Summary information

PDB id
7otb
Class
DNA
Method
X-ray (1.6 Å)
Summary
Ruthenium polypridyl complex bound to a unimolecular chair-form g-quadruplex
Reference
McQuaid KT, Takahashi S, Baumgaertner L, Cardin DJ, Paterson NG, Hall JP, Sugimoto N, Cardin CJ (2022): "Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex." J.Am.Chem.Soc., 144, 5956-5964. doi: 10.1021/jacs.2c00178.
Abstract
The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.
G4 notes
3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-Lw), chair(2+2), UDUD

Base-block schematics in six views

PyMOL session file PDB file View in 3Dmol.js

List of 3 G-tetrads

 1 glyco-bond=s-s- sugar=---- groove=wnwn planarity=0.543 type=bowl-2 nts=4 GGGG A.DG1,A.DG9,A.DG13,A.DG21
 2 glyco-bond=s-s- sugar=--.- groove=wnwn planarity=0.515 type=other  nts=4 GGGG A.DG2,A.DG8,A.DG14,A.DG20
 3 glyco-bond=-s-s sugar=---- groove=wnwn planarity=0.568 type=saddle nts=4 GGGG A.DG3,A.DG7,A.DG15,A.DG19

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 3 G-tetrad layers, INTRA-molecular, with 1 stem

 1  glyco-bond=s-s- sugar=---- groove=wnwn Major-->WC nts=4 GGGG A.DG1,A.DG9,A.DG13,A.DG21
 2  glyco-bond=s-s- sugar=--.- groove=wnwn Major-->WC nts=4 GGGG A.DG2,A.DG8,A.DG14,A.DG20
 3  glyco-bond=-s-s sugar=---- groove=wnwn WC-->Major nts=4 GGGG A.DG3,A.DG7,A.DG15,A.DG19
  step#1  mp(<<,backward) area=17.44 rise=3.51 twist=22.0
  step#2  mm(<>,outward)  area=12.49 rise=3.50 twist=20.0
  strand#1 DNA glyco-bond=ss- sugar=--- nts=3 GGG A.DG1,A.DG2,A.DG3
  strand#2 DNA glyco-bond=--s sugar=--- nts=3 GGG A.DG9,A.DG8,A.DG7
  strand#3 DNA glyco-bond=ss- sugar=-.- nts=3 GGG A.DG13,A.DG14,A.DG15
  strand#4 DNA glyco-bond=--s sugar=--- nts=3 GGG A.DG21,A.DG20,A.DG19

Download PDB file
Interactive view in 3Dmol.js
2 stacking diagrams 
 1  glyco-bond=s-s- sugar=---- groove=wnwn Major-->WC nts=4 GGGG A.DG1,A.DG9,A.DG13,A.DG21
 2  glyco-bond=s-s- sugar=--.- groove=wnwn Major-->WC nts=4 GGGG A.DG2,A.DG8,A.DG14,A.DG20
  step#1  mp(<<,backward) area=17.44 rise=3.51 twist=22.0

Download PDB file
Interactive view in 3Dmol.js

 
 2  glyco-bond=s-s- sugar=--.- groove=wnwn Major-->WC nts=4 GGGG A.DG2,A.DG8,A.DG14,A.DG20
 3  glyco-bond=-s-s sugar=---- groove=wnwn WC-->Major nts=4 GGGG A.DG3,A.DG7,A.DG15,A.DG19
  step#2  mm(<>,outward)  area=12.49 rise=3.50 twist=20.0

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 3 G-tetrad layers, 3 loops, INTRA-molecular, UDUD, anti-parallel, 3(-Lw-Ln-Lw), chair(2+2)

 1  glyco-bond=s-s- sugar=---- groove=wnwn Major-->WC nts=4 GGGG A.DG1,A.DG9,A.DG13,A.DG21
 2  glyco-bond=s-s- sugar=--.- groove=wnwn Major-->WC nts=4 GGGG A.DG2,A.DG8,A.DG14,A.DG20
 3  glyco-bond=-s-s sugar=---- groove=wnwn WC-->Major nts=4 GGGG A.DG3,A.DG7,A.DG15,A.DG19
  step#1  mp(<<,backward) area=17.44 rise=3.51 twist=22.0
  step#2  mm(<>,outward)  area=12.49 rise=3.50 twist=20.0
  strand#1  U DNA glyco-bond=ss- sugar=--- nts=3 GGG A.DG1,A.DG2,A.DG3
  strand#2  D DNA glyco-bond=--s sugar=--- nts=3 GGG A.DG9,A.DG8,A.DG7
  strand#3  U DNA glyco-bond=ss- sugar=-.- nts=3 GGG A.DG13,A.DG14,A.DG15
  strand#4  D DNA glyco-bond=--s sugar=--- nts=3 GGG A.DG21,A.DG20,A.DG19
  loop#1 type=lateral   strands=[#1,#2] nts=3 TTA A.DT4,A.DT5,A.DA6
  loop#2 type=lateral   strands=[#2,#3] nts=3 TTA A.DT10,A.DT11,A.DA12
  loop#3 type=lateral   strands=[#3,#4] nts=3 TTT A.DT16,A.DT17,A.DT18

Download PDB file
Interactive view in 3Dmol.js