pdb id class method authors reference annotation
139d DNA NMR Wang Y, Patel DJ (1993) "Solution structure of a parallel-stranded G-quadruplex DNA." J.Mol.Biol., 234, 1171-1183. doi: 10.1006/jmbi.1993.1668. Solution structure of a parallel-stranded g-quadruplex DNA. 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
143d DNA NMR Wang Y, Patel DJ (1993) "Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex." Structure, 1, 263-282. doi: 10.1016/0969-2126(93)90015-9. Solution structure of the human telomeric repeat d(ag3[t2ag3]3) of the g-quadruplex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-LwD+Ln), basket(2+2), UDDU
148d DNA NMR Schultze P, Macaya RF, Feigon J (1994) "Three-dimensional solution structure of the thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG)." J.Mol.Biol., 235, 1532-1547. doi: 10.1006/jmbi.1994.1105. Three-dimensional solution structure of the thrombin binding DNA aptamer d(ggttggtgtggttgg). 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
156d DNA NMR Schultze P, Smith FW, Feigon J (1994) "Refined solution structure of the dimeric quadruplex formed from the Oxytricha telomeric oligonucleotide d(GGGGTTTTGGGG)." Structure, 2, 221-233. doi: 10.1016/S0969-2126(00)00023-X. Refined solution structure of the dimeric quadruplex formed from the oxytricha telomeric oligonucleotide d(ggggttttgggg). 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
186d DNA NMR Wang Y, Patel DJ (1994) "Solution structure of the Tetrahymena telomeric repeat d(T2G4)4 G-tetraplex." Structure, 2, 1141-1156. doi: 10.1016/S0969-2126(94)00117-0. Solution structure of the tetrahymena telomeric repeat d(t2g4)4 g-tetraplex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU
1a6h DNA NMR Kettani A, Kumar RA, Patel DJ (1995) "Solution structure of a DNA quadruplex containing the fragile X syndrome triplet repeat." J.Mol.Biol., 254, 638-656. doi: 10.1006/jmbi.1995.0644. DNA quadruplex containing gcgc tetrad, NMR, 4 structures. 2 G-tetrads
1a8n DNA NMR Kettani A, Bouaziz S, Gorin A, Zhao H, Jones RA, Patel DJ (1998) "Solution structure of a Na cation stabilized DNA quadruplex containing G.G.G.G and G.C.G.C tetrads formed by G-G-G-C repeats observed in adeno-associated viral DNA." J.Mol.Biol., 282, 619-636. doi: 10.1006/jmbi.1998.2030. Solution structure of a na+ cation stabilized DNA quadruplex containing g.g.g.g and g.c.g.c tetrads formed by g-g-g-c repeats observed in aav and human chromosome 19, NMR, 8 structures. 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD
1a8w DNA NMR Bouaziz S, Kettani A, Patel DJ (1998) "A K cation-induced conformational switch within a loop spanning segment of a DNA quadruplex containing G-G-G-C repeats." J.Mol.Biol., 282, 637-652. doi: 10.1006/jmbi.1998.2031. A k+ cation-induced conformational switch within a loop spanning segment of a DNA quadruplex containing g-g-g-c repeats, NMR, 8 structures. 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD
1aff DNA NMR Kettani A, Bouaziz S, Wang W, Jones RA, Patel DJ (1997) "Bombyx mori single repeat telomeric DNA sequence forms a G-quadruplex capped by base triads." Nat.Struct.Biol., 4, 382-389. doi: 10.1038/nsb0597-382. DNA quadruplex containing gggg tetrads and (t.a).a triads, NMR, 8 structures. 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UUDD
1bub DNA NMR Beger RD, Marathias VM, Volkman BF, Bolton PH (1998) "Determination of internuclear angles of DNA using paramagnetic-assisted magnetic alignment." J.Magn.Reson., 135, 256-259. doi: 10.1006/jmre.1998.1527. Determination of internuclear angles of DNA using paramagnetic assisted magnetic alignment. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
1c32 DNA NMR Marathias VM, Bolton PH (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. doi: 10.1093/nar/28.9.1969. Solution structure of a quadruplex forming DNA and its intermidiate. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-Lx-Lw-Ln), (2+2), UDUD
1c34 DNA NMR Marathias VM, Bolton PH (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. doi: 10.1093/nar/28.9.1969. Solution structure of a quadruplex forming DNA and its intermidiate. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
