List of 306 G4 structures auto-curated by DSSR from the PDB

Last updated on 2019-05-06 by Xiang-Jun Lu <xiangjun@x3dna.org>


pdb_id category method annotation reference authors
139d DNA nmr Solution structure of a parallel-stranded g-quadruplex DNA; 3Dmol view …… (1993) "Solution structure of a parallel-stranded G-quadruplex DNA." J.Mol.Biol., 234, 1171-1183. pubmed Wang, Y., Patel, D.J.
143d DNA nmr Solution structure of the human telomeric repeat d(ag3[t2ag3]3) of the g-quadruplex; 3Dmol view …… (1993) "Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex." Structure, 1, 263-282. pubmed Wang, Y., Patel, D.J.
148d DNA nmr Three-dimensional solution structure of the thrombin binding DNA aptamer d(ggttggtgtggttgg); 3Dmol view …… (1994) "Three-dimensional solution structure of the thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG)." J.Mol.Biol., 235, 1532-1547. pubmed Schultze, P., Macaya, R.F., Feigon, J.
156d DNA nmr Refined solution structure of the dimeric quadruplex formed from the oxytricha telomeric oligonucleotide d(ggggttttgggg); 3Dmol view …… (1994) "Refined solution structure of the dimeric quadruplex formed from the Oxytricha telomeric oligonucleotide d(GGGGTTTTGGGG)." Structure, 2, 221-233. pubmed Schultze, P., Smith, F.W., Feigon, J.
186d DNA nmr Solution structure of the tetrahymena telomeric repeat d(t2g4)4 g-tetraplex; 3Dmol view …… (1994) "Solution structure of the Tetrahymena telomeric repeat d(T2G4)4 G-tetraplex." Structure, 2, 1141-1156. pubmed Wang, Y., Patel, D.J.
1a6h DNA nmr DNA quadruplex containing gcgc tetrad, nmr, 4 structures; 3Dmol view …… (1995) "Solution structure of a DNA quadruplex containing the fragile X syndrome triplet repeat." J.Mol.Biol., 254, 638-656. pubmed Kettani, A., Kumar, R.A., Patel, D.J.
1a8n DNA nmr Solution structure of a na+ cation stabilized DNA quadruplex containing g.g.g.g and g.c.g.c tetrads formed by g-g-g-c repeats observed in aav and human chromosome 19, nmr, 8 structures; 3Dmol view …… (1998) "Solution structure of a Na cation stabilized DNA quadruplex containing G.G.G.G and G.C.G.C tetrads formed by G-G-G-C repeats observed in adeno-associated viral DNA." J.Mol.Biol., 282, 619-636. pubmed Kettani, A., Bouaziz, S., Gorin, A., Zhao, H., Jones, R.A., Patel, D.J.
1a8w DNA nmr A k+ cation-induced conformational switch within a loop spanning segment of a DNA quadruplex containing g-g-g-c repeats, nmr, 8 structures; 3Dmol view …… (1998) "A K cation-induced conformational switch within a loop spanning segment of a DNA quadruplex containing G-G-G-C repeats." J.Mol.Biol., 282, 637-652. pubmed Bouaziz, S., Kettani, A., Patel, D.J.
1aff DNA nmr DNA quadruplex containing gggg tetrads and (t.a).a triads, nmr, 8 structures; 3Dmol view …… (1997) "Bombyx mori single repeat telomeric DNA sequence forms a G-quadruplex capped by base triads." Nat.Struct.Mol.Biol., 4, 382-389. pubmed Kettani, A., Bouaziz, S., Wang, W., Jones, R.A., Patel, D.J.
1bub DNA nmr Determination of internuclear angles of DNA using paramagnetic assisted magnetic alignment; 3Dmol view …… (1998) "Determination of internuclear angles of DNA using paramagnetic-assisted magnetic alignment." J.Magn.Reson., 135, 256-259. pubmed Beger, R.D., Marathias, V.M., Volkman, B.F., Bolton, P.H.
1c32 DNA nmr Solution structure of a quadruplex forming DNA and its intermidiate; 3Dmol view …… (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. pubmed Marathias, V.M., Bolton, P.H.
1c34 DNA nmr Solution structure of a quadruplex forming DNA and its intermidiate; 3Dmol view …… (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. pubmed Marathias, V.M., Bolton, P.H.
1c35 DNA nmr Solution structure of a quadruplex forming DNA and its intermidiate; 3Dmol view …… (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. pubmed Marathias, V.M., Bolton, P.H.
1c38 DNA nmr Solution structure of a quadruplex forming DNA and its intermediate; 3Dmol view …… (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. pubmed Marathias, V.M., Bolton, P.H.
1d59 DNA x-ray (2.3 Å) Crystal structure of 4-stranded oxytricha telomeric DNA; 3Dmol view …… (1992) "Crystal structure of four-stranded Oxytricha telomeric DNA." Nature, 356, 126-131. pubmed Kang, C., Zhang, X., Ratliff, R., Moyzis, R., Rich, A.
1d6d DNA nmr Solution DNA structure containing (a-a)-t triads interdigitated between a-t base pairs and gggg tetrads; nmr, 8 struct.; 3Dmol view …… (2000) "A diamond-shaped zipper-like DNA architecture containing triads sandwiched between mismatches and tetrads." J.Mol.Biol., 295, 455-469. pubmed Kuryavyi, V., Kettani, A., Wang, W., Jones, R., Patel, D.J.
1eeg DNA nmr A(gggg)a hexad pairing aligment for the d(g-g-a-g-g-a-g) sequence; 3Dmol view …… (2000) "A dimeric DNA interface stabilized by stacked A.(G.G.G.G).A hexads and coordinated monovalent cations." J.Mol.Biol., 297, 627-644. pubmed Kettani, A., Gorin, A., Majumdar, A., Hermann, T., Skripkin, E., Zhao, H., Jones, R., Patel, D.J.
1emq DNA nmr Nmr observation of t-tetrads in a parallel stranded DNA quadruplex formed by saccharomyces cerevisiae telomere repeats; 3Dmol view …… (1999) "NMR observation of T-tetrads in a parallel stranded DNA quadruplex formed by Saccharomyces cerevisiae telomere repeats." Nucleic Acids Res., 27, 2457-2464. pubmed Patel, P.K., Hosur, R.V.
1evm DNA nmr Nmr observation of a-tetrad; 3Dmol view …… (1999) "NMR studies on truncated sequences of human telomeric DNA: observation of a novel A-tetrad." Nucleic Acids Res., 27, 3836-3843. pubmed Patel, P.K., Koti, A.S., Hosur, R.V.
1evn DNA nmr Nmr observation of a-tetrad; 3Dmol view …… (1999) "NMR studies on truncated sequences of human telomeric DNA: observation of a novel A-tetrad." Nucleic Acids Res., 27, 3836-3843. pubmed Patel, P.K., Koti, A.S., Hosur, R.V.
1evo DNA nmr Nmr observation of a novel c-tetrad; 3Dmol view …… (2000) "NMR observation of a novel C-tetrad in the structure of the SV40 repeat sequence GGGCGG." Biochem.Biophys.Res.Commun., 270, 967-971. pubmed Patel, P.K., Bhavesh, N.S., Hosur, R.V.
1f3s DNA nmr Solution structure of DNA sequence gggttcagg forms gggg tetrade and g(c-a) triad.; 3Dmol view …… (2000) "A two-stranded template-based approach to G.(C-A) triad formation: designing novel structural elements into an existing DNA framework." J.Mol.Biol., 301, 129-146. pubmed Kettani, A., Basu, G., Gorin, A., Majumdar, A., Skripkin, E., Patel, D.J.
1fqp DNA nmr Intramolecular quadruplex DNA with three gggg repeats, nmr, ph 6.7, 0.1 m na+ and 4 mm (strand concentration), 5 structures; 3Dmol view …… (1995) "Solution structure of the Na+ form of the dimeric guanine quadruplex [d(G3T4G3)]2." Eur.J.Biochem., 233, 631-643. pubmed Keniry, M.A., Strahan, G.D., Owen, E.A., Shafer, R.H.
1hao hydrolase-hydrolase inhibitor-DNA x-ray (2.8 Å) Complex of human alpha-thrombin with a 15mer oligonucleotide ggttggtgtggttgg (based on nmr model of DNA); 3Dmol view …… (1996) "An ambiguous structure of a DNA 15-mer thrombin complex." Acta Crystallogr.,Sect.D, 52, 272-282. pubmed Padmanabhan, K., Tulinsky, A.
1hap hydrolase-hydrolase inhibitor-DNA x-ray (2.8 Å) Complex of human alpha-thrombin with a 15mer oligonucleotide ggttggtgtggttgg (based on x-ray model of DNA); 3Dmol view …… (1996) "An ambiguous structure of a DNA 15-mer thrombin complex." Acta Crystallogr.,Sect.D, 52, 272-282. pubmed Padmanabhan, K., Tulinsky, A.
1hut hydrolase-hydrolase inhibitor-DNA x-ray (2.9 Å) The structure of alpha-thrombin inhibited by a 15-mer single-stranded DNA aptamer; 3Dmol view …… (1993) "The structure of alpha-thrombin inhibited by a 15-mer single-stranded DNA aptamer." J.Biol.Chem., 268, 17651-17654. pubmed Padmanabhan, K., Padmanabhan, K.P., Ferrara, J.D., Sadler, J.E., Tulinsky, A.
1i34 DNA nmr Solution DNA quadruplex with double chain reversal loop and two diagonal loops connecting gggg tetrads flanked by g-(t-t) triad and t-t-t triple; 3Dmol view …… (2001) "A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple." J.Mol.Biol., 310, 181-194. pubmed Kuryavyi, V., Majumdar, A., Shallop, A., Chernichenko, N., Skripkin, E., Jones, R., Patel, D.J.
1j6s RNA x-ray (1.4 Å) Crystal structure of an RNA tetraplex (ugaggu)4 with a-tetrads, g-tetrads, u-tetrads and g-u octads; 3Dmol view …… (2003) "Crystal structure of an RNA purine-rich tetraplex containing adenine tetrads: implications for specific binding in RNA tetraplexes." Structure, 11, 815-823. pubmed Pan, B., Xiong, Y., Shi, K., Deng, J., Sundaralingam, M.
1j8g RNA x-ray (0.61 Å) X-ray analysis of a RNA tetraplex r(uggggu)4 at ultra-high resolution; 3Dmol view …… (2001) "X-ray analysis of an RNA tetraplex (UGGGGU)(4) with divalent Sr(2+) ions at subatomic resolution (0.61 A)." Proc.Natl.Acad.Sci.USA, 98, 13665-13670. pubmed Deng, J., Xiong, Y., Sundaralingam, M.
1jb7 DNA-binding protein-DNA x-ray (1.86 Å) DNA g-quartets in a 1.86 a resolution structure of an oxytricha nova telomeric protein-DNA complex; 3Dmol view …… (2001) "DNA G-quartets in a 1.86 A resolution structure of an Oxytricha nova telomeric protein-DNA complex." J.Mol.Biol., 310, 367-377. pubmed Horvath, M.P., Schultz, S.C.
1jjp DNA nmr A(gggg) pentad-containing dimeric DNA quadruplex involving stacked g(anti)g(anti)g(anti)g(syn) tetrads; 3Dmol view …… (2001) "V-shaped scaffold: a new architectural motif identified in an A x (G x G x G x G) pentad-containing dimeric DNA quadruplex involving stacked G(anti) x G(anti) x G(anti) x G(syn) tetrads." J.Mol.Biol., 311, 1063-1079. pubmed Zhang, N., Gorin, A., Majumdar, A., Kettani, A., Chernichenko, N., Skripkin, E., Patel, D.J.
1jpq DNA x-ray (1.6 Å) Crystal structure of the oxytricha telomeric DNA at 1.6a; 3Dmol view …… (2002) "Crystal structure of the potassium form of an Oxytricha nova G-quadruplex." J.Mol.Biol., 320, 189-200. pubmed Haider, S., Parkinson, G.N., Neidle, S.
1jrn DNA x-ray (2.0 Å) Orthorhombic form of oxytricha telomeric DNA at 2.0a; 3Dmol view …… (2002) "Crystal structure of the potassium form of an Oxytricha nova G-quadruplex." J.Mol.Biol., 320, 189-200. pubmed Haider, S., Parkinson, G.N., Neidle, S.
1jvc DNA nmr Dimeric DNA quadruplex containing major groove-aligned a.t.a.t and g.c.g.c tetrads stabilized by inter-subunit watson-crick a:t and g:c pairs; 3Dmol view …… (2001) "Dimeric DNA quadruplex containing major groove-aligned A-T-A-T and G-C-G-C tetrads stabilized by inter-subunit Watson-Crick A-T and G-C pairs." J.Mol.Biol., 312, 1073-1088. pubmed Zhang, N., Gorin, A., Majumdar, A., Kettani, A., Chernichenko, N., Skripkin, E., Patel, D.J.
1k4x DNA nmr Potassium form of oxy-1.5 quadruplex DNA; 3Dmol view …… (1999) "The effect of sodium, potassium and ammonium ions on the conformation of the dimeric quadruplex formed by the Oxytricha nova telomere repeat oligonucleotide d(G(4)T(4)G(4))." Nucleic Acids Res., 27, 3018-3028. pubmed Schultze, P., Hud, N.V., Smith, F.W., Feigon, J.
1k8p DNA x-ray (2.4 Å) Structure of the human g-quadruplex reveals a novel topology; 3Dmol view …… (2002) "Crystal structure of parallel quadruplexes from human telomeric DNA." Nature, 417, 876-880. pubmed Parkinson, G.N., Lee, M.P., Neidle, S.
1kf1 DNA x-ray (2.1 Å) Structure and packing of human telomeric DNA; 3Dmol view …… (2002) "Crystal structure of parallel quadruplexes from human telomeric DNA." Nature, 417, 876-880. pubmed Parkinson, G.N., Lee, M.P., Neidle, S.
