Summary information

PDB id
6l92
Class
DNA
Method
NMR
Summary
A basket type g-quadruplex in wnt DNA promoter
Reference
Wang ZF, Li MH, Chu IT, Winnerdy FR, Phan AT, Chang TC (2020): "Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter." Nucleic Acids Res., 48, 1120-1130. doi: 10.1093/nar/gkz1207.
Abstract
Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.
G4 notes
3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+LnD-P), (3+1), UUUD

Base-block schematics in six views

PyMOL session file PDB file View in 3Dmol.js

List of 3 G-tetrads

 1 glyco-bond=sss- sugar=---- groove=--wn planarity=0.070 type=planar nts=4 GGGG A.DG1,A.DG16,A.DG20,A.DG11
 2 glyco-bond=---s sugar=--.- groove=--wn planarity=0.062 type=planar nts=4 GGGG A.DG2,A.DG17,A.DG21,A.DG10
 3 glyco-bond=---s sugar=---- groove=--wn planarity=0.080 type=planar nts=4 GGGG A.DG3,A.DG18,A.DG22,A.DG9

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 3 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=sss- sugar=---- groove=--wn Major-->WC nts=4 GGGG A.DG1,A.DG16,A.DG20,A.DG11
 2  glyco-bond=---s sugar=--.- groove=--wn WC-->Major nts=4 GGGG A.DG2,A.DG17,A.DG21,A.DG10
 3  glyco-bond=---s sugar=---- groove=--wn WC-->Major nts=4 GGGG A.DG3,A.DG18,A.DG22,A.DG9
  step#1  mm(<>,outward)  area=13.87 rise=4.53 twist=16.2
  step#2  pm(>>,forward)  area=17.27 rise=4.48 twist=24.3
  strand#1 DNA glyco-bond=s-- sugar=--- nts=3 GGG A.DG1,A.DG2,A.DG3
  strand#2 DNA glyco-bond=s-- sugar=--- nts=3 GGG A.DG16,A.DG17,A.DG18
  strand#3 DNA glyco-bond=s-- sugar=-.- nts=3 GGG A.DG20,A.DG21,A.DG22
  strand#4 DNA glyco-bond=-ss sugar=--- nts=3 GGG A.DG11,A.DG10,A.DG9

Download PDB file
Interactive view in 3Dmol.js

2 stacking diagrams
 1  glyco-bond=sss- sugar=---- groove=--wn Major-->WC nts=4 GGGG A.DG1,A.DG16,A.DG20,A.DG11
2 glyco-bond=---s sugar=--.- groove=--wn WC-->Major nts=4 GGGG A.DG2,A.DG17,A.DG21,A.DG10
step#1 mm(<>,outward) area=13.87 rise=4.53 twist=16.2

Download PDB file
Interactive view in 3Dmol.js

 2  glyco-bond=---s sugar=--.- groove=--wn WC-->Major nts=4 GGGG A.DG2,A.DG17,A.DG21,A.DG10
3 glyco-bond=---s sugar=---- groove=--wn WC-->Major nts=4 GGGG A.DG3,A.DG18,A.DG22,A.DG9
step#2 pm(>>,forward) area=17.27 rise=4.48 twist=24.3

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 3 G-tetrad layers, 3 loops, INTRA-molecular, UUUD, hybrid-(mixed), 3(+LnD-P), (3+1)

 1  glyco-bond=sss- sugar=---- groove=--wn Major-->WC nts=4 GGGG A.DG1,A.DG16,A.DG20,A.DG11
 2  glyco-bond=---s sugar=--.- groove=--wn WC-->Major nts=4 GGGG A.DG2,A.DG17,A.DG21,A.DG10
 3  glyco-bond=---s sugar=---- groove=--wn WC-->Major nts=4 GGGG A.DG3,A.DG18,A.DG22,A.DG9
  step#1  mm(<>,outward)  area=13.87 rise=4.53 twist=16.2
  step#2  pm(>>,forward)  area=17.27 rise=4.48 twist=24.3
  strand#1  U DNA glyco-bond=s-- sugar=--- nts=3 GGG A.DG1,A.DG2,A.DG3
  strand#2  U DNA glyco-bond=s-- sugar=--- nts=3 GGG A.DG16,A.DG17,A.DG18
  strand#3  U DNA glyco-bond=s-- sugar=-.- nts=3 GGG A.DG20,A.DG21,A.DG22
  strand#4  D DNA glyco-bond=-ss sugar=--- nts=3 GGG A.DG11,A.DG10,A.DG9
  loop#1 type=lateral   strands=[#1,#4] nts=5 CCACC A.DC4,A.DC5,A.DA6,A.DC7,A.DC8
  loop#2 type=diagonal  strands=[#4,#2] nts=4 CAGT A.DC12,A.DA13,A.DG14,A.DT15
  loop#3 type=propeller strands=[#2,#3] nts=1 C A.DC19

Download PDB file
Interactive view in 3Dmol.js