1c35 DNA NMR Marathias VM, Bolton PH (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. doi: 10.1093/nar/28.9.1969. Solution structure of a quadruplex forming DNA and its intermidiate. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
1c38 DNA NMR Marathias VM, Bolton PH (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. doi: 10.1093/nar/28.9.1969. Solution structure of a quadruplex forming DNA and its intermediate. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
1d59 DNA X-ray (2.3 Å) Kang C, Zhang X, Ratliff R, Moyzis R, Rich A (1992) "Crystal structure of four-stranded Oxytricha telomeric DNA." Nature, 356, 126-131. doi: 10.1038/356126a0. Crystal structure of 4-stranded oxytricha telomeric DNA. 8 G-tetrads, 2 G4 helices, 2 G4 stems, (2+2), UDUD
1d6d DNA NMR Kuryavyi V, Kettani A, Wang W, Jones R, Patel DJ (2000) "A diamond-shaped zipper-like DNA architecture containing triads sandwiched between mismatches and tetrads." J.Mol.Biol., 295, 455-469. doi: 10.1006/jmbi.1999.3345. Solution DNA structure containing (a-a)-t triads interdigitated between a-t base pairs and gggg tetrads; NMR, 8 struct.. 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UUDD
1eeg DNA NMR Kettani A, Gorin A, Majumdar A, Hermann T, Skripkin E, Zhao H, Jones R, Patel DJ (2000) "A dimeric DNA interface stabilized by stacked A.(G.G.G.G).A hexads and coordinated monovalent cations." J.Mol.Biol., 297, 627-644. doi: 10.1006/jmbi.2000.3524. A(gggg)a hexad pairing aligment for the d(g-g-a-g-g-a-g) sequence. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5'
1emq DNA NMR Patel PK, Hosur RV (1999) "NMR observation of T-tetrads in a parallel stranded DNA quadruplex formed by Saccharomyces cerevisiae telomere repeats." Nucleic Acids Res., 27, 2457-2464. doi: 10.1093/nar/27.12.2457. NMR observation of t-tetrads in a parallel stranded DNA quadruplex formed by saccharomyces cerevisiae telomere repeats. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/5'
1evm DNA NMR Patel PK, Koti AS, Hosur RV (1999) "NMR studies on truncated sequences of human telomeric DNA: observation of a novel A-tetrad." Nucleic Acids Res., 27, 3836-3843. doi: 10.1093/nar/27.19.3836. NMR observation of a-tetrad. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
1evn DNA NMR Patel PK, Koti AS, Hosur RV (1999) "NMR studies on truncated sequences of human telomeric DNA: observation of a novel A-tetrad." Nucleic Acids Res., 27, 3836-3843. doi: 10.1093/nar/27.19.3836. NMR observation of a-tetrad. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
1evo DNA NMR Patel PK, Bhavesh NS, Hosur RV (2000) "NMR observation of a novel C-tetrad in the structure of the SV40 repeat sequence GGGCGG." Biochem.Biophys.Res.Commun., 270, 967-971. doi: 10.1006/bbrc.2000.2479. NMR observation of a novel c-tetrad. 5 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/5'
1f3s DNA NMR Kettani A, Basu G, Gorin A, Majumdar A, Skripkin E, Patel DJ (2000) "A two-stranded template-based approach to G.(C-A) triad formation: designing novel structural elements into an existing DNA framework." J.Mol.Biol., 301, 129-146. doi: 10.1006/jmbi.2000.3932. Solution structure of DNA sequence gggttcagg forms gggg tetrade and g(c-a) triad.. 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD
1fqp DNA NMR Keniry MA, Strahan GD, Owen EA, Shafer RH (1995) "Solution structure of the Na+ form of the dimeric guanine quadruplex [d(G3T4G3)]2." Eur.J.Biochem., 233, 631-643. doi: 10.1111/j.1432-1033.1995.631_2.x. Intramolecular quadruplex DNA with three gggg repeats, NMR, ph 6.7, 0.1 m na+ and 4 mm (strand concentration), 5 structures. 3 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1hao hydrolase-hydrolase inhibitor-DNA X-ray (2.8 Å) Padmanabhan K, Tulinsky A (1996) "An ambiguous structure of a DNA 15-mer thrombin complex." Acta Crystallogr.,Sect.D, 52, 272-282. doi: 10.1107/S0907444995013977. Complex of human alpha-thrombin with a 15mer oligonucleotide ggttggtgtggttgg (based on NMR model of DNA). 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