1l1h DNA x-ray (1.75 Å) Crystal structure of the quadruplex DNA-drug complex; 3Dmol view …… (2003) "Structure of a G-quadruplex-Ligand Complex." J.Mol.Biol., 326, 117-125. pubmed Haider, S.M., Parkinson, G.N., Neidle, S.
1lvs DNA nmr The solution structure of d(g4t4g3)2; 3Dmol view …… (2002) "The solution structure of d(G(4)T(4)G(3))(2): a bimolecular G-quadruplex with a novel fold." J.Mol.Biol., 320, 911-924. pubmed Crnugelj, M., Hud, N.V., Plavec, J.
1mdg RNA x-ray (1.5 Å) An alteRNAting antiparallel octaplex in an RNA crystal structure; 3Dmol view …… (2003) "An Eight-Stranded Helical Fragment in RNA Crystal Structure: Implications for Tetraplex Interaction." Structure, 11, 825-831. pubmed Pan, B.C., Xiong, Y., Shi, K., Sundaralingam, M.
1my9 RNA nmr Solution structure of a k+ cation stabilized dimeric RNA quadruplex containing two g:g(:a):g:g(:a) hexads, g:g:g:g tetrads and uuuu loops; 3Dmol view …… (2002) "A Dimeric RNA Quadruplex Architecture Comprised of Two G:G(:A):G:G(:A) Hexads, G:G:G:G Tetrads and UUUU Loops." J.Mol.Biol., 322, 955-970. pubmed Liu, H., Matsugami, A., Katahira, M., Uesugi, S.
1myq DNA nmr An intramolecular quadruplex of (gga)(4) triplet repeat DNA with a g:g:g:g tetrad and a g(:a):g(:a):g(:a):g heptad, and its dimeric interaction; 3Dmol view …… (2001) "An intramolecular quadruplex of (GGA)(4) triplet repeat DNA with a G:G:G:G tetrad and a G(:A):G(:A):G(:A):G heptad, and its dimeric interaction." J.Mol.Biol., 313, 255-269. pubmed Matsugami, A., Ouhashi, K., Kanagawa, M., Liu, H., Kanagawa, S., Uesugi, S., Katahira, M.
1n7a DNA, RNA x-ray (1.2 Å) Rip-radiation-damage induced phasing; 3Dmol view …… (2003) "Specific Radiation-Damage Can Be Used To Solve Macromolecular Crystal Structures." Structure, 11, 217-224. pubmed Ravelli, R.B.G., Leiros, H.-K.S., Pan, B., Caffrey, M., McSweeney, S.
1n7b DNA, RNA x-ray (1.4 Å) Rip-radiation-damage induced phasing; 3Dmol view …… (2003) "Specific Radiation-Damage Can Be Used To Solve Macromolecular Crystal Structures." Structure, 11, 217-224. pubmed Ravelli, R.B.G., Leiros, H.-K.S., Pan, B., Caffrey, M., McSweeney, S.
1np9 DNA nmr Structure of the parallel-stranded DNA quadruplex d(ttaggga)4 containing the human telomeric repeat; 3Dmol view …… (2003) "Structure of the parallel-stranded DNA quadruplex d(TTAGGGT)4 containing the human telomeric repeat: evidence for A-tetrad formation from NMR and molecular dynamics simulations." ORG.BIOMOL.CHEM., 1, 1650-1656. pubmed Gavathiotis, E., Searle, M.S.
1nyd DNA nmr Solution structure of DNA quadruplex gcggtggat; 3Dmol view …… (2003) "Association of DNA quadruplexes through G:C:G:C tetrads. Solution structure of d(GCGGTGGAT)." Biochemistry, 42, 14356-14365. pubmed Webba da Silva, M.
1nzm DNA nmr Nmr structure of the parallel-stranded DNA quadruplex d(ttagggt)4 complexed with the telomerase inhibitor rhps4; 3Dmol view …… (2003) "Drug Recognition and Stabilisation of the Parallel-stranded DNA Quadruplex d(TTAGGGT)4 Containing the Human Telomeric Repeat." J.Mol.Biol., 334, 25-36. pubmed Gavathiotis, E., Heald, R.A., Stevens, M.F.G., Searle, M.S.
1o0k DNA x-ray (1.17 Å) Structure of the first parallel DNA quadruplex-drug complex; 3Dmol view …… (2003) "Structure of the First Parallel DNA Quadruplex-drug Complex." J.Am.Chem.Soc., 125, 4066-4067. pubmed Clark, G.R., Pytel, P.D., Squire, C.J., Neidle, S.
1oz8 DNA nmr Intramolecular higher-order packing of parallel quadruplexes comprising a g:g:g:g tetrad and a g(:a):g(:a):g(:a):g heptad of gga triplet repeat DNA; 3Dmol view …… (2003) "Intramolecular Higher Order Packing of Parallel Quadruplexes Comprising a G:G:G:G Tetrad and a G(:A):G(:A):G(:A):G Heptad of GGA Triplet Repeat DNA." J.BIOL.CHEM., 278, 28147-28153. pubmed Matsugami, A., Okuizumi, T., Uesugi, S., Katahira, M.
1pa6 DNA binding protein-DNA x-ray (2.45 Å) Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgagg; 3Dmol view …… (2003) "Nucleotide shuffling and ssDNA recognition in Oxytricha nova telomere end-binding protein complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C.
1ph1 DNA binding protein-DNA x-ray (2.51 Å) Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttggggt; 3Dmol view …… (2003) "Nucleotide Shuffling and Ssdna Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C.
1ph2 DNA binding protein-DNA x-ray (3.1 Å) Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttg; 3Dmol view …… (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C.
1ph3 DNA binding protein-DNA x-ray (2.3 Å) Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttggtg; 3Dmol view …… (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C.
1ph4 DNA binding protein-DNA x-ray (2.3 Å) Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttggcg; 3Dmol view …… (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C.
1ph5 DNA binding protein-DNA x-ray (2.3 Å) Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttg(3dr)gg; 3Dmol view …… (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C.
1ph6 DNA binding protein-DNA x-ray (2.1 Å) Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgtgg; 3Dmol view …… (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C.
1ph7 DNA binding protein-DNA x-ray (2.9 Å) Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgigg; 3Dmol view …… (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C.
1ph8 DNA binding protein-DNA x-ray (2.36 Å) Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgcgg; 3Dmol view …… (2003) "Nucleotide Shuffling and Ssdna Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C.
1ph9 DNA binding protein-DNA x-ray (2.5 Å) Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgagg; 3Dmol view …… (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C.
1phj DNA binding protein-DNA x-ray (2.5 Å) Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA gg(3dr)gttttgggg; 3Dmol view …… (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C.
1qdf DNA nmr The nmr study of DNA quadruplex structure, aptamer (15mer) DNA; 3Dmol view …… (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. pubmed Marathias, V.M., Wang, K.Y., Kumar, S., Pham, T.Q., Swaminathan, S., Bolton, P.H.
1qdh DNA nmr The nmr study of DNA quadruplex structure, aptamer (15mer) DNA; 3Dmol view …… (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. pubmed Marathias, V.M., Wang, K.Y., Kumar, S., Pham, T.Q., Swaminathan, S., Bolton, P.H.
1qdi DNA nmr The nmr study of DNA quadruplex structure, (12mer) DNA; 3Dmol view …… (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. pubmed Marathias, V.M., Wang, K.Y., Kumar, S., Pham, T.Q., Swaminathan, S., Bolton, P.H.
1qdk DNA nmr The nmr study of DNA quadruplex structure, (12mer) DNA; 3Dmol view …… (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. pubmed Marathias, V.M., Wang, K.Y., Kumar, S., Pham, T.Q., Swaminathan, S., Bolton, P.H.
1rau RNA nmr Solution structure of an unusually stable RNA tetraplex containing g-and u-quartet structures; 3Dmol view …… (1992) "Solution structure of an unusually stable RNA tetraplex containing G- and U-quartet structures." Biochemistry, 31, 8406-8414. pubmed Cheong, C., Moore, P.B.
1rde DNA nmr Nmr structure of the thrombin-binding DNA aptamer stabilized by sr2+; 3Dmol view …… (2004) "NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+." J.Biomol.Struct.Dyn., 22, 25-33. pubmed Mao, X., Marky, L.A., Gmeiner, W.H.
1s45 DNA x-ray (2.2 Å) Crystal structure analysis of the DNA quadruplex d(tggggt) s1; 3Dmol view …… (2004) "A Thymine tetrad in d(TGGGGT) quadruplexes stabilized with Tl+1/Na+1 ions." Nucleic Acids Res., 32, 1097-1102. pubmed Caceres, C., Wright, G., Gouyette, C., Parkinson, G., Subirana, J.A.
1s47 DNA x-ray (2.5 Å) Crystal structure analysis of the DNA quadruplex d(tggggt)s2; 3Dmol view …… (2004) "A Thymine tetrad in d(TGGGGT) quadruplexes stabilized with Tl+1/Na+1 ions." Nucleic Acids Res., 32, 1097-1102. pubmed Caceres, C., Wright, G., Gouyette, C., Parkinson, G., Subirana, J.A.
1s9l RNA nmr Nmr solution structure of a parallel lna quadruplex; 3Dmol view …… (2004) "NMR solution structure of a parallel LNA quadruplex." Nucleic Acids Res., 32, 3083-3092. pubmed Randazzo, A., Esposito, V., Ohlenschlager, O., Ramachandran, R., Mayola, L.
1u64 DNA nmr The solution structure of d(g3t4g4)2; 3Dmol view …… (2004) "d(G3T4G4) forms unusual dimeric G-quadruplex structure with the same general fold in the presence of K+, Na+ or NH4+ ions." Bioorg.Med.Chem., 12, 5735-5744. pubmed Sket, P., Crnugelj, M., Plavec, J.
1v3p DNA x-ray (2.3 Å) Crystal structure of d(gcgagagc): the DNA octaplex structure with i-motif of g-quartet; 3Dmol view …… (2004) "Crystal structures of a DNA octaplex with I-motif of G-quartets and its splitting into two quadruplexes suggest a folding mechanism of eight tandem repeats." Nucleic Acids Res., 32, 2541-2549. pubmed Kondo, J., Adachi, W., Umeda, S., Sunami, T., Takenaka, A.
1xav DNA nmr Major g-quadruplex structure formed in human c-myc promoter, a monomeric parallel-stranded quadruplex; 3Dmol view …… (2005) "Solution structure of the biologically relevant G-Quadruplex element in the human c-MYC promoter. Implications for G-quadruplex stabilization." Biochemistry, 44, 2048-2058. pubmed Ambrus, A., Chen, D., Dai, J., Jones, R.A., Yang, D.
1xce DNA nmr Helica structure of DNA by design: the t(gggg)t hexad alignment; 3Dmol view …… (2005) "Experimental Demonstration of T:(G:G:G):T Hexad and T:A:A:T Tetrad Alignments within a DNA Quadruplex Stem." Biochemistry, 44, 3754-3764. pubmed Webba da Silva, M.
1y8d DNA nmr Dimeric parallel-stranded tetraplex with 3+1 5' g-tetrad interface, single-residue chain reversal loops and gag triad in the context of a(gggg) pentad; 3Dmol view …… (2005) "An interlocked dimeric parallel-stranded DNA quadruplex: A potent inhibitor of HIV-1 integrase." Proc.Natl.Acad.Sci.USA, 102, 634-639. pubmed Phan, A.T., Kuryavyi, V.V., Ma, J.-B., Faure, A., Andreola, M.-L., Patel, D.J.
201d DNA nmr Solution structure of the oxytricha telomeric repeat d[g4(t4g4)3] g-tetraplex; 3Dmol view …… (1995) "Solution structure of the Oxytricha telomeric repeat d[G4(T4G4)3] G-tetraplex." J.Mol.Biol., 251, 76-94. pubmed Wang, Y., Patel, D.J.
230d DNA nmr Solution structures of unimolecular quadruplexes formed by oligonucleotides containing oxytricha telomere repeats; 3Dmol view …… (1995) "Solution structures of unimolecular quadruplexes formed by oligonucleotides containing Oxytricha telomere repeats." Structure, 3, 997-1008. pubmed Smith, F.W., Schultze, P., Feigon, J.
244d DNA x-ray (1.2 Å) The high-resolution crystal structure of a parallel-stranded guanine tetraplex; 3Dmol view …… (1994) "The high-resolution crystal structure of a parallel-stranded guanine tetraplex." Science, 265, 520-524. pubmed Laughlan, G., Murchie, A.I., Norman, D.G., Moore, M.H., Moody, P.C., Lilley, D.M., Luisi, B.
2a5p DNA nmr Monomeric parallel-stranded DNA tetraplex with snap-back 3+1 3' g-tetrad, single-residue chain reversal loops, gag triad in the context of gaag diagonal loop, nmr, 8 struct.; 3Dmol view …… (2005) "Small-molecule interaction with a five-guanine-tract G-quadruplex structure from the human MYC promoter." Nat.Chem.Biol., 1, 167-173. pubmed Phan, A.T., Kuryavyi, V., Gaw, H.Y., Patel, D.J.
2a5r DNA nmr Complex of tetra-(4-n-methylpyridyl) porphin with monomeric parallel-stranded DNA tetraplex, snap-back 3+1 3' g-tetrad, single-residue chain reversal loops, gag triad in the context of gaag diagonal loop, c-myc promoter, nmr, 6 struct.; 3Dmol view …… (2005) "Small-molecule interaction with a five-guanine-tract G-quadruplex structure from the human MYC promoter." Nat.Chem.Biol., 1, 167-173. pubmed Phan, A.T., Kuryavyi, V., Gaw, H.Y., Patel, D.J.
2akg DNA nmr Thallium form of the g-quadruplex from oxytricha nova, d(g4t4g4)2; 3Dmol view …… (2005) "(205)Tl NMR methods for the characterization of monovalent cation binding to nucleic acids." J.Am.Chem.Soc., 127, 16723-16732. pubmed Gill, M.L., Strobel, S.A., Loria, J.P.
2aqy DNA nmr (3+1) assembly of three human telomeric DNA repeats into an asymmetrical dimeric g-quadruplex; 3Dmol view …… (2005) "(3 + 1) Assembly of three human telomeric repeats into an asymmetric dimeric G-quadruplex." J.Am.Chem.Soc., 127, 17277-17285. pubmed Zhang, N., Phan, A.T., Patel, D.J.
