  strand#3 DNA glyco-bond=s- nts=2 GG A.DG11,A.DG12
  strand#4 DNA glyco-bond=-s nts=2 GG A.DG17,A.DG16

Download PDB file
Interactive view in 3Dmol.js

1 stacking diagram
 1  glyco-bond=s-s- groove=wnwn Major-->WC nts=4 GGGG A.DG1,A.DG7,A.DG11,A.DG17
2 glyco-bond=-s-s groove=wnwn WC-->Major nts=4 GGGG A.DG2,A.DG6,A.DG12,A.DG16
step#1 mm(<>,outward) area=10.18 rise=3.44 twist=19.1

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem [summary · schematics · tetrads · helices · costacks · homepage]

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 2 G-tetrad layers, 3 loops, INTRA-molecular, UDUD, anti-parallel, 2(-Lw-Ln-Lw), chair(2+2)

 1  glyco-bond=s-s- groove=wnwn Major-->WC nts=4 GGGG A.DG1,A.DG7,A.DG11,A.DG17
 2  glyco-bond=-s-s groove=wnwn WC-->Major nts=4 GGGG A.DG2,A.DG6,A.DG12,A.DG16
  step#1  mm(<>,outward)  area=10.18 rise=3.44 twist=19.1
  strand#1  U DNA glyco-bond=s- nts=2 GG A.DG1,A.DG2
  strand#2  D DNA glyco-bond=-s nts=2 GG A.DG7,A.DG6
  strand#3  U DNA glyco-bond=s- nts=2 GG A.DG11,A.DG12
  strand#4  D DNA glyco-bond=-s nts=2 GG A.DG17,A.DG16
  loop#1 type=lateral   strands=[#1,#2] nts=3 CGA A.DC3,A.DG4,A.DA5
  loop#2 type=lateral   strands=[#2,#3] nts=3 AGG A.DA8,A.DG9,A.DG10
  loop#3 type=lateral   strands=[#3,#4] nts=3 CGT A.DC13,A.DG14,A.DT15

Download PDB file
Interactive view in 3Dmol.js

List of 0 G4 coaxial stacks [summary · schematics · tetrads · helices · stems · homepage]

List of 0 non-stem G4-loops (including the two closing Gs)