Summary information

PDB id
7oa3
Class
RNA
Method
X-ray (2.8 Å)
Summary
Crystal structure of chili RNA aptamer in complex with dmhbo+ (iridium hexammine co-crystallized form)
Reference
Mieczkowski M, Steinmetzger C, Bessi I, Lenz AK, Schmiedel A, Holzapfel M, Lambert C, Pena V, Hobartner C (2021): "Large Stokes shift fluorescence activation in an RNA aptamer by intermolecular proton transfer to guanine." Nat Commun, 12, 3549. doi: 10.1038/s41467-021-23932-0.
Abstract
Fluorogenic RNA aptamers are synthetic functional RNAs that specifically bind and activate conditional fluorophores. The Chili RNA aptamer mimics large Stokes shift fluorescent proteins and exhibits high affinity for 3,5-dimethoxy-4-hydroxybenzylidene imidazolone (DMHBI) derivatives to elicit green or red fluorescence emission. Here, we elucidate the structural and mechanistic basis of fluorescence activation by crystallography and time-resolved optical spectroscopy. Two co-crystal structures of the Chili RNA with positively charged DMHBO+ and DMHBI+ ligands revealed a G-quadruplex and a trans-sugar-sugar edge G:G base pair that immobilize the ligand by π-π stacking. A Watson-Crick G:C base pair in the fluorophore binding site establishes a short hydrogen bond between the N7 of guanine and the phenolic OH of the ligand. Ultrafast excited state proton transfer (ESPT) from the neutral chromophore to the RNA was found with a time constant of 130 fs and revealed the mode of action of the large Stokes shift fluorogenic RNA aptamer.
G4 notes
4 G-tetrads, 2 G4 helices

Base-block schematics in six views

PyMOL session file PDB file View in 3Dmol.js

List of 4 G-tetrads

 1 glyco-bond=---- sugar=-3-3 groove=---- planarity=0.328 type=other  nts=4 GGGG A.G9,A.G12,A.G42,A.G36
 2 glyco-bond=---- sugar=---3 groove=---- planarity=0.228 type=other  nts=4 GGGG A.G13,A.G32,A.G37,A.G41
 3 glyco-bond=---- sugar=-3-3 groove=---- planarity=0.341 type=other  nts=4 GGGG B.G9,B.G12,B.G42,B.G36
 4 glyco-bond=---- sugar=---3 groove=---- planarity=0.241 type=other  nts=4 GGGG B.G13,B.G32,B.G37,B.G41

List of 2 G4-helices

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 2 G-tetrad layers, INTRA-molecular

 1  glyco-bond=---- sugar=-3-3 groove=---- WC-->Major nts=4 GGGG A.G9,A.G12,A.G42,A.G36
 2  glyco-bond=---- sugar=--3- groove=---- Major-->WC nts=4 GGGG A.G32,A.G13,A.G41,A.G37
  step#1  pp(><,inward)   area=5.67  rise=3.55 twist=-33.3
  strand#1 RNA glyco-bond=-- sugar=-- nts=2 GG A.G9,A.G32
  strand#2 RNA glyco-bond=-- sugar=3- nts=2 GG A.G12,A.G13
  strand#3 RNA glyco-bond=-- sugar=-3 nts=2 GG A.G42,A.G41
  strand#4 RNA glyco-bond=-- sugar=3- nts=2 GG A.G36,A.G37

Download PDB file
Interactive view in 3Dmol.js
1 stacking diagram 
 1  glyco-bond=---- sugar=-3-3 groove=---- WC-->Major nts=4 GGGG A.G9,A.G12,A.G42,A.G36
 2  glyco-bond=---- sugar=--3- groove=---- Major-->WC nts=4 GGGG A.G32,A.G13,A.G41,A.G37
  step#1  pp(><,inward)   area=5.67  rise=3.55 twist=-33.3

Download PDB file
Interactive view in 3Dmol.js

Helix#2, 2 G-tetrad layers, INTRA-molecular

 1  glyco-bond=---- sugar=-3-3 groove=---- WC-->Major nts=4 GGGG B.G9,B.G12,B.G42,B.G36
 2  glyco-bond=---- sugar=--3- groove=---- Major-->WC nts=4 GGGG B.G32,B.G13,B.G41,B.G37
  step#1  pp(><,inward)   area=5.71  rise=3.52 twist=-34.0
  strand#1 RNA glyco-bond=-- sugar=-- nts=2 GG B.G9,B.G32
  strand#2 RNA glyco-bond=-- sugar=3- nts=2 GG B.G12,B.G13
  strand#3 RNA glyco-bond=-- sugar=-3 nts=2 GG B.G42,B.G41
  strand#4 RNA glyco-bond=-- sugar=3- nts=2 GG B.G36,B.G37

Download PDB file
Interactive view in 3Dmol.js
1 stacking diagram 
 1  glyco-bond=---- sugar=-3-3 groove=---- WC-->Major nts=4 GGGG B.G9,B.G12,B.G42,B.G36
 2  glyco-bond=---- sugar=--3- groove=---- Major-->WC nts=4 GGGG B.G32,B.G13,B.G41,B.G37
  step#1  pp(><,inward)   area=5.71  rise=3.52 twist=-34.0

Download PDB file
Interactive view in 3Dmol.js

List of 8 non-stem G4-loops (including the two closing Gs)

 1 type=lateral   helix=#1 nts=4 GGAG A.G9,A.G10,A.A11,A.G12
 2 type=lateral   helix=#1 nts=20 GGGCGCCAGUUCGCUGGUGG A.G13,A.G14,A.G15,A.C16,A.G17,A.C18,A.C19,A.A20,A.G21,A.U22,A.U23,A.C24,A.G25,A.C26,A.U27,A.G28,A.G29,A.U30,A.G31,A.G32
 3 type=V-shaped  helix=#1 nts=6 GUUGGG A.G32,A.U33,A.U34,A.G35,A.G36,A.G37
 4 type=lateral   helix=#1 nts=5 GUGCG A.G37,A.U38,A.G39,A.C40,A.G41
 5 type=lateral   helix=#2 nts=4 GGAG B.G9,B.G10,B.A11,B.G12
 6 type=lateral   helix=#2 nts=20 GGGCGCCAGUUCGCUGGUGG B.G13,B.G14,B.G15,B.C16,B.G17,B.C18,B.C19,B.A20,B.G21,B.U22,B.U23,B.C24,B.G25,B.C26,B.U27,B.G28,B.G29,B.U30,B.G31,B.G32
 7 type=V-shaped  helix=#2 nts=6 GUUGGG B.G32,B.U33,B.U34,B.G35,B.G36,B.G37
 8 type=lateral   helix=#2 nts=5 GUGCG B.G37,B.U38,B.G39,B.C40,B.G41