2avh DNA x-ray (1.5 Å) G4t3g4 dimeric quadruplex structure; 3Dmol view …… (2006) "Topology variation and loop structural homology in crystal and simulated structures of a bimolecular DNA quadruplex." J.Am.Chem.Soc., 128, 5480-5487. pubmed Hazel, P., Parkinson, G.N., Neidle, S.
2avj DNA x-ray (2.39 Å) G4(br)uttg4 dimeric quadruplex; 3Dmol view …… (2006) "Topology variation and loop structural homology in crystal and simulated structures of a bimolecular DNA quadruplex." J.Am.Chem.Soc., 128, 5480-5487. pubmed Hazel, P., Parkinson, G.N., Neidle, S.
2awe RNA x-ray (2.1 Å) Base-tetrad swapping results in dimerization of RNA quadruplexes: implications for formation of i-motif RNA octaplex; 3Dmol view …… (2006) "Base-tetrad swapping results in dimerization of RNA quadruplexes: implications for formation of the i-motif RNA octaplex." Proc.Natl.Acad.Sci.Usa, 103, 3130-3134. pubmed Pan, B., Shi, K., Sundaralingam, M.
2chj nucleic acid nmr Nmr structure of tglglt quadruplex; 3Dmol view …… (2006) "NMR Solution Structures of Lna (Locked Nucleic Acid) Modified Quadruplexes." Nucleic Acids Res., 34, 2006-. pubmed Nielsen, J.T., Arar, K., Petersen, M.
2chk nucleic acid nmr Nmr structure of tllllt quadruplex; 3Dmol view …… (2006) "NMR Solution Structures of Lna (Locked Nucleic Acid) Modified Quadruplexes." Nucleic Acids Res., 34, 2006-. pubmed Nielsen, J.T., Arar, K., Petersen, M.
2e4i DNA nmr Human telomeric DNA mixed-parallel-antiparallel quadruplex under physiological ionic conditions stabilized by proper incorporation of 8-bromoguanosines; 3Dmol view …… (2007) "Structure of a human telomeric DNA sequence stabilized by 8-bromoguanosine substitutions, as determined by NMR in a K+ solution." Febs J., 274, 3545-3556. pubmed Matsugami, A., Xu, Y., Noguchi, Y., Sugiyama, H., Katahira, M.
2f8u DNA nmr G-quadruplex structure formed in human bcl-2 promoter, hybrid form; 3Dmol view …… (2006) "NMR solution structure of the major G-quadruplex structure formed in the human BCL2 promoter region." Nucleic Acids Res., 34, 5133-5144. pubmed Dai, J., Chen, D., Jones, R.A., Hurley, L.H., Yang, D.
2gku DNA nmr Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, nmr, 12 structures; 3Dmol view …… (2006) "Structure of the human telomere in k(+) solution: an intramolecular (3 + 1) g-quadruplex scaffold." J.Am.Chem.Soc., 128, 9963-9970. pubmed Luu, K.N., Phan, A.T., Kuryavyi, V.V., Lacroix, L., Patel, D.J.
2grb RNA x-ray (1.4 Å) Crystal structure of an RNA quadruplex containing inosine-tetrad; 3Dmol view …… (2006) "Crystal structure of an RNA quadruplex containing inosine tetrad: implications for the roles of NH2 group in purine tetrads." J.Mol.Biol., 363, 451-459. pubmed Pan, B., Shi, K., Sundaralingam, M.
2gw0 DNA x-ray (1.55 Å) A d(tggggt)- sodium and calcium complex.; 3Dmol view …… (2007) "Observation of the coexistence of sodium and calcium ions in a DNA G-quadruplex ion channel." J.Am.Chem.Soc., 129, 10106-10107. pubmed Lee, M.P., Parkinson, G.N., Hazel, P., Neidle, S.
2gwe DNA x-ray (2.2 Å) Crystal structure of d(g4t4g4) with six quadruplexes in the asymmetric unit.; 3Dmol view …… Lee, M.P.H., Haider, S., Parkinson, G.N., Neidle, S.
2gwq DNA x-ray (2.0 Å) Crystal structure of d(g4t4g4) with four quadruplexes in the asymmetric unit.; 3Dmol view …… Lee, M.P.H., Haider, S., Parkinson, G.N., Neidle, S.
2hbn DNA x-ray (1.55 Å) Crystallization of the tl+-form of the oxytricha nova g-quadruplex; 3Dmol view …… (2006) "Crystallization and characterization of the thallium form of the Oxytricha nova G-quadruplex." Nucleic Acids Res., 34, 4506-4514. pubmed Gill, M.L., Strobel, S.A., Loria, J.P.
2hri DNA x-ray (2.09 Å) A parallel stranded human telomeric quadruplex in complex with the porphyrin tmpyp4; 3Dmol view …… (2007) "Structural basis for binding of porphyrin to human telomeres." Biochemistry, 46, 2390-2397. pubmed Parkinson, G.N., Ghosh, R., Neidle, S.
2hy9 DNA nmr Human telomere DNA quadruplex structure in k+ solution hybrid-1 form; 3Dmol view …… (2007) "Structure of the intramolecular human telomeric G-quadruplex in potassium solution: a novel adenine triple formation." Nucleic Acids Res., 35, 2440-2450. pubmed Dai, J., Punchihewa, C., Ambrus, A., Chen, D., Jones, R.A., Yang, D.
2idn DNA nmr Nmr structure of a new modified thrombin binding aptamer containing a 5'-5' inversion of polarity site; 3Dmol view …… (2006) "A new modified thrombin binding aptamer containing a 5'-5' inversion of polarity site." Nucleic Acids Res., 34, 6653-6662. pubmed Martino, L., Virno, A., Randazzo, A., Virgilio, A., Esposito, V., Giancola, C., Bucci, M., Cirino, G., Mayol, L.
2jpz DNA nmr Human telomere DNA quadruplex structure in k+ solution hybrid-2 form; 3Dmol view …… (2007) "Structure of the Hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: insights into structure polymorphism of the human telomeric sequence." Nucleic Acids Res., 35, 4927-4940. pubmed Dai, J., Carver, M., Punchihewa, C., Jones, R.A., Yang, D.
2jsk DNA nmr Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, 16 g form 1, nmr, 10 structures; 3Dmol view …… (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. pubmed Phan, A.T., Kuryavyi, V., Luu, K.N., Patel, D.J.
2jsl DNA nmr Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, form 2 natural, nmr, 10 structures; 3Dmol view …… (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. pubmed Phan, A.T., Kuryavyi, V., Luu, K.N., Patel, D.J.
2jsm DNA nmr Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, nmr, 10 structures, form 1 natural; 3Dmol view …… (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. pubmed Phan, A.T., Kuryavyi, V., Luu, K.N., Patel, D.J.
2jsq DNA nmr Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, form 2 15brg, nmr, 10 structures; 3Dmol view …… (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. pubmed Phan, A.T., Kuryavyi, V., Luu, K.N., Patel, D.J.
2jt7 DNA nmr Nmr solution structure of the 4:1 distamycin a-[d(tggggt)]4 complex; 3Dmol view …… (2007) "Structural and thermodynamic studies of the interaction of distamycin A with the parallel quadruplex structure [d(TGGGGT)]4." J.Am.Chem.Soc., 129, 16048-16056. pubmed Martino, L., Virno, A., Pagano, B., Virgilio, A., Di Micco, S., Galeone, A., Giancola, C., Bifulco, G., Mayol, L., Randazzo, A.
2jwq DNA nmr G-quadruplex recognition by quinacridines: a sar, nmr and biological study; 3Dmol view …… (2007) "G-Quadruplex Recognition by Quinacridines: a SAR, NMR, and Biological Study." ChemMedChem, 2, 655-666. pubmed Hounsou, C., Guittat, L., Monchaud, D., Jourdan, M., Saettel, N., Mergny, J.L., Teulade-Fichou, M.
2kaz DNA nmr Folding topology of a bimolecular DNA quadruplex containing a stable mini-hairpin motif within the connecting loop; 3Dmol view …… (2009) "Folding topology of a bimolecular DNA quadruplex containing a stable mini-hairpin motif within the diagonal loop." J.Mol.Biol., 385, 1600-1615. pubmed Balkwill, G.D., Garner, T.P., Williams, H.E., Searle, M.S.
2kbp RNA nmr Solution structure of a g-quadruplex of human telomeric RNA; 3Dmol view …… (2009) "Structure of propeller-type parallel-stranded RNA G-quadruplexes, formed by human telomeric RNA sequences in K+ solution." J.Am.Chem.Soc., 131, 2570-2578. pubmed Martadinata, H., Phan, A.T.
2kf7 DNA nmr Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by human telomeric repeats in k+ solution (with g7-to-brg substitution); 3Dmol view …… (2009) "Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers." J.Am.Chem.Soc., 131, 4301-4309. pubmed Lim, K.W., Amrane, S., Bouaziz, S., Xu, W., Mu, Y., Patel, D.J., Luu, K.N., Phan, A.T.
2kf8 DNA nmr Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by human telomeric repeats in k+ solution; 3Dmol view …… (2009) "Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers." J.Am.Chem.Soc., 131, 4301-4309. pubmed Lim, K.W., Amrane, S., Bouaziz, S., Xu, W., Mu, Y., Patel, D.J., Luu, K.N., Phan, A.T.
2kka DNA nmr Human telomere DNA two-tetrad quadruplex structure in k+ solution; 3Dmol view …… (2010) "Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution: insights into the interconversion of human telomeric G-quadruplex structures." Nucleic Acids Res., 38, 1009-1021. pubmed Zhang, Z., Dai, J., Veliath, E., Jones, R.A., Yang, D.
2km3 DNA nmr Structure of an intramolecular g-quadruplex containing a g.c.g.c tetrad formed by human telomeric variant ctaggg repeats; 3Dmol view …… (2009) "Sequence variant (CTAGGG)n in the human telomere favors a G-quadruplex structure containing a G.C.G.C tetrad." Nucleic Acids Res., 37, 6239-6248. pubmed Lim, K.W., Alberti, P., Guedin, A., Lacroix, L., Riou, J.F., Royle, N.J., Mergny, J.L., Phan, A.T.
2kow DNA nmr Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by giardia telomeric repeat d(taggg)4 in k+ solution (with g18-to-ino substitution); 3Dmol view …… (2009) "Giardia Telomeric Sequence d(TAGGG)(4) Forms Two Intramolecular G-Quadruplexes in K(+) Solution: Effect of Loop Length and Sequence on the Folding Topology." J.Am.Chem.Soc., 131, 16824-16831. pubmed Hu, L., Lim, K.W., Bouaziz, S., Phan, A.T.
2kpr DNA nmr Monomeric intronic human chl1 gene quadruplex DNA nmr, 17 structures; 3Dmol view …… (2010) "Solution Structure of a Unique G-Quadruplex Scaffold Adopted by a Guanosine-Rich Human Intronic Sequence." Structure, 18, 73-82. pubmed Kuryavyi, V., Patel, D.J.
2kqg DNA nmr A g-rich sequence within the c-kit oncogene promoter forms a parallel g-quadruplex having asymmetric g-tetrad dynamics; 3Dmol view …… (2009) "A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics." J.Am.Chem.Soc., 131, 13399-13409. pubmed Hsu, S.-T.D., Varnai, P., Bugaut, A., Reszka, A.P., Neidle, S., Balasubramanian, S.
2kqh DNA nmr A g-rich sequence within the c-kit oncogene promoter forms a parallel g-quadruplex having asymmetric g-tetrad dynamics; 3Dmol view …… (2009) "A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics." J.Am.Chem.Soc., 131, 13399-13409. pubmed Hsu, S.-T.D., Varnai, P., Bugaut, A., Reszka, A.P., Neidle, S., Balasubramanian, S.
2kvy DNA nmr Nmr solution structure of the 4:1 complex between an uncharged distamycin a analogue and [d(tggggt)]4; 3Dmol view …… (2010) "Structural and conformational requisites in DNA quadruplex groove binding: another piece to the puzzle." J.Am.Chem.Soc., 132, 6425-6433. pubmed Cosconati, S., Marinelli, L., Trotta, R., Virno, A., De Tito, S., Romagnoli, R., Pagano, B., Limongelli, V., Giancola, C., Baraldi, P.G., Mayol, L., Novellino, E., Randazzo, A.
2kyo DNA nmr Dimeric human ckit-2 proto-oncogene promoter quadruplex DNA nmr, 10 structures; 3Dmol view …… (2010) "Solution structures of all parallel-stranded monomeric and dimeric G-quadruplex scaffolds of the human c-kit2 promoter." Nucleic Acids Res., 38, 6757-6773. pubmed Kuryavyi, V., Phan, A.T., Patel, D.J.
2kyp DNA nmr Monomeric human ckit-2 proto-oncogene promoter quadruplex DNA nmr, 12 structures; 3Dmol view …… (2010) "Solution structures of all parallel-stranded monomeric and dimeric G-quadruplex scaffolds of the human c-kit2 promoter." Nucleic Acids Res., 38, 6757-6773. pubmed Kuryavyi, V., Phan, A.T., Patel, D.J.
2kzd DNA nmr Structure of a (3+1) g-quadruplex formed by htert promoter sequence; 3Dmol view …… (2010) "Coexistence of two distinct G-quadruplex conformations in the hTERT promoter." J.Am.Chem.Soc., 132, 12331-12342. pubmed Lim, K.W., Lacroix, L., Yue, D.J.E., Lim, J.K.C., Lim, J.M.W., Phan, A.T.
2kze DNA nmr Structure of an all-parallel-stranded g-quadruplex formed by htert promoter sequence; 3Dmol view …… (2010) "Coexistence of two distinct G-quadruplex conformations in the hTERT promoter." J.Am.Chem.Soc., 132, 12331-12342. pubmed Lim, K.W., Lacroix, L., Yue, D.J.E., Lim, J.K.C., Lim, J.M.W., Phan, A.T.
2l7v DNA-inhibitor nmr Quindoline-g-quadruplex complex; 3Dmol view …… (2011) "Solution Structure of a 2:1 Quindoline-c-MYC G-Quadruplex: Insights into G-Quadruplex-Interactive Small Molecule Drug Design." J.Am.Chem.Soc., 133, 17673-17680. pubmed Dai, J., Carver, M., Hurley, L.H., Yang, D.
2l88 DNA nmr Solution structure of all parallel g-quadruplex formed by the oncogene ret promoter sequence; 3Dmol view …… (2011) "Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence." Nucleic Acids Res., 39, 6753-6763. pubmed Tong, X., Lan, W., Zhang, X., Wu, H., Liu, M., Cao, C.
2la5 RNA binding protein-RNA nmr RNA duplex-quadruplex junction complex with fmrp rgg peptide; 3Dmol view …… (2011) "Structure-function studies of FMRP RGG peptide recognition of an RNA duplex-quadruplex junction." Nat.Struct.Mol.Biol., 18, 796-804. pubmed Phan, A.T., Kuryavyi, V., Darnell, J.C., Serganov, A., Majumdar, A., Ilin, S., Raslin, T., Polonskaia, A., Chen, C., Clain, D., Darnell, R.B., Patel, D.J.
2lby DNA nmr G-quadruplex structure formed at the 5'-end of nheiii_1 element in human c-myc promoter; 3Dmol view …… (2011) "c-MYC promoter G-quadruplex formed at the 5'-end of NHE III1 element: insights into biological relevance and parallel-stranded G-quadruplex stability." Nucleic Acids Res., 39, 9023-9033. pubmed Mathad, R.I., Hatzakis, E., Dai, J., Yang, D.
2ld8 DNA nmr Structure of human telomeric DNA in crowded solution; 3Dmol view …… (2011) "Structure of Human Telomeric DNA in Crowded Solution." J.Am.Chem.Soc. pubmed Heddi, B., Phan, A.T.
2le6 DNA nmr Structure of a dimeric all-parallel-stranded g-quadruplex stacked via the 5'-to-5' interface; 3Dmol view …… (2011) "Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity." Nucleic Acids Res. pubmed Do, N.Q., Lim, K.W., Teo, M.H., Heddi, B., Phan, A.T.
2led DNA nmr Unique structural features of interconverting monomeric and dimeric g-quadruplexes adopted by a sequence from intron of n-myc gene; 3Dmol view …… (2012) "Unique Structural Features of Interconverting Monomeric and Dimeric G-Quadruplexes Adopted by a Sequence from the Intron of the N-myc Gene." J.Am.Chem.Soc., 134, 4132-4141. pubmed Trajkovski, M., Webba da Silva, M., Plavec, J.
2lee DNA nmr Unique structural features of interconverting monomeric and dimeric g-quadruplexes adopted by a sequence from intron of n-myc gene; 3Dmol view …… (2012) "Unique Structural Features of Interconverting Monomeric and Dimeric G-Quadruplexes Adopted by a Sequence from the Intron of the N-myc Gene." J.Am.Chem.Soc., 134, 4132-4141. pubmed Trajkovski, M., Webba da Silva, M., Plavec, J.
2lk7 DNA nmr Monomer-dimer equilibrium for 5'-5' stacking of propeller-type parallel-stranded g-quadruplexes: nmr structural study; 3Dmol view …… (2012) "Monomer-Dimer Equilibrium for the 5'-5' Stacking of Propeller-Type Parallel-Stranded G-Quadruplexes: NMR Structural Study." Chemistry pubmed Do, N.Q., Phan, A.T.
2lod DNA nmr Solution-state structure of an intramolecular g-quadruplex with propeller, diagonal and edgewise loops; 3Dmol view …… (2012) "Solution-state structure of an intramolecular G-quadruplex with propeller, diagonal and edgewise loops." Nucleic Acids Res., 40, 6946-6956. pubmed Marusic, M., Sket, P., Bauer, L., Viglasky, V., Plavec, J.
2lpw DNA nmr Human ceb25 minisatellite g-quadruplex; 3Dmol view …… (2012) "Formation of Pearl-Necklace Monomorphic G-Quadruplexes in the Human CEB25 Minisatellite." J.Am.Chem.Soc., 134, 5807-5816. pubmed Amrane, S., Adrian, M., Heddi, B., Serero, A., Nicolas, A., Mergny, J.L., Phan, A.T.
2lxq DNA nmr Monomeric pile g-quadruplex DNA from neisseria gonorrhoeae; 3Dmol view …… (2012) "RecA-Binding pilE G4 Sequence Essential for Pilin Antigenic Variation Forms Monomeric and 5' End-Stacked Dimeric Parallel G-Quadruplexes." Structure, 20, 2090-2102. pubmed Kuryavyi, V., Cahoon, L.A., Seifert, H.S., Patel, D.J.
2lxv DNA nmr Dimeric pil-e g-quadruplex DNA from neisseria gonorrhoeae, nmr 11 structures; 3Dmol view …… (2012) "RecA-Binding pilE G4 Sequence Essential for Pilin Antigenic Variation Forms Monomeric and 5' End-Stacked Dimeric Parallel G-Quadruplexes." Structure, 20, 2090-2102. pubmed Kuryavyi, V., Cahoon, L.A., Seifert, H.S., Patel, D.J.
2lyg DNA nmr Fuc_tba; 3Dmol view …… (2013) "Carbohydrate-DNA interactions at G-quadruplexes: folding and stability changes by attaching sugars at the 5'-end." Chemistry, 19, 1920-1927. pubmed Gomez-Pinto, I., Vengut-Climent, E., Lucas, R., Avino, A., Eritja, R., Gonzalez, C., Morales, J.C.
2m18 RNA nmr Structure of stacked g-quadruplex formed by human terra sequence in potassium solution; 3Dmol view …… (2013) "Structure of Human Telomeric RNA (TERRA): Stacking of Two G-Quadruplex Blocks in K(+) Solution." Biochemistry, 52, 2176-2183. pubmed Martadinata, H., Phan, A.T.
2m1g DNA nmr Parallel human telomeric quadruplex containing 2'f-ana substitutions; 3Dmol view …… (2013) "Dramatic effect of furanose c2' substitution on structure and stability: directing the folding of the human telomeric quadruplex with a single fluorine atom." J.Am.Chem.Soc., 135, 5344-5347. pubmed Martin-Pintado, N., Yahyaee-Anzahaee, M., Deleavey, G.F., Portella, G., Orozco, M., Damha, M.J., Gonzalez, C.
2m27 DNA nmr Major g-quadruplex structure formed in human vegf promoter, a monomeric parallel-stranded quadruplex; 3Dmol view …… (2013) "Solution structure of the major G-quadruplex formed in the human VEGF promoter in K+: insights into loop interactions of the parallel G-quadruplexes." Nucleic Acids Res., 41, 10584-10592. pubmed Agrawal, P., Hatzakis, E., Guo, K., Carver, M., Yang, D.
2m4p DNA nmr Solution structure of an intramolecular propeller-type g-quadruplex containing a single bulge; 3Dmol view …… (2013) "Bulges in G-Quadruplexes: Broadening the Definition of G-Quadruplex-Forming Sequences." J.Am.Chem.Soc., 135, 5017-5028. pubmed Mukundan, V.T., Phan, A.T.
2m53 DNA nmr G-rich vegf aptamer with lna modifications; 3Dmol view …… (2013) "G-rich VEGF aptamer with locked and unlocked nucleic acid modifications exhibits a unique G-quadruplex fold." Nucleic Acids Res. pubmed Marusic, M., Veedu, R.N., Wengel, J., Plavec, J.
2m6v DNA nmr Solution nmr structure of the d(gggttgggttttgggtggg) quadruplex in sodium conditions; 3Dmol view …… (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007-eaat3007. pubmed Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.
2m6w DNA nmr Solution nmr structure of the d(ggggttggggttttggggaagggg) quadruplex in sodium conditions; 3Dmol view …… (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007-eaat3007. pubmed Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.
2m8z DNA nmr Structure of d[ggttggcgcgaagcattcgcgggttgg] quadruplex-duplex hybrid; 3Dmol view …… (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. pubmed Lim, K.W., Phan, A.T.
2m90 DNA nmr Structure of d[gcgcgaagcattcgcggggaggtggggaaggg] quadruplex-duplex hybrid; 3Dmol view …… (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. pubmed Lim, K.W., Phan, A.T.
2m91 DNA nmr Structure of d[gggaagggcgcgaagcattcgcgaggtagg] quadruplex-duplex hybrid; 3Dmol view …… (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. pubmed Lim, K.W., Phan, A.T.
2m92 DNA nmr Structure of d[agggtgggtgctggggcgcgaagcattcgcgagg] quadruplex-duplex hybrid; 3Dmol view …… (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. pubmed Lim, K.W., Phan, A.T.
2m93 DNA nmr Structure of d[ttgggtgggcgcgaagcattcgcggggtgggt] quadruplex-duplex hybrid; 3Dmol view …… (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. pubmed Lim, K.W., Phan, A.T.
2may DNA nmr Structure of a g-quadruplex containing a single lna modification; 3Dmol view …… Li, Z., Lech, C., Adrian, M., Heddi, B., Phan, A.T.
2mb2 DNA nmr Parallel-stranded g-quadruplex in DNA poly-g stretches; 3Dmol view …… (2014) "Formation of g-quadruplexes in poly-g sequences: structure of a propeller-type parallel-stranded g-quadruplex formed by a g15 stretch." Biochemistry, 53, 7718-7723. pubmed Sengar, A., Heddi, B., Phan, A.T.
2mb3 DNA-DNA inhibitor nmr Solution structure of an intramolecular (3+1) human telomeric g-quadruplex bound to a telomestatin derivative; 3Dmol view …… (2013) "Solution structure of an intramolecular (3 + 1) human telomeric g-quadruplex bound to a telomestatin derivative." J.Am.Chem.Soc., 135, 13495-13501. pubmed Chung, W.J., Heddi, B., Tera, M., Iida, K., Nagasawa, K., Phan, A.T.
2mb4 DNA nmr Solution structure of a stacked dimeric g-quadruplex formed by a segment of the human ceb1 minisatellite; 3Dmol view …… (2014) "Structure and Conformational Dynamics of a Stacked Dimeric G-Quadruplex Formed by the Human CEB1 Minisatellite." J.Am.Chem.Soc., 136, 6297-6305. pubmed Adrian, M., Ang, D.J., Lech, C.J., Heddi, B., Nicolas, A., Phan, A.T.
2mbj DNA nmr Structure of an antiparallel (2+2) g-quadruplex formed by human telomeric repeats in na+ solution (with g22-to-brg substitution); 3Dmol view …… (2013) "Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity." Nucleic Acids Res., 41, 10556-10562. pubmed Lim, K.W., Ng, V.C., Martin-Pintado, N., Heddi, B., Phan, A.T.
2mcc DNA nmr Structural studies on dinuclear ruthenium(ii) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence; 3Dmol view …… (2013) "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence." J.Med.Chem., 56, 8674-8683. pubmed Wilson, T., Costa, P.J., Felix, V., Williamson, M.P., Thomas, J.A.
2mco DNA nmr Structural studies on dinuclear ruthenium(ii) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence; 3Dmol view …… (2013) "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence." J.Med.Chem., 56, 8674-8683. pubmed Wilson, T., Costa, P.J., Felix, V., Williamson, M.P., Thomas, J.A.
2mft DNA nmr Solution nmr structure of the d(gggttttgggtgggttttggg) quadruplex in sodium conditions; 3Dmol view …… Karsisiotis, A.I., Webba da Silva, M.
2mfu DNA nmr Solution nmr structure of quadruplex d(tgggtttgggttgggtttggg) in sodium conditions; 3Dmol view …… Karsisiotis, A., Dillon, P., Webba da Silva, M.
2mgn DNA nmr Solution structure of a g-quadruplex bound to the bisquinolinium compound phen-dc3; 3Dmol view …… (2014) "Solution Structure of a G-quadruplex Bound to the Bisquinolinium Compound Phen-DC3." Angew.Chem.Int.Ed.Engl., 53, 999-1002. pubmed Chung, W.J., Heddi, B., Hamon, F., Teulade-Fichou, M.P., Phan, A.T.
2ms6 DNA nmr Human telomeric g-quadruplex DNA sequence (ttagggt)4 complexed with flavonoid quercetin; 3Dmol view …… (2015) "Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence." Sci Rep, 5, 17574-17574. pubmed Tawani, A., Kumar, A.
2ms9 DNA nmr Solution structure of a g-quadruplex; 3Dmol view …… Chung, W.J., Heddi, B., Schmitt, E., Lim, K.W., Mechulam, Y., Phan, A.T.
2mwz DNA nmr Xanthine and 8-oxoguanine in g-quadruplexes: formation of a g g x o tetrad; 3Dmol view …… (2015) "Xanthine and 8-oxoguanine in G-quadruplexes: formation of a GGXO tetrad." Nucleic Acids Res., 43, 10506-10514. pubmed Cheong, V.V., Heddi, B., Lech, C.J., Phan, A.T.
2n21 hydrolase-DNA nmr Solution structure of complex between DNA g-quadruplex and g-quadruplex recognition domain of rhau; 3Dmol view …… (2015) "Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex." Proc.Natl.Acad.Sci.USA pubmed Heddi, B., Cheong, V.V., Martadinata, H., Phan, A.T.
2n2d DNA nmr Structure of DNA g-quadruplex adopted by als and ftd related ggggcc repeat with g21 to br-g21 substitution; 3Dmol view …… (2015) "Solution structure of a DNA quadruplex containing ALS and FTD related GGGGCC repeat stabilized by 8-bromodeoxyguanosine substitution." Nucleic Acids Res., 43, 8590-8600. pubmed Brcic, J., Plavec, J.
2n3m DNA nmr G-quadruplex structure of an anti-proliferative DNA sequence; 3Dmol view …… Do, N.Q., Chung, W.J., Truong, T.H.A., Heddi, B., Phan, A.T.
2n4y DNA nmr Structure and possible function of a g-quadruplex in the long terminal repeat of the proviral hiv-1 genome; 3Dmol view …… (2016) "Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome." Nucleic Acids Res., 44, 6442-6451. pubmed De Nicola, B., Lech, C.J., Heddi, B., Regmi, S., Frasson, I., Perrone, R., Richter, S.N., Phan, A.T.
2n60 DNA nmr G-quadruplexes with (4n-1) guanines in the g-tetrad core: formation of a g-triad water complex and implication for small-molecule binding; 3Dmol view …… (2016) "G-quadruplexes with (4n - 1) guanines in the G-tetrad core: formation of a G-triadwater complex and implication for small-molecule binding." Nucleic Acids Res., 44, 910-916. pubmed Heddi, B., Martin-Pintado, N., Serimbetov, Z., Kari, T.M., Phan, A.T.
2n6c DNA nmr Solution structure for quercetin complexed with c-myc g-quadruplex DNA; 3Dmol view …… Kumar, A., Tawani, A.
2n9q DNA nmr Photoswitchable g-quadruplex; 3Dmol view …… (2016) "Photoresponsive Formation of an Intermolecular Minimal G-Quadruplex Motif." Angew.Chem.Int.Ed.Engl., 55, 2738-2742. pubmed Thevarpadam, J., Bessi, I., Binas, O., Goncalves, D.P., Slavov, C., Jonker, H.R., Richter, C., Wachtveitl, J., Schwalbe, H., Heckel, A.
2o3m DNA nmr Monomeric g-DNA tetraplex from human c-kit promoter; 3Dmol view …… (2007) "Structure of an unprecedented G-quadruplex scaffold in the human c-kit promoter." J.Am.Chem.Soc., 129, 4386-4392. pubmed Phan, A.T., Kuryavyi, V.V., Burge, S., Neidle, S., Patel, D.J.
2o4f DNA x-ray (1.5 Å) Structure of a parallel-stranded guanine tetraplex crystallised with monovalent ions; 3Dmol view …… (2007) "Structure of a d(TGGGGT) quadruplex crystallized in the presence of Li+ ions." Acta Crystallogr.,Sect.D, 63, 682-688. pubmed Creze, C., Rinaldi, B., Haser, R., Bouvet, P., Gouet, P.
2rqj RNA nmr Quadruplex structure of an RNA aptamer against bovine prion protein; 3Dmol view …… (2009) "Unique quadruplex structure and interaction of an RNA aptamer against bovine prion protein." Nucleic Acids Res., 37, 6249-6258. pubmed Mashima, T., Matsugami, A., Nishikawa, F., Nishikawa, S., Katahira, M.
2rsk membrane protein-RNA nmr RNA aptamer against prion protein in complex with the partial binding peptide; 3Dmol view …… (2013) "Anti-prion activity of an RNA aptamer and its structural basis." Nucleic Acids Res., 41, 1355-1362. pubmed Mashima, T., Nishikawa, F., Kamatari, Y.O., Fujiwara, H., Saimura, M., Nagata, T., Kodaki, T., Nishikawa, S., Kuwata, K., Katahira, M.
2ru7 membrane protein-RNA nmr Refined structure of RNA aptamer in complex with the partial binding peptide of prion protein; 3Dmol view …… (2014) "Binding of an RNA aptamer and a partial peptide of a prion protein: crucial importance of water entropy in molecular recognition." Nucleic Acids Res. pubmed Hayashi, T., Oshima, H., Mashima, T., Nagata, T., Katahira, M., Kinoshita, M.
2wcn DNA nmr Solution structure of an lna-modified quadruplex; 3Dmol view …… (2009) "Solution Structure of a Locked Nucleic Acid Modified Quadruplex: Introducing the V4 Folding Topology." Angew.Chem.Int.Ed.Engl., 48, 3099-. pubmed Nielsen, J.T., Arar, K., Petersen, M.
352d DNA x-ray (0.95 Å) The crystal structure of a parallel-stranded parallel-stranded guanine tetraplex at 0.95 angstrom resolution; 3Dmol view …… (1997) "The crystal structure of a parallel-stranded guanine tetraplex at 0.95 A resolution." J.Mol.Biol., 273, 171-182. pubmed Phillips, K., Dauter, Z., Murchie, A.I., Lilley, D.M., Luisi, B.
3cco DNA x-ray (2.2 Å) Structural adaptation and conservation in quadruplex-drug recognition; 3Dmol view …… (2008) "Topology conservation and loop flexibility in quadruplex-drug recognition: crystal structures of inter- and intramolecular telomeric DNA quadruplex-drug complexes." J.Mol.Biol., 381, 1145-1156. pubmed Parkinson, G.N., Cuenca, F., Neidle, S.
3cdm DNA x-ray (2.1 Å) Structural adaptation and conservation in quadruplex-drug recognition; 3Dmol view …… (2008) "Topology conservation and loop flexibility in quadruplex-drug recognition: crystal structures of inter- and intramolecular telomeric DNA quadruplex-drug complexes." J.Mol.Biol., 381, 1145-1156. pubmed Parkinson, G.N., Cuenca, F., Neidle, S.
3ce5 DNA x-ray (2.5 Å) A bimolecular parallel-stranded human telomeric quadruplex in complex with a 3,6,9-trisubstituted acridine molecule braco19; 3Dmol view …… (2008) "Structural basis of DNA quadruplex recognition by an acridine drug." J.Am.Chem.Soc., 130, 6722-6724. pubmed Campbell, N.H., Parkinson, G.N., Reszka, A.P., Neidle, S.
3em2 DNA x-ray (2.3 Å) A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6038; 3Dmol view …… (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. pubmed Campbell, N.H., Patel, M., Tofa, A.B., Ghosh, R., Parkinson, G.N., Neidle, S.
3eqw DNA x-ray (2.2 Å) A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6042 in small unit cell; 3Dmol view …… (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. pubmed Campbell, N.H., Patel, M., Tofa, A.B., Ghosh, R., Parkinson, G.N., Neidle, S.
3eru DNA x-ray (2.0 Å) A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6045; 3Dmol view …… (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. pubmed Campbell, N.H., Patel, M., Tofa, A.B., Ghosh, R., Parkinson, G.N., Neidle, S.
3es0 DNA x-ray (2.2 Å) A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6048; 3Dmol view …… (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. pubmed Campbell, N.H., Patel, M., Tofa, A.B., Ghosh, R., Parkinson, G.N., Neidle, S.
3et8 DNA x-ray (2.45 Å) A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6054; 3Dmol view …… (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. pubmed Campbell, N.H., Patel, M., Tofa, A.B., Ghosh, R., Parkinson, G.N., Neidle, S.
3eui DNA x-ray (2.2 Å) A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6042 in a large unit cell; 3Dmol view …… (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. pubmed Campbell, N.H., Patel, M., Tofa, A.B., Ghosh, R., Parkinson, G.N., Neidle, S.
3eum DNA x-ray (1.78 Å) A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6066; 3Dmol view …… (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. pubmed Campbell, N.H., Patel, M., Tofa, A.B., Ghosh, R., Parkinson, G.N., Neidle, S.
3ibk RNA x-ray (2.2 Å) Crystal structure of a telomeric RNA quadruplex; 3Dmol view …… (2010) "A crystallographic and modelling study of a human telomeric RNA (TERRA) quadruplex." Nucleic Acids Res., 38, 5569-5580. pubmed Collie, G.W., Haider, S.M., Neidle, S., Parkinson, G.N.
3mij RNA x-ray (2.6 Å) Crystal structure of a telomeric RNA g-quadruplex complexed with an acridine-based ligand.; 3Dmol view …… (2011) "Structural basis of telomeric RNA quadruplex-acridine ligand recognition." J.Am.Chem.Soc., 133, 2721-2728. pubmed Collie, G.W., Sparapani, S., Parkinson, G.N., Neidle, S.
3nyp DNA x-ray (1.18 Å) A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine ligand containing bis-3-fluoropyrrolidine end side chains; 3Dmol view …… (2011) "Fluorine in medicinal chemistry: beta-fluorination of peripheral pyrrolidines attached to acridine ligands affects their interactions with G-quadruplex DNA." Org.Biomol.Chem., 9, 1328-1331. pubmed Campbell, N.H., Smith, D.L., Reszka, A.P., Neidle, S., O'Hagan, D.
3nz7 DNA x-ray (1.1 Å) A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine ligand containing bis-3-fluoropyrrolidine end side chains; 3Dmol view …… (2011) "Fluorine in medicinal chemistry: beta-fluorination of peripheral pyrrolidines attached to acridine ligands affects their interactions with G-quadruplex DNA." Org.Biomol.Chem., 9, 1328-1331. pubmed Campbell, N.H., Smith, D.L., Reszka, A.P., Neidle, S., O'Hagan, D.
3qcr DNA x-ray (3.2 Å) Incomplete structural model of a human telomeric DNA quadruplex-acridine complex.; 3Dmol view …… (2011) "Structural basis of telomeric RNA quadruplex-acridine ligand recognition." J.Am.Chem.Soc., 133, 2721-2728. pubmed Collie, G.W., Sparapani, S., Parkinson, G.N., Neidle, S.
3qlp hydrolase-hydrolase inhibitor-DNA x-ray (2.14 Å) X-ray structure of the complex between human alpha thrombin and a modified thrombin binding aptamer (mtba); 3Dmol view …… (2011) "Thrombin-aptamer recognition: a revealed ambiguity." Nucleic Acids Res., 39, 7858-7867. pubmed Russo Krauss, I., Merlino, A., Giancola, C., Randazzo, A., Mazzarella, L., Sica, F.
3qsc DNA x-ray (2.4 Å) The first crystal structure of a human telomeric g-quadruplex DNA bound to a metal-containing ligand (a copper complex); 3Dmol view …… (2012) "Molecular basis of structure-activity relationships between salphen metal complexes and human telomeric DNA quadruplexes." J.Med.Chem., 55, 209-222. pubmed Campbell, N.H., Karim, N.H., Parkinson, G.N., Gunaratnam, M., Petrucci, V., Todd, A.K., Vilar, R., Neidle, S.
3qsf DNA x-ray (2.4 Å) The first crystal structure of a human telomeric g-quadruplex DNA bound to a metal-containing ligand (a nickel complex); 3Dmol view …… (2012) "Molecular basis of structure-activity relationships between salphen metal complexes and human telomeric DNA quadruplexes." J.Med.Chem., 55, 209-222. pubmed Campbell, N.H., Karim, N.H., Parkinson, G.N., Gunaratnam, M., Petrucci, V., Todd, A.K., Vilar, R., Neidle, S.
3qxr DNA x-ray (1.62 Å) Crystal structure of the brominated ckit-1 proto-oncogene promoter quadruplex DNA; 3Dmol view …… (2012) "Crystal structure of a c-kit promoter quadruplex reveals the structural role of metal ions and water molecules in maintaining loop conformation." Nucleic Acids Res., 40, 4691-4700. pubmed Wei, D., Parkinson, G.N., Reszka, A.P., Neidle, S.
3r6r DNA-antibiotic x-ray (2.4 Å) Structure of the complex of an intramolecular human telomeric DNA with berberine formed in k+ solution; 3Dmol view …… (2013) "The crystal structure of human telomeric DNA complexed with berberine: an interesting case of stacked ligand to G-tetrad ratio higher than 1:1." Nucleic Acids Res., 41, 632-638. pubmed Bazzicalupi, C., Ferraroni, M., Bilia, A.R., Scheggi, F., Gratteri, P.
3sc8 DNA x-ray (2.3 Å) Crystal structure of an intramolecular human telomeric DNA g-quadruplex bound by the naphthalene diimide bmsg-sh-3; 3Dmol view …… (2012) "Structural basis for telomeric g-quadruplex targeting by naphthalene diimide ligands." J.Am.Chem.Soc., 134, 2723-2731. pubmed Collie, G.W., Promontorio, R., Hampel, S.M., Micco, M., Neidle, S., Parkinson, G.N.
3t5e DNA x-ray (2.1 Å) Crystal structure of an intramolecular human telomeric DNA g-quadruplex bound by the naphthalene diimide bmsg-sh-4; 3Dmol view …… (2012) "Structural basis for telomeric g-quadruplex targeting by naphthalene diimide ligands." J.Am.Chem.Soc., 134, 2723-2731. pubmed Collie, G.W., Promontorio, R., Hampel, S.M., Micco, M., Neidle, S., Parkinson, G.N.
3tvb DNA-antibiotic x-ray (1.08 Å) A highly symmetric DNA g-4 quadruplex-drug complex; 3Dmol view …… (2012) "The high-resolution crystal structure of a parallel intermolecular DNA G-4 quadruplex/drug complex employing syn glycosyl linkages." Nucleic Acids Res., 40, 5731-5738. pubmed Clark, G.R., Pytel, P.D., Squire, C.J.
3uyh DNA x-ray (1.95 Å) Crystal structure of an intramolecular human telomeric DNA g-quadruplex bound by the naphthalene diimide compound, mm41; 3Dmol view …… (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. pubmed Micco, M., Collie, G.W., Dale, A.G., Ohnmacht, S.A., Pazitna, I., Gunaratnam, M., Reszka, A.P., Neidle, S.
4da3 DNA x-ray (2.4 Å) Crystal structure of an intramolecular human telomeric DNA g-quadruplex 21-mer bound by the naphthalene diimide compound mm41.; 3Dmol view …… (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. pubmed Micco, M., Collie, G.W., Dale, A.G., Ohnmacht, S.A., Pazitna, I., Gunaratnam, M., Reszka, A.P., Neidle, S.
4daq DNA x-ray (2.75 Å) Crystal structure of an intramolecular human telomeric DNA g-quadruplex 21-mer bound by the naphthalene diimide compound bmsg-sh-3; 3Dmol view …… (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. pubmed Micco, M., Collie, G.W., Dale, A.G., Ohnmacht, S.A., Pazitna, I., Gunaratnam, M., Reszka, A.P., Neidle, S.
4dih hydrolase-hydrolase inhibitor-DNA x-ray (1.8 Å) X-ray structure of the complex between human alpha thrombin and thrombin binding aptamer in the presence of sodium ions; 3Dmol view …… (2012) "High-resolution structures of two complexes between thrombin and thrombin-binding aptamer shed light on the role of cations in the aptamer inhibitory activity." Nucleic Acids Res., 40, 8119-8128. pubmed Russo Krauss, I., Merlino, A., Randazzo, A., Novellino, E., Mazzarella, L., Sica, F.
4dii hydrolase-hydrolase inhibitor-DNA x-ray (2.05 Å) X-ray structure of the complex between human alpha thrombin and thrombin binding aptamer in the presence of potassium ions; 3Dmol view …… (2012) "High-resolution structures of two complexes between thrombin and thrombin-binding aptamer shed light on the role of cations in the aptamer inhibitory activity." Nucleic Acids Res., 40, 8119-8128. pubmed Russo Krauss, I., Merlino, A., Randazzo, A., Novellino, E., Mazzarella, L., Sica, F.
4fxm DNA x-ray (1.65 Å) Crystal structure of the complex of a human telomeric repeat g-quadruplex and n-methyl mesoporphyrin ix (p21212); 3Dmol view …… (2012) "Optimized End-Stacking Provides Specificity of N-Methyl Mesoporphyrin IX for Human Telomeric G-Quadruplex DNA." J.Am.Chem.Soc., 134, 20446-20456. pubmed Nicoludis, J.M., Miller, S.T., Jeffrey, P.D., Barrett, S.P., Rablen, P.R., Lawton, T.J., Yatsunyk, L.A.
4g0f DNA x-ray (2.15 Å) Crystal structure of the complex of a human telomeric repeat g-quadruplex and n-methyl mesoporphyrin ix (p6); 3Dmol view …… (2012) "Optimized End-Stacking Provides Specificity of N-Methyl Mesoporphyrin IX for Human Telomeric G-Quadruplex DNA." J.Am.Chem.Soc., 134, 20446-20456. pubmed Nicoludis, J.M., Miller, S.T., Jeffrey, P.D., Barrett, S.P., Rablen, P.R., Lawton, T.J., Yatsunyk, L.A.
4h29 DNA x-ray (1.99 Å) B-raf dimer DNA quadruplex; 3Dmol view …… (2013) "Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex." J.Am.Chem.Soc., 135, 19319-19329. pubmed Wei, D., Todd, A.K., Zloh, M., Gunaratnam, M., Parkinson, G.N., Neidle, S.
4i7y hydrolase-hydrolase inhibitor-DNA x-ray (2.4 Å) Crystal structure of human alpha thrombin in complex with a 27-mer aptamer bound to exosite ii; 3Dmol view …… (2013) "Duplex-quadruplex motifs in a peculiar structural organization cooperatively contribute to thrombin binding of a DNA aptamer." Acta Crystallogr.,Sect.D, 69, 2403-2411. pubmed Russo Krauss, I., Pica, A., Merlino, A., Mazzarella, L., Sica, F.
4kzd immune system-RNA x-ray (2.19 Å) Crystal structure of an RNA aptamer in complex with fluorophore and fab; 3Dmol view …… (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. pubmed Huang, H., Suslov, N.B., Li, N.S., Shelke, S.A., Evans, M.E., Koldobskaya, Y., Rice, P.A., Piccirilli, J.A.
4kze immune system-RNA x-ray (2.4 Å) Crystal structure of an RNA aptamer in complex with fab; 3Dmol view …… (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. pubmed Huang, H., Suslov, N.B., Li, N.S., Shelke, S.A., Evans, M.E., Koldobskaya, Y., Rice, P.A., Piccirilli, J.A.
4l0a DNA, RNA x-ray (1.7 Å) X-ray structure of an all lna quadruplex; 3Dmol view …… (2014) "A regular thymine tetrad and a peculiar supramolecular assembly in the first crystal structure of an all-LNA G-quadruplex." Acta Crystallogr.,Sect.D, 70, 362-370. pubmed Russo Krauss, I., Parkinson, G.N., Merlino, A., Mattia, C.A., Randazzo, A., Novellino, E., Mazzarella, L., Sica, F.
4lz1 hydrolase-hydrolase inhibitor-DNA x-ray (1.65 Å) X-ray structure of the complex between human thrombin and the tba deletion mutant lacking thymine 12 nucleobase; 3Dmol view …… (2013) "Dissecting the contribution of thrombin exosite I in the recognition of thrombin binding aptamer." Febs J., 280, 6581-6588. pubmed Pica, A., Russo Krauss, I., Merlino, A., Nagatoishi, S., Sugimoto, N., Sica, F.
4lz4 hydrolase-hydrolase inhibitor-DNA x-ray (2.56 Å) X-ray structure of the complex between human thrombin and the tba deletion mutant lacking thymine 3 nucleobase; 3Dmol view …… (2013) "Dissecting the contribution of thrombin exosite I in the recognition of thrombin binding aptamer." Febs J., 280, 6581-6588. pubmed Pica, A., Russo Krauss, I., Merlino, A., Nagatoishi, S., Sugimoto, N., Sica, F.
4ni7 cytokine-DNA x-ray (2.4 Å) Crystal structure of human interleukin 6 in complex with a modified nucleotide aptamer (somamer sl1025); 3Dmol view …… (2014) "Crystal structure of interleukin-6 in complex with a modified nucleic Acid ligand." J.Biol.Chem., 289, 8720-8734. pubmed Gelinas, A.D., Davies, D.R., Edwards, T.E., Rohloff, J.C., Carter, J.D., Zhang, C., Gupta, S., Ishikawa, Y., Hirota, M., Nakaishi, Y., Jarvis, T.C., Janjic, N.
4ni9 cytokine-DNA x-ray (2.55 Å) Crystal structure of human interleukin 6 in complex with a modified nucleotide aptamer (somamer sl1025), form 2; 3Dmol view …… (2014) "Crystal structure of interleukin-6 in complex with a modified nucleic Acid ligand." J.Biol.Chem., 289, 8720-8734. pubmed Gelinas, A.D., Davies, D.R., Edwards, T.E., Rohloff, J.C., Carter, J.D., Zhang, C., Gupta, S., Ishikawa, Y., Hirota, M., Nakaishi, Y., Jarvis, T.C., Janjic, N.
4p1d DNA x-ray (1.55 Å) Structure of the complex of a bimolecular human telomeric DNA with coptisine; 3Dmol view …… Ferraroni, M., Bazzicalupi, C., Gratteri, P., Bilia, A.R., Sissi, C.
4q9q RNA x-ray (2.45 Å) Crystal structure of an RNA aptamer bound to bromo-ligand analog in complex with fab; 3Dmol view …… (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. pubmed Huang, H., Suslov, N.B., Li, N.S., Shelke, S.A., Evans, M.E., Koldobskaya, Y., Rice, P.A., Piccirilli, J.A.
4q9r RNA-immune system x-ray (3.12 Å) Crystal structure of an RNA aptamer bound to trifluoroethyl-ligand analog in complex with fab; 3Dmol view …… (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. pubmed Huang, H., Suslov, N.B., Li, N.S., Shelke, S.A., Evans, M.E., Koldobskaya, Y., Rice, P.A., Piccirilli, J.A.
4r44 DNA x-ray (2.69 Å) Racemic crystal structure of a tetramolecular DNA g-quadruplex; 3Dmol view …… (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. pubmed Mandal, P.K., Collie, G.W., Kauffmann, B., Huc, I.
4r45 DNA x-ray (1.9 Å) Racemic crystal structure of a bimolecular DNA g-quadruplex (p-1); 3Dmol view …… (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. pubmed Mandal, P.K., Collie, G.W., Kauffmann, B., Huc, I.
4r47 DNA x-ray (1.85 Å) Racemic crystal structure of a bimolecular DNA g-quadruplex (p21-n); 3Dmol view …… (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. pubmed Mandal, P.K., Collie, G.W., Kauffmann, B., Huc, I.
4rj1 RNA x-ray (0.92 Å) Structural variations and solvent structure of uggggu quadruplexes stabilized by sr2+ ions; 3Dmol view …… (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. pubmed Fyfe, A.C., Dunten, P.W., Martick, M.M., Scott, W.G.
4rkv RNA x-ray (0.88 Å) Structural variations and solvent structure of uggggu quadruplexes stabilized by sr2+ ions; 3Dmol view …… (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. pubmed Fyfe, A.C., Dunten, P.W., Martick, M.M., Scott, W.G.
4rne RNA x-ray (1.01 Å) Structural variations and solvent structure of uggggu quadruplexes stabilized by sr2+ ions; 3Dmol view …… (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. pubmed Fyfe, A.C., Dunten, P.W., Martick, M.M., Scott, W.G.
4ts0 RNA x-ray (2.8 Å) Crystal structure of the spinach RNA aptamer in complex with dfhbi, barium ions; 3Dmol view …… (2014) "Structural basis for activity of highly efficient RNA mimics of green fluorescent protein." Nat.Struct.Mol.Biol., 21, 658-663. pubmed Warner, K.D., Chen, M.C., Song, W., Strack, R.L., Thorn, A., Jaffrey, S.R., Ferre-D'Amare, A.R.
4ts2 RNA x-ray (2.88 Å) Crystal structure of the spinach RNA aptamer in complex with dfhbi, magnesium ions; 3Dmol view …… (2014) "Structural basis for activity of highly efficient RNA mimics of green fluorescent protein." Nat.Struct.Mol.Biol., 21, 658-663. pubmed Warner, K.D., Chen, M.C., Song, W., Strack, R.L., Thorn, A., Jaffrey, S.R., Ferre-D'Amare, A.R.
4u5m DNA x-ray (1.5 Å) Structure of a left-handed DNA g-quadruplex; 3Dmol view …… (2015) "Structure of a left-handed DNA G-quadruplex." Proc.Natl.Acad.Sci.USA, 112, 2729-2733. pubmed Chung, W.J., Heddi, B., Schmitt, E., Lim, K.W., Mechulam, Y., Phan, A.T.
4u92 DNA x-ray (1.5 Å) Crystal structure of a DNA-ba2+ g-quadruplex containing a water-mediated c-tetrad; 3Dmol view …… (2014) "Crystal structure of a DNA/Ba2+ G-quadruplex containing a water-mediated C-tetrad." Nucleic Acids Res., 42, 13422-13429. pubmed Zhang, D., Huang, T., Lukeman, P.S., Paukstelis, P.J.
4wb2 DNA-RNA hybrid x-ray (1.8 Å) Crystal structure of the mirror-image l-RNA-l-DNA aptamer nox-d20 in complex with mouse c5a complement anaphylatoxin; 3Dmol view …… (2015) "Structural basis for the targeting of complement anaphylatoxin C5a using a mixed L-RNA/L-DNA aptamer." Nat Commun, 6, 6481-6481. pubmed Yatime, L., Maasch, C., Hoehlig, K., Klussmann, S., Andersen, G.R., Vater, A.
4wb3 DNA-RNA hybrid x-ray (2.0 Å) Crystal structure of the mirror-image l-RNA-l-DNA aptamer nox-d20 in complex with mouse c5a-desarg complement anaphylatoxin; 3Dmol view …… (2015) "Structural basis for the targeting of complement anaphylatoxin C5a using a mixed L-RNA/L-DNA aptamer." Nat Commun, 6, 6481-6481. pubmed Yatime, L., Maasch, C., Hoehlig, K., Klussmann, S., Andersen, G.R., Vater, A.
4wo2 DNA x-ray (1.82 Å) Crystal structure of human native ckit proto-oncogene promoter quadruplex DNA; 3Dmol view …… WEI, D., PARKINSON, G.N., NEIDLE, S.
4wo3 DNA x-ray (2.73 Å) The second c-kit DNA quadruplex crystal structure; 3Dmol view …… WEI, D., NEIDLE, S.
4xk0 RNA x-ray (1.08 Å) Crystal structure of a tetramolecular RNA g-quadruplex in potassium; 3Dmol view …… (2015) "Insights into the mechanism of a G-quadruplex-unwinding DEAH-box helicase." Nucleic Acids Res., 43, 2223-2231. pubmed Chen, M.C., Murat, P., Abecassis, K., Ferre-D'Amare, A.R., Balasubramanian, S.
5bjo RNA x-ray (2.35 Å) Crystal structure of the corn RNA aptamer in complex with dfho, site-specific 5-iodo-u; 3Dmol view …… (2017) "A homodimer interface without base pairs in an RNA mimic of red fluorescent protein." Nat. Chem. Biol., 13, 1195-1201. pubmed Warner, K.D., Sjekloca, L., Song, W., Filonov, G.S., Jaffrey, S.R., Ferre-D'Amare, A.R.
5bjp RNA x-ray (2.51 Å) Crystal structure of the corn RNA aptamer in complex with dfho, iridium hexammine soak; 3Dmol view …… (2017) "A homodimer interface without base pairs in an RNA mimic of red fluorescent protein." Nat. Chem. Biol., 13, 1195-1201. pubmed Warner, K.D., Sjekloca, L., Song, W., Filonov, G.S., Jaffrey, S.R., Ferre-D'Amare, A.R.
5ccw drug-DNA x-ray (1.89 Å) Structure of the complex of a human telomeric DNA with au(caffein-2-ylidene)2; 3Dmol view …… (2016) "Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation." Angew.Chem.Int.Ed.Engl., 55, 4256-4259. pubmed Bazzicalupi, C., Ferraroni, M., Papi, F., Massai, L., Bertrand, B., Messori, L., Gratteri, P., Casini, A.
5cdb DNA x-ray (1.7 Å) Structure of the complex of a bimolecular human telomeric DNA with a 13-diphenylalkyl berberine derivative; 3Dmol view …… (2016) "Solution and Solid-State Analysis of Binding of 13-Substituted Berberine Analogues to Human Telomeric G-quadruplexes." Chem Asian J, 11, 1107-1115. pubmed Ferraroni, M., Bazzicalupi, C., Papi, F., Fiorillo, G., Guaman-Ortiz, L.M., Nocentini, A., Scovassi, A.I., Lombardi, P., Gratteri, P.