1hap hydrolase-hydrolase inhibitor-DNA X-ray (2.8 Å) Padmanabhan K, Tulinsky A (1996) "An ambiguous structure of a DNA 15-mer thrombin complex." Acta Crystallogr.,Sect.D, 52, 272-282. doi: 10.1107/S0907444995013977. Complex of human alpha-thrombin with a 15mer oligonucleotide ggttggtgtggttgg (based on x-ray model of DNA). 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-Lw-Ln-Lw), chair(2+2), UDUD
1hut hydrolase-hydrolase inhibitor-DNA X-ray (2.9 Å) Padmanabhan K, Padmanabhan KP, Ferrara JD, Sadler JE, Tulinsky A (1993) "The structure of alpha-thrombin inhibited by a 15-mer single-stranded DNA aptamer." J.Biol.Chem., 268, 17651-17654. The structure of alpha-thrombin inhibited by a 15-mer single-stranded DNA aptamer. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-Lw-Ln-Lw), chair(2+2), UDUD
1i34 DNA NMR Kuryavyi V, Majumdar A, Shallop A, Chernichenko N, Skripkin E, Jones R, Patel DJ (2001) "A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple." J.Mol.Biol., 310, 181-194. doi: 10.1006/jmbi.2001.4759. Solution DNA quadruplex with double chain reversal loop and two diagonal loops connecting gggg tetrads flanked by g-(t-t) triad and t-t-t triple. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(D+PD), (2+2), UDDU
1j6s RNA X-ray (1.4 Å) Pan B, Xiong Y, Shi K, Deng J, Sundaralingam M (2003) "Crystal structure of an RNA purine-rich tetraplex containing adenine tetrads: implications for specific binding in RNA tetraplexes." Structure, 11, 815-823. doi: 10.1016/S0969-2126(03)00107-2. Crystal structure of an RNA tetraplex (ugaggu)4 with a-tetrads, g-tetrads, u-tetrads and g-u octads. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
1j8g RNA X-ray (0.61 Å) Deng J, Xiong Y, Sundaralingam M (2001) "X-ray analysis of an RNA tetraplex (UGGGGU)(4) with divalent Sr(2+) ions at subatomic resolution (0.61 A)." Proc.Natl.Acad.Sci.USA, 98, 13665-13670. doi: 10.1073/pnas.241374798. X-ray analysis of a RNA tetraplex r(uggggu)4 at ultra-high resolution. 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
1jb7 DNA-binding protein-DNA X-ray (1.86 Å) Horvath MP, Schultz SC (2001) "DNA G-quartets in a 1.86 A resolution structure of an Oxytricha nova telomeric protein-DNA complex." J.Mol.Biol., 310, 367-377. doi: 10.1006/jmbi.2001.4766. DNA g-quartets in a 1.86 Å resolution structure of an oxytricha nova telomeric protein-DNA complex. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1jjp DNA NMR Zhang N, Gorin A, Majumdar A, Kettani A, Chernichenko N, Skripkin E, Patel DJ (2001) "V-shaped scaffold: a new architectural motif identified in an A x (G x G x G x G) pentad-containing dimeric DNA quadruplex involving stacked G(anti) x G(anti) x G(anti) x G(syn) tetrads." J.Mol.Biol., 311, 1063-1079. doi: 10.1006/jmbi.2001.4916. A(gggg) pentad-containing dimeric DNA quadruplex involving stacked g(anti)g(anti)g(anti)g(syn) tetrads. 4 G-tetrads, 1 G4 helix
1jpq DNA X-ray (1.6 Å) Haider S, Parkinson GN, Neidle S (2002) "Crystal structure of the potassium form of an Oxytricha nova G-quadruplex." J.Mol.Biol., 320, 189-200. doi: 10.1016/S0022-2836(02)00428-X. Crystal structure of the oxytricha telomeric DNA at 1.6a. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1jrn DNA X-ray (2.0 Å) Haider S, Parkinson GN, Neidle S (2002) "Crystal structure of the potassium form of an Oxytricha nova G-quadruplex." J.Mol.Biol., 320, 189-200. doi: 10.1016/S0022-2836(02)00428-X. Orthorhombic form of oxytricha telomeric DNA at 2.0a. 8 G-tetrads, 2 G4 helices, 2 G4 stems, (2+2), UDDU
1jvc DNA NMR Zhang N, Gorin A, Majumdar A, Kettani A, Chernichenko N, Skripkin E, Patel DJ (2001) "Dimeric DNA quadruplex containing major groove-aligned A-T-A-T and G-C-G-C tetrads stabilized by inter-subunit Watson-Crick A-T and G-C pairs." J.Mol.Biol., 312, 1073-1088. doi: 10.1006/jmbi.2001.5002. Dimeric DNA quadruplex containing major groove-aligned a.t.a.t and g.c.g.c tetrads stabilized by inter-subunit watson-crick a:t and g:c pairs. 1 G-tetrad
