Summary information and primary citation

PDB-id
5j6u
Class
DNA
Method
NMR
Summary
Diy g-quadruplexes: solution structure of d(ggggtttggggttttggggaagggg) in sodium
Reference
Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018): "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007.
Abstract
The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
G4 notes
4 G-tetrads, 1 G4 helix, 1 G4 stem, UDDU, anti-parallel:basket, 2+2, 4(-LwD+Ln)

Cartoon-block schematics in six views (download the tarball)

PyMOL session file

Download PDB file

View in 3Dmol.js

List of 4 G-tetrads

 1 glyco-bond=s--s sugar=---- groove=w-n- planarity=0.096 type=planar N- nts=4 GGGG A.DG1,A.DG11,A.DG25,A.DG16
 2 glyco-bond=-ss- sugar=---- groove=w-n- planarity=0.120 type=planar N+ nts=4 GGGG A.DG2,A.DG10,A.DG24,A.DG17
 3 glyco-bond=s--s sugar=---- groove=w-n- planarity=0.083 type=planar N- nts=4 GGGG A.DG3,A.DG9,A.DG23,A.DG18
 4 glyco-bond=-ss- sugar=-.-. groove=w-n- planarity=0.075 type=planar N+ nts=4 GGGG A.DG4,A.DG8,A.DG22,A.DG19

List of 1 G4-helix

In DSSR, a G4-helix is defined by stacking interactions of G-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem.

Helix#1, 4 G-tetrads, INTRA-molecular, with 1 stem
 1  glyco-bond=s--s sugar=---- groove=w-n- Major-->WC N- nts=4 GGGG A.DG1,A.DG11,A.DG25,A.DG16
 2  glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major N+ nts=4 GGGG A.DG2,A.DG10,A.DG24,A.DG17
 3  glyco-bond=s--s sugar=---- groove=w-n- Major-->WC N- nts=4 GGGG A.DG3,A.DG9,A.DG23,A.DG18
 4  glyco-bond=-ss- sugar=-.-. groove=w-n- WC-->Major N+ nts=4 GGGG A.DG4,A.DG8,A.DG22,A.DG19
  step#1  mm(<>,outward)  area=14.81 rise=3.29 twist=15.3
  step#2  pp(><,inward)   area=18.73 rise=3.44 twist=34.9
  step#3  mm(<>,outward)  area=13.27 rise=3.15 twist=16.5
  strand#1 DNA glyco-bond=s-s- sugar=---- nts=4 GGGG A.DG1,A.DG2,A.DG3,A.DG4
  strand#2 DNA glyco-bond=-s-s sugar=---. nts=4 GGGG A.DG11,A.DG10,A.DG9,A.DG8
  strand#3 DNA glyco-bond=-s-s sugar=---- nts=4 GGGG A.DG25,A.DG24,A.DG23,A.DG22
  strand#4 DNA glyco-bond=s-s- sugar=---. nts=4 GGGG A.DG16,A.DG17,A.DG18,A.DG19

Download PDB file
Interactive view in 3Dmol.js

3 stacking diagrams
 1  glyco-bond=s--s sugar=---- groove=w-n- Major-->WC N- nts=4 GGGG A.DG1,A.DG11,A.DG25,A.DG16
2 glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major N+ nts=4 GGGG A.DG2,A.DG10,A.DG24,A.DG17
step#1 mm(<>,outward) area=14.81 rise=3.29 twist=15.3

Download PDB file
Interactive view in 3Dmol.js

 2  glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major N+ nts=4 GGGG A.DG2,A.DG10,A.DG24,A.DG17
3 glyco-bond=s--s sugar=---- groove=w-n- Major-->WC N- nts=4 GGGG A.DG3,A.DG9,A.DG23,A.DG18
step#2 pp(><,inward) area=18.73 rise=3.44 twist=34.9

Download PDB file
Interactive view in 3Dmol.js

 3  glyco-bond=s--s sugar=---- groove=w-n- Major-->WC N- nts=4 GGGG A.DG3,A.DG9,A.DG23,A.DG18
4 glyco-bond=-ss- sugar=-.-. groove=w-n- WC-->Major N+ nts=4 GGGG A.DG4,A.DG8,A.DG22,A.DG19
step#3 mm(<>,outward) area=13.27 rise=3.15 twist=16.5

Download PDB file
Interactive view in 3Dmol.js

List of 1 G4-stem

In DSSR, a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands.

Stem#1, 4 G-tetrads, 3 loops, INTRA-molecular, UDDU, anti-parallel:basket, 2+2, 4(-LwD+Ln)
 1  glyco-bond=s--s sugar=---- groove=w-n- Major-->WC N- nts=4 GGGG A.DG1,A.DG11,A.DG25,A.DG16
 2  glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major N+ nts=4 GGGG A.DG2,A.DG10,A.DG24,A.DG17
 3  glyco-bond=s--s sugar=---- groove=w-n- Major-->WC N- nts=4 GGGG A.DG3,A.DG9,A.DG23,A.DG18
 4  glyco-bond=-ss- sugar=-.-. groove=w-n- WC-->Major N+ nts=4 GGGG A.DG4,A.DG8,A.DG22,A.DG19
  step#1  mm(<>,outward)  area=14.81 rise=3.29 twist=15.3
  step#2  pp(><,inward)   area=18.73 rise=3.44 twist=34.9
  step#3  mm(<>,outward)  area=13.27 rise=3.15 twist=16.5
  strand#1  U DNA glyco-bond=s-s- sugar=---- nts=4 GGGG A.DG1,A.DG2,A.DG3,A.DG4
  strand#2  D DNA glyco-bond=-s-s sugar=---. nts=4 GGGG A.DG11,A.DG10,A.DG9,A.DG8
  strand#3  D DNA glyco-bond=-s-s sugar=---- nts=4 GGGG A.DG25,A.DG24,A.DG23,A.DG22
  strand#4  U DNA glyco-bond=s-s- sugar=---. nts=4 GGGG A.DG16,A.DG17,A.DG18,A.DG19
  loop#1 type=lateral   strands=[#1,#2] nts=3 TTT A.DT5,A.DT6,A.DT7
  loop#2 type=diagonal  strands=[#2,#4] nts=4 TTTT A.DT12,A.DT13,A.DT14,A.DT15
  loop#3 type=lateral   strands=[#4,#3] nts=2 AA A.DA20,A.DA21

Download PDB file
Interactive view in 3Dmol.js