5cmx hydrolase x-ray (2.98 Å) X-ray structure of the complex between human alpha thrombin and a duplex-quadruplex 31-mer DNA aptamer; 3Dmol view …… (2016) "Different duplex/quadruplex junctions determine the properties of anti-thrombin aptamers with mixed folding." Nucleic Acids Res., 44, 983-991. pubmed Russo Krauss, I., Spiridonova, V., Pica, A., Napolitano, V., Sica, F.
5de5 RNA binding protein-RNA x-ray (3.0 Å) Crystal structure of the complex between human fmrp rgg motif and g-quadruplex RNA.; 3Dmol view …… (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. pubmed Vasilyev, N., Polonskaia, A., Darnell, J.C., Darnell, R.B., Patel, D.J., Serganov, A.
5de8 RNA binding protein-RNA x-ray (3.1 Å) Crystal structure of the complex between human fmrp rgg motif and g-quadruplex RNA, iridium hexammine bound form.; 3Dmol view …… (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. pubmed Vasilyev, N., Polonskaia, A., Darnell, J.C., Darnell, R.B., Patel, D.J., Serganov, A.
5dea RNA binding protein-RNA x-ray (2.8 Å) Crystal structure of the complex between human fmrp rgg motif and g-quadruplex RNA, cesium bound form.; 3Dmol view …… (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. pubmed Vasilyev, N., Polonskaia, A., Darnell, J.C., Darnell, R.B., Patel, D.J., Serganov, A.
5dww DNA x-ray (2.79 Å) Structural insights into the quadruplex-duplex 3' interface formed from a telomeric repeat - ttloop; 3Dmol view …… (2016) "Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target." J.Am.Chem.Soc., 138, 1226-1233. pubmed Russo Krauss, I., Ramaswamy, S., Neidle, S., Haider, S., Parkinson, G.N.
5dwx DNA x-ray (2.71 Å) Structural insights into the quadruplex-duplex 3' interface formed from a telomeric repeat - tloop; 3Dmol view …… (2016) "Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target." J.Am.Chem.Soc., 138, 1226-1233. pubmed Russo Krauss, I., Ramaswamy, S., Neidle, S., Haider, S., Parkinson, G.N.
5ew1 protein-DNA x-ray (2.95 Å) Human thrombin sandwiched between two DNA aptamers: hd22 and hd1-deltat3; 3Dmol view …… (2017) "Through-bond effects in the ternary complexes of thrombin sandwiched by two DNA aptamers." Nucleic Acids Res., 45, 461-469. pubmed Pica, A., Russo Krauss, I., Parente, V., Tateishi-Karimata, H., Nagatoishi, S., Tsumoto, K., Sugimoto, N., Sica, F.
5ew2 protein-DNA x-ray (3.59 Å) Human thrombin sandwiched between two DNA aptamers: hd22 and hd1-deltat12; 3Dmol view …… (2017) "Through-bond effects in the ternary complexes of thrombin sandwiched by two DNA aptamers." Nucleic Acids Res., 45, 461-469. pubmed Pica, A., Russo Krauss, I., Parente, V., Tateishi-Karimata, H., Nagatoishi, S., Tsumoto, K., Sugimoto, N., Sica, F.
5hix DNA x-ray (2.48 Å) Cocrystal structure of an anti-parallel DNA g-quadruplex and a tetra-quinoline foldamer; 3Dmol view …… (2016) "Multivalent Interactions between an Aromatic Helical Foldamer and a DNA G-Quadruplex in the Solid State." Chembiochem, 17, 1911-1914. pubmed Mandal, P.K., Baptiste, B., Langlois d'Estaintot, B., Kauffmann, B., Huc, I.
5i2v DNA nmr Nmr structure of a new g-quadruplex forming sequence within the kras proto-oncogene promoter region; 3Dmol view …… (2017) "High-resolution three-dimensional NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation." J. Biol. Chem., 292, 8082-8091. pubmed Kerkour, A., Marquevielle, J., Ivashchenko, S., Yatsunyk, L.A., Mergny, J.L., Salgado, G.F.
5j05 DNA nmr Diy g-quadruplexes: solution structure of d(gggtttgggttttgggaggg) in sodium; 3Dmol view …… (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007-eaat3007. pubmed Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.
5j4p DNA nmr Diy g-quadruplexes: solution structure of d(ggtttggttttggtttgg) in sodium; 3Dmol view …… (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007-eaat3007. pubmed Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.
5j4w DNA nmr Diy g-quadruplexes: solution structure of d(ggtttggttttggttgg) in sodium; 3Dmol view …… (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007-eaat3007. pubmed Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.
5j6u DNA nmr Diy g-quadruplexes: solution structure of d(ggggtttggggttttggggaagggg) in sodium; 3Dmol view …… (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007-eaat3007. pubmed Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.
5lig DNA nmr G-quadruplex formed at the 5'-end of nheiii_1 element in human c-myc promoter bound to triangulenium based fluorescence probe daota-m2; 3Dmol view …… (2016) "NMR Structure of a Triangulenium-Based Long-Lived Fluorescence Probe Bound to a G-Quadruplex." Angew.Chem.Int.Ed.Engl., 55, 12508-12511. pubmed Kotar, A., Wang, B., Shivalingam, A., Gonzalez-Garcia, J., Vilar, R., Plavec, J.
5lqg DNA nmr A two-quartet g-quadruplex formed by human telomere in kcl solution at neutral ph; 3Dmol view …… Wang, B., Galer, P., Sket, P., Plavec, J.
5lqh DNA nmr A two-quartet g-quadruplex formed by human telomere in kcl solution at ph 5.0; 3Dmol view …… Wang, B., Galer, P., Sket, P., Plavec, J.
5ls8 DNA x-ray (1.78 Å) Light-activated ruthenium complex bound to a DNA quadruplex; 3Dmol view …… McQuaid, K.T., Abell, H., Brazier, J., Cardin, C.J., Hall, J.P.
5m2l DNA nmr Structure of DNA tetrameric agcga-quadruplex adopted by 15-mer d(gcgagggagcgaggg), vk34, oligonucleotide found in regulatory region of the plekhg3 human gene; 3Dmol view …… (2017) "Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions." Nat Commun, 8, 15355-15355. pubmed Kocman, V., Plavec, J.
5mbr DNA nmr Quadruplex with flipped tetrad formed by a human telomeric sequence; 3Dmol view …… (2017) "Tracing Effects of Fluorine Substitutions on G-Quadruplex Conformational Changes." ACS Chem. Biol., 12, 1308-1315. pubmed Dickerhoff, J., Haase, L., Langel, W., Weisz, K.
5mcr DNA nmr Quadruplex with flipped tetrad formed by an artificial sequence; 3Dmol view …… (2017) "Tracing Effects of Fluorine Substitutions on G-Quadruplex Conformational Changes." ACS Chem. Biol., 12, 1308-1315. pubmed Dickerhoff, J., Haase, L., Langel, W., Weisz, K.
5mjx DNA nmr 2'f-ana-DNA chimeric tba quadruplex structure; 3Dmol view …… (2017) "Mapping the affinity landscape of Thrombin-binding aptamers on 2 F-ANA/DNA chimeric G-Quadruplex microarrays." Nucleic Acids Res., 45, 1619-1632. pubmed Lietard, J., Abou Assi, H., Gomez-Pinto, I., Gonzalez, C., Somoza, M.M., Damha, M.J.
5mta DNA nmr G-quadruplex formed within promoters of plasmodium falciparum b var genes; 3Dmol view …… Juribasic Kulcsar, M., Gabelica, V., Plavec, J.
5mtg DNA nmr G-quadruplex formed within promoters of plasmodium falciparum b var genes - form i; 3Dmol view …… Juribasic Kulcsar, M., Gabelica, V., Plavec, J.
5mvb DNA nmr Solution structure of a human g-quadruplex hybrid-2 form in complex with a gold-ligand.; 3Dmol view …… (2017) "Solution NMR Structure of a Ligand/Hybrid-2-G-Quadruplex Complex Reveals Rearrangements that Affect Ligand Binding." Angew. Chem. Int. Ed. Engl., 56, 7102-7106. pubmed Wirmer-Bartoschek, J., Bendel, L.E., Jonker, H.R.A., Grun, J.T., Papi, F., Bazzicalupi, C., Messori, L., Gratteri, P., Schwalbe, H.
5nys DNA nmr M2 g-quadruplex dilute solution; 3Dmol view …… (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. pubmed Trajkovski, M., Endoh, T., Tateishi-Karimata, H., Ohyama, T., Tanaka, S., Plavec, J., Sugimoto, N.
5nyt DNA nmr M2 g-quadruplex 20 wt% ethylene glycol; 3Dmol view …… (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. pubmed Trajkovski, M., Endoh, T., Tateishi-Karimata, H., Ohyama, T., Tanaka, S., Plavec, J., Sugimoto, N.
5nyu DNA nmr M2 g-quadruplex 10 wt% peg8000; 3Dmol view …… (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. pubmed Trajkovski, M., Endoh, T., Tateishi-Karimata, H., Ohyama, T., Tanaka, S., Plavec, J., Sugimoto, N.
5o4d DNA nmr G-quadruplex of human papillomavirus type 52; 3Dmol view …… (2019) "Towards Understanding of Polymorphism of the G-rich Region of Human Papillomavirus Type 52." Molecules, 24 pubmed Marusic, M., Plavec, J.
5ob3 RNA x-ray (2.0 Å) Ispinach aptamer; 3Dmol view …… (2017) "Crystal structure and fluorescence properties of the iSpinach aptamer in complex with DFHBI." RNA, 23, 1788-1795. pubmed Fernandez-Millan, P., Autour, A., Ennifar, E., Westhof, E., Ryckelynck, M.
5oph DNA nmr G-quadruplex structure of DNA oligonucleotide containing ggggcc repeats linked to als and ftd; 3Dmol view …… (2018) "NMR structure of a G-quadruplex formed by four d(G4C2) repeats: insights into structural polymorphism." Nucleic Acids Res., 46, 11605-11617. pubmed Brcic, J., Plavec, J.
5ov2 DNA nmr 2'f-ana-g modified quadruplex with a flipped tetrad; 3Dmol view …… (2017) "Nonconventional C-HF Hydrogen Bonds Support a Tetrad Flip in Modified G-Quadruplexes." J Phys Chem Lett, 8, 5148-5152. pubmed Dickerhoff, J., Weisz, K.
5ua3 DNA x-ray (1.88 Å) Crystal structure of a DNA g-quadruplex with a cytosine bulge; 3Dmol view …… (2018) "Structure and hydrodynamics of a DNA G-quadruplex with a cytosine bulge." Nucleic Acids Res., 46, 5319-5331. pubmed Meier, M., Moya-Torres, A., Krahn, N.J., McDougall, M.D., Orriss, G.L., McRae, E.K.S., Booy, E.P., McEleney, K., Patel, T.R., McKenna, S.A., Stetefeld, J.
5v3f RNA x-ray (1.7 Å) Co-crystal structure of the fluorogenic RNA mango; 3Dmol view …… (2017) "Structural basis for high-affinity fluorophore binding and activation by RNA Mango." Nat. Chem. Biol., 13, 807-813. pubmed Trachman, R.J., Demeshkina, N.A., Lau, M.W.L., Panchapakesan, S.S.S., Jeng, S.C.Y., Unrau, P.J., Ferre-D'Amare, A.R.
5vhe hydrolase x-ray (3.79 Å) Dhx36 in complex with the c-myc g-quadruplex; 3Dmol view …… (2018) "Structural basis of G-quadruplex unfolding by the DEAH/RHA helicase DHX36." Nature, 558, 465-469. pubmed Chen, M.C., Tippana, R., Demeshkina, N.A., Murat, P., Balasubramanian, S., Myong, S., Ferre-D'Amare, A.R.
5w77 DNA-inhibitor nmr Complex of DNA and compounds; 3Dmol view …… (2018) "Chemical and structural studies provide a mechanistic basis for recognition of the MYC G-quadruplex." Nat Commun, 9, 4229-4229. pubmed Calabrese, D.R., Chen, X., Leon, E.C., Gaikwad, S.M., Phyo, Z., Hewitt, W.M., Alden, S., Hilimire, T.A., He, F., Michalowski, A.M., Simmons, J.K., Saunders, L.B., Zhang, S., Connors, D., Walters, K.J., Mock, B.A., Schneekloth Jr., J.S.
5yey DNA nmr The structure of a chair-type g-quadruplex of the human telomeric variant in k+ solution; 3Dmol view …… (2019) "A chair-type G-quadruplex structure formed by a human telomeric variant DNA in K+solution." Chem Sci, 10, 218-226. pubmed Liu, C., Zhou, B., Geng, Y., Yan Tam, D., Feng, R., Miao, H., Xu, N., Shi, X., You, Y., Hong, Y., Tang, B.Z., Kwan Lo, P., Kuryavyi, V., Zhu, G.
5z80 DNA nmr Solution structure for the 1:1 complex of a platinum(ii)-based tripod bound to a hybrid-1 human telomeric g-quadruplex; 3Dmol view …… (2018) "Solution structures of multiple G-quadruplex complexes induced by a platinum(II)-based tripod reveal dynamic binding." Nat Commun, 9, 3496-3496. pubmed Liu, W., Zhong, Y.F., Liu, L.Y., Shen, C.T., Zeng, W., Wang, F., Yang, D., Mao, Z.W.
5z8f DNA nmr Solution structure for the unique dimeric 4:2 complex of a platinum(ii)-based tripod bound to a hybrid-1 human telomeric g-quadruplex; 3Dmol view …… (2018) "Solution structures of multiple G-quadruplex complexes induced by a platinum(II)-based tripod reveal dynamic binding." Nat Commun, 9, 3496-3496. pubmed Liu, W., Zhong, Y.F., Liu, L.Y., Shen, C.T., Zeng, W., Wang, F., Yang, D., Mao, Z.W.