1k4x DNA NMR Schultze P, Hud NV, Smith FW, Feigon J (1999) "The effect of sodium, potassium and ammonium ions on the conformation of the dimeric quadruplex formed by the Oxytricha nova telomere repeat oligonucleotide d(G(4)T(4)G(4))." Nucleic Acids Res., 27, 3018-3028. doi: 10.1093/nar/27.15.3018. Potassium form of oxy-1.5 quadruplex DNA. 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1k8p DNA X-ray (2.4 Å) Parkinson GN, Lee MP, Neidle S (2002) "Crystal structure of parallel quadruplexes from human telomeric DNA." Nature, 417, 876-880. doi: 10.1038/nature755. Structure of the human g-quadruplex reveals a novel topology. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
1kf1 DNA X-ray (2.1 Å) Parkinson GN, Lee MP, Neidle S (2002) "Crystal structure of parallel quadruplexes from human telomeric DNA." Nature, 417, 876-880. doi: 10.1038/nature755. Structure and packing of human telomeric DNA. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
1l1h DNA X-ray (1.75 Å) Haider SM, Parkinson GN, Neidle S (2003) "Structure of a G-quadruplex-Ligand Complex." J.Mol.Biol., 326, 117-125. doi: 10.1016/S0022-2836(02)01354-2. Crystal structure of the quadruplex DNA-drug complex. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1lvs DNA NMR Crnugelj M, Hud NV, Plavec J (2002) "The solution structure of d(G(4)T(4)G(3))(2): a bimolecular G-quadruplex with a novel fold." J.Mol.Biol., 320, 911-924. doi: 10.1016/S0022-2836(02)00569-7. The solution structure of d(g4t4g3)2. 3 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1mdg RNA X-ray (1.5 Å) Pan BC, Xiong Y, Shi K, Sundaralingam M (2003) "An Eight-Stranded Helical Fragment in RNA Crystal Structure: Implications for Tetraplex Interaction." Structure, 11, 825-831. doi: 10.1016/S0969-2126(03)00108-4. An alternating antiparallel octaplex in an RNA crystal structure. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
1my9 RNA NMR Liu H, Matsugami A, Katahira M, Uesugi S (2002) "A Dimeric RNA Quadruplex Architecture Comprised of Two G:G(:A):G:G(:A) Hexads, G:G:G:G Tetrads and UUUU Loops." J.Mol.Biol., 322, 955-970. doi: 10.1016/S0022-2836(02)00876-8. Solution structure of a k+ cation stabilized dimeric RNA quadruplex containing two g:g(:a):g:g(:a) hexads, g:g:g:g tetrads and uuuu loops. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
1myq DNA NMR Matsugami A, Ouhashi K, Kanagawa M, Liu H, Kanagawa S, Uesugi S, Katahira M (2001) "An intramolecular quadruplex of (GGA)(4) triplet repeat DNA with a G:G:G:G tetrad and a G(:A):G(:A):G(:A):G heptad, and its dimeric interaction." J.Mol.Biol., 313, 255-269. doi: 10.1006/jmbi.2001.5047. An intramolecular quadruplex of (gga)(4) triplet repeat DNA with a g:g:g:g tetrad and a g(:a):g(:a):g(:a):g heptad, and its dimeric interaction. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
1n7a DNA, RNA X-ray (1.2 Å) Ravelli RBG, Leiros H-KS, Pan B, Caffrey M, McSweeney S (2003) "Specific Radiation-Damage Can Be Used To Solve Macromolecular Crystal Structures." Structure, 11, 217-224. doi: 10.1016/S0969-2126(03)00006-6. Rip-radiation-damage induced phasing. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED
1n7b DNA, RNA X-ray (1.4 Å) Ravelli RBG, Leiros H-KS, Pan B, Caffrey M, McSweeney S (2003) "Specific Radiation-Damage Can Be Used To Solve Macromolecular Crystal Structures." Structure, 11, 217-224. doi: 10.1016/S0969-2126(03)00006-6. Rip-radiation-damage induced phasing. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED
1np9 DNA NMR Gavathiotis E, Searle MS (2003) "Structure of the parallel-stranded DNA quadruplex d(TTAGGGT)4 containing the human telomeric repeat: evidence for A-tetrad formation from NMR and molecular dynamics simulations." ORG.BIOMOL.CHEM., 1, 1650-1656. doi: 10.1039/b300845m. Structure of the parallel-stranded DNA quadruplex d(ttaggga)4 containing the human telomeric repeat. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
1nyd DNA NMR Webba da Silva M (2003) "Association of DNA quadruplexes through G:C:G:C tetrads. Solution structure of d(GCGGTGGAT)." Biochemistry, 42, 14356-14365. doi: 10.1021/bi0355185. Solution structure of DNA quadruplex gcggtggat. 4 G-tetrads, 2 G4 helices, 2 G4 stems, parallel(4+0), UUUU
1nzm DNA NMR Gavathiotis E, Heