Summary information

PDB id
6l8m
Class
DNA
Method
NMR
Summary
Wnt DNA promoter mutant g-quadruplex
Reference
Wang ZF, Li MH, Chu IT, Winnerdy FR, Phan AT, Chang TC (2020): "Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter." Nucleic Acids Res., 48, 1120-1130. doi: 10.1093/nar/gkz1207.
Abstract
Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.
G4 notes
3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD

Base-block schematics in six views

PyMOL session file PDB file View in 3Dmol.js

List of 3 G-tetrads

 1 glyco-bond=s--- sugar=-.-- groove=w--n planarity=0.061 type=planar nts=4 GGGG A.DG1,A.DG10,A.DG21,A.DG17
 2 glyco-bond=s--- sugar=3--- groove=w--n planarity=0.074 type=planar nts=4 GGGG A.DG2,A.DG9,A.DG20,A.DG16
 3 glyco-bond=---- sugar=-.-- groove=---- planarity=0.076 type=planar nts=4 GGGG A.DG11,A.DG14,A.DG18,A.DG22

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 3 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=s--- sugar=3--- groove=w--n Major-->WC nts=4 GGGG A.DG2,A.DG9,A.DG20,A.DG16
 2  glyco-bond=s--- sugar=-.-- groove=w--n Major-->WC nts=4 GGGG A.DG1,A.DG10,A.DG21,A.DG17
 3  glyco-bond=---- sugar=.--- groove=---- Major-->WC nts=4 GGGG A.DG14,A.DG11,A.DG22,A.DG18
  step#1  pm(>>,forward)  area=9.73  rise=3.42 twist=31.6
  step#2  pm(>>,forward)  area=15.16 rise=3.85 twist=28.6
  strand#1 DNA glyco-bond=ss- sugar=3-. nts=3 GGG A.DG2,A.DG1,A.DG14
  strand#2 DNA glyco-bond=--- sugar=-.- nts=3 GGG A.DG9,A.DG10,A.DG11
  strand#3 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG20,A.DG21,A.DG22
  strand#4 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG16,A.DG17,A.DG18

Download PDB file
Interactive view in 3Dmol.js
2 stacking diagrams 
 1  glyco-bond=s--- sugar=3--- groove=w--n Major-->WC nts=4 GGGG A.DG2,A.DG9,A.DG20,A.DG16
 2  glyco-bond=s--- sugar=-.-- groove=w--n Major-->WC nts=4 GGGG A.DG1,A.DG10,A.DG21,A.DG17
  step#1  pm(>>,forward)  area=9.73  rise=3.42 twist=31.6

Download PDB file
Interactive view in 3Dmol.js

 
 2  glyco-bond=s--- sugar=-.-- groove=w--n Major-->WC nts=4 GGGG A.DG1,A.DG10,A.DG21,A.DG17
 3  glyco-bond=---- sugar=.--- groove=---- Major-->WC nts=4 GGGG A.DG14,A.DG11,A.DG22,A.DG18
  step#2  pm(>>,forward)  area=15.16 rise=3.85 twist=28.6

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 2 G-tetrad layers, 3 loops, INTRA-molecular, UDDD, hybrid-(mixed), 2(-LwX+P), UD3(1+3)

 1  glyco-bond=s--- sugar=-.-- groove=w--n Major-->WC nts=4 GGGG A.DG1,A.DG10,A.DG21,A.DG17
 2  glyco-bond=s--- sugar=3--- groove=w--n Major-->WC nts=4 GGGG A.DG2,A.DG9,A.DG20,A.DG16
  step#1  mp(<<,backward) area=9.73  rise=3.42 twist=31.6
  strand#1  U DNA glyco-bond=ss sugar=-3 nts=2 GG A.DG1,A.DG2
  strand#2  D DNA glyco-bond=-- sugar=.- nts=2 GG A.DG10,A.DG9
  strand#3  D DNA glyco-bond=-- sugar=-- nts=2 GG A.DG21,A.DG20
  strand#4  D DNA glyco-bond=-- sugar=-- nts=2 GG A.DG17,A.DG16
  loop#1 type=lateral   strands=[#1,#2] nts=6 GTCACC A.DG3,A.DT4,A.DC5,A.DA6,A.DC7,A.DC8
  loop#2 type=diag-prop strands=[#2,#4] nts=5 GCAGT A.DG11,A.DC12,A.DA13,A.DG14,A.DT15
  loop#3 type=propeller strands=[#4,#3] nts=2 GC A.DG18,A.DC19

Download PDB file
Interactive view in 3Dmol.js

List of 2 non-stem G4-loops (including the two closing Gs)

 1 type=lateral   helix=#1 nts=4 GCAG A.DG11,A.DC12,A.DA13,A.DG14
 2 type=V-shaped  helix=#1 nts=5 GTGGG A.DG14,A.DT15,A.DG16,A.DG17,A.DG18