5zev DNA nmr Solution structure of g-quadruplex formed in vegfr-2 proximal promoter sequence; 3Dmol view …… (2018) "A putative G-quadruplex structure in the proximal promoter ofVEGFR-2has implications for drug design to inhibit tumor angiogenesis." J. Biol. Chem., 293, 8947-8955. pubmed Liu, Y., Lan, W., Wang, C., Cao, C.
6a7y DNA nmr Solution structure of an intermolecular leaped v-shape g-quadruplex; 3Dmol view …… (2018) "NMR solution structure of an asymmetric intermolecular leaped V-shape G-quadruplex: selective recognition of the d(G2NG3NG4) sequence motif by a short linear G-rich DNA probe." Nucleic Acids Res. pubmed Wan, C., Fu, W., Jing, H., Zhang, N.
6a85 DNA x-ray (1.45 Å) Crystal structure of a novel DNA quadruplex; 3Dmol view …… (2018) "High-resolution DNA quadruplex structure containing all the A-, G-, C-, T-tetrads." Nucleic Acids Res., 46, 11627-11638. pubmed Liu, H.H., Wang, R., Yu, X., Shen, F.S., Lan, W.X., Haruehanroengra, P., Yao, Q.Q., Zhang, J., Chen, Y.Q., Li, S.H., Wu, B.X., Zheng, L.N., Ma, J.B., Lin, J.Z., Cao, C.Y., Li, J.X., Sheng, J., Gan, J.H.
6ac7 DNA nmr Structure of a g-quadruplex; 3Dmol view …… (2018) "Structure of a (3+1) hybrid G-quadruplex in the PARP1 promoter." Nucleic Acids Res. pubmed Sengar, A., Vandana, J.J., Chambers, V.S., Di Antonio, M., Winnerdy, F.R., Balasubramanian, S., Phan, A.T.
6au4 DNA x-ray (2.35 Å) Crystal structure of the major quadruplex formed in the human c-myc promoter; 3Dmol view …… (2018) "Crystal structure of the major quadruplex formed in the promoter region of the human c-MYC oncogene." PLoS ONE, 13, e0205584-e0205584. pubmed Stump, S., Mou, T.C., Sprang, S.R., Natale, N.R., Beall, H.D.
6b14 immune system-RNA x-ray (1.64 Å) Crystal structure of spinach RNA aptamer in complex with fab bl3-6s97n; 3Dmol view …… (2018) "Affinity maturation of a portable Fab-RNA module for chaperone-assisted RNA crystallography." Nucleic Acids Res., 46, 2624-2635. pubmed Koirala, D., Shelke, S.A., Dupont, M., Ruiz, S., DasGupta, S., Bailey, L.J., Benner, S.A., Piccirilli, J.A.
6b3k immune system-RNA x-ray (2.09 Å) Crystal structure of mutant spinach RNA aptamer in complex with fab bl3-6; 3Dmol view …… (2018) "Affinity maturation of a portable Fab-RNA module for chaperone-assisted RNA crystallography." Nucleic Acids Res., 46, 2624-2635. pubmed Koirala, D., Shelke, S.A., Dupont, M., Ruiz, S., DasGupta, S., Bailey, L.J., Benner, S.A., Piccirilli, J.A.
6c63 RNA x-ray (2.9 Å) Crystal structure of the mango-ii fluorescent aptamer bound to to1-biotin; 3Dmol view …… (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. pubmed Trachman 3rd., R.J., Abdolahzadeh, A., Andreoni, A., Cojocaru, R., Knutson, J.R., Ryckelynck, M., Unrau, P.J., Ferre-D'Amare, A.R.
6c64 RNA x-ray (3.0 Å) Crystal structure of the mango-ii fluorescent aptamer bound to to3-biotin; 3Dmol view …… (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. pubmed Trachman 3rd., R.J., Abdolahzadeh, A., Andreoni, A., Cojocaru, R., Knutson, J.R., Ryckelynck, M., Unrau, P.J., Ferre-D'Amare, A.R.
6c65 RNA x-ray (2.8 Å) Crystal structure of the mango-ii-a22u fluorescent aptamer bound to to1-biotin; 3Dmol view …… (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. pubmed Trachman 3rd., R.J., Abdolahzadeh, A., Andreoni, A., Cojocaru, R., Knutson, J.R., Ryckelynck, M., Unrau, P.J., Ferre-D'Amare, A.R.
6ccw DNA nmr Hybrid-2 form human telomeric g quadruplex in complex with epiberberine; 3Dmol view …… (2018) "Molecular Recognition of the Hybrid-2 Human Telomeric G-Quadruplex by Epiberberine: Insights into Conversion of Telomeric G-Quadruplex Structures." Angew. Chem. Int. Ed. Engl., 57, 10888-10893. pubmed Lin, C., Wu, G., Wang, K., Onel, B., Sakai, S., Shao, Y., Yang, D.
6e8s RNA x-ray (2.35 Å) Structure of the mango-iii aptamer bound to to1-biotin; 3Dmol view …… (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. pubmed Trachman 3rd., R.J., Autour, A., Jeng, S.C.Y., Abdolahzadeh, A., Andreoni, A., Cojocaru, R., Garipov, R., Dolgosheina, E.V., Knutson, J.R., Ryckelynck, M., Unrau, P.J., Ferre-D'Amare, A.R.
6e8t RNA x-ray (2.9 Å) Structure of the mango-iii (a10u) aptamer bound to to1-biotin; 3Dmol view …… (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. pubmed Trachman 3rd., R.J., Autour, A., Jeng, S.C.Y., Abdolahzadeh, A., Andreoni, A., Cojocaru, R., Garipov, R., Dolgosheina, E.V., Knutson, J.R., Ryckelynck, M., Unrau, P.J., Ferre-D'Amare, A.R.
6e8u RNA x-ray (1.55 Å) Structure of the mango-iii (a10u) aptamer bound to to1-biotin; 3Dmol view …… (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. pubmed Trachman 3rd., R.J., Autour, A., Jeng, S.C.Y., Abdolahzadeh, A., Andreoni, A., Cojocaru, R., Garipov, R., Dolgosheina, E.V., Knutson, J.R., Ryckelynck, M., Unrau, P.J., Ferre-D'Amare, A.R.
6eo6 hydrolase-DNA x-ray (1.69 Å) X-ray structure of the complex between human alpha-thrombin and modified 15-mer DNA aptamer containing 5-(3-(2-(1h-indol-3-yl)acetamide-n-yl)-1-propen-1-yl)-2'-deoxyuridine residue; 3Dmol view …… (2018) "Crystal structures of thrombin in complex with chemically modified thrombin DNA aptamers reveal the origins of enhanced affinity." Nucleic Acids Res., 46, 4819-4830. pubmed Dolot, R., Lam, C.H., Sierant, M., Zhao, Q., Liu, F.W., Nawrot, B., Egli, M., Yang, X.
6eo7 hydrolase-DNA x-ray (2.24 Å) X-ray structure of the complex between human alpha-thrombin and modified 15-mer DNA aptamer containing 5-(3-(acetamide-n-yl)-1-propen-1-yl)-2'-deoxyuridine residue; 3Dmol view …… (2018) "Crystal structures of thrombin in complex with chemically modified thrombin DNA aptamers reveal the origins of enhanced affinity." Nucleic Acids Res., 46, 4819-4830. pubmed Dolot, R., Lam, C.H., Sierant, M., Zhao, Q., Liu, F.W., Nawrot, B., Egli, M., Yang, X.
6erl DNA nmr Quadruplex with flipped tetrad formed by the c-myc promoter sequence; 3Dmol view …… (2018) "Loop Length Affects Syn-Anti Conformational Rearrangements in Parallel G-Quadruplexes." Chemistry pubmed Karg, B., Weisz, K.
6evv hydrolase x-ray (2.5 Å) X-ray structure of the complex between human alpha thrombin and nu172, a duplex-quadruplex 26-mer DNA aptamer, in the presence of potassium ions.; 3Dmol view …… (2018) "Several structural motifs cooperate in determining the highly effective anti-thrombin activity of NU172 aptamer." Nucleic Acids Res., 46, 12177-12185. pubmed Troisi, R., Napolitano, V., Spiridonova, V., Russo Krauss, I., Sica, F.
6f4z DNA nmr 2'f-arag modified quadruplex with flipped g-tract and central tetrad; 3Dmol view …… (2018) "Fluorine-Mediated Editing of a G-Quadruplex Folding Pathway." Chembiochem, 19, 927-930. pubmed Dickerhoff, J., Weisz, K.
6fc9 DNA nmr The 1,8-bis(aminomethyl)anthracene and quadruplex-duplex junction complex; 3Dmol view …… Santana, A., Serrano, I., Montalvillo-Jimenez, L., Corzana, F., Bastida, A., Jimenez-Barbero, J., Gonzalez, C., Asensio, J.L.
6ffr DNA-RNA hybrid nmr DNA-RNA hybrid quadruplex with flipped tetrad; 3Dmol view …… (2018) "DNA-RNA Hybrid Quadruplexes Reveal Interactions that Favor RNA Parallel Topologies." Chemistry, 24, 15365-15371. pubmed Haase, L., Dickerhoff, J., Weisz, K.
6fq2 DNA x-ray (2.31 Å) Structure of minimal sequence for left -handed g-quadruplex formation; 3Dmol view …… (2019) "A Minimal Sequence for Left-Handed G-Quadruplex Formation." Angew. Chem. Int. Ed. Engl., 58, 2331-2335. pubmed Bakalar, B., Heddi, B., Schmitt, E., Mechulam, Y., Phan, A.T.
6ftu DNA x-ray (2.95 Å) Structure of a quadruplex forming sequence from d. discoideum; 3Dmol view …… (2018) "Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome." Nucleic Acids Res., 46, 5297-5307. pubmed Guedin, A., Lin, L.Y., Armane, S., Lacroix, L., Mergny, J.L., Thore, S., Yatsunyk, L.A.
6ge1 RNA nmr Solution structure of the r(ugguggu)4 RNA quadruplex; 3Dmol view …… (2019) "Unraveling the structural basis for the exceptional stability of RNA G-quadruplexes capped by a uridine tetrad at the 3' terminus." RNA, 25, 121-134. pubmed Andralojc, W., Malgowska, M., Sarzynska, J., Pasternak, K., Szpotkowski, K., Kierzek, R., Gdaniec, Z.
6gh0 DNA nmr Two-quartet kit* g-quadruplex is formed via double-stranded pre-folded structure; 3Dmol view …… (2019) "Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure." Nucleic Acids Res., 47, 2641-2653. pubmed Kotar, A., Rigo, R., Sissi, C., Plavec, J.
6gn7 hydrolase x-ray (2.8 Å) X-ray structure of the complex between human alpha thrombin and nu172, a duplex-quadruplex 26-mer DNA aptamer, in the presence of sodium ions.; 3Dmol view …… (2018) "Several structural motifs cooperate in determining the highly effective anti-thrombin activity of NU172 aptamer." Nucleic Acids Res., 46, 12177-12185. pubmed Troisi, R., Napolitano, V., Spiridonova, V., Russo Krauss, I., Sica, F.
6gz6 DNA x-ray (2.01 Å) Structure of a left-handed g-quadruplex; 3Dmol view …… (2019) "A Minimal Sequence for Left-Handed G-Quadruplex Formation." Angew.Chem.Int.Ed.Engl., 58, 2331-2335. pubmed Bakalar, B., Heddi, B., Schmitt, E., Mechulam, Y., Phan, A.T.
6gzn DNA nmr Adenine-driven structural switch from two- to three-quartet DNA g-quadruplex; 3Dmol view …… (2018) "Adenine-Driven Structural Switch from a Two- to Three-Quartet DNA G-Quadruplex." Angew. Chem. Int. Ed. Engl., 57, 15395-15399. pubmed Lenarcic Zivkovic, M., Rozman, J., Plavec, J.
6h1k DNA nmr The major g-quadruplex form of hiv-1 ltr; 3Dmol view …… (2018) "Major G-Quadruplex Form of HIV-1 LTR Reveals a (3 + 1) Folding Topology Containing a Stem-Loop." J. Am. Chem. Soc., 140, 13654-13662. pubmed Butovskaya, E., Heddi, B., Bakalar, B., Richter, S.N., Phan, A.T.
6h5r DNA x-ray (2.0 Å) Structure of the complex of a human telomeric DNA with bis(1-butyl-3-methyl-imidazole-2-ylidene) gold(i); 3Dmol view …… (2018) "Interaction of a gold(i) dicarbene anticancer drug with human telomeric DNA G-quadruplex: solution and computationally aided X-ray diffraction analysis." Dalton Trans, 47, 16132-16138. pubmed Guarra, F., Marzo, T., Ferraroni, M., Papi, F., Bazzicalupi, C., Gratteri, P., Pescitelli, G., Messori, L., Biver, T., Gabbiani, C.
6ia0 DNA nmr Human telomeric g-quadruplex with 8-oxo-g substitution in the central g-quartet; 3Dmol view …… (2019) "Impact of Oxidative Lesions on the Human Telomeric G-Quadruplex." J. Am. Chem. Soc., 141, 2594-2603. pubmed Bielskute, S., Plavec, J., Podbevsek, P.
6ia4 DNA nmr Human telomeric g-quadruplex with 8-oxo-g substitution in the outer g-quartet; 3Dmol view …… (2019) "Impact of Oxidative Lesions on the Human Telomeric G-Quadruplex." J. Am. Chem. Soc., 141, 2594-2603. pubmed Bielskute, S., Plavec, J., Podbevsek, P.
6jkn DNA x-ray (1.4 Å) Crystal structure of g-quadruplex formed by bromo-substituted human telomeric DNA; 3Dmol view …… (2019) "The crystal structure of an antiparallel chair-type G-quadruplex formed by Bromo-substituted human telomeric DNA." Nucleic Acids Res. pubmed Geng, Y., Liu, C., Zhou, B., Cai, Q., Miao, H., Shi, X., Xu, N., You, Y., Fung, C.P., Din, R.U., Zhu, G.
6neb DNA nmr Myc promoter g-quadruplex with 1:6:1 loop length; 3Dmol view …… Dickerhoff, J., Onel, B., Chen, L., Chen, Y., Yang, D.
pdb_id category method annotation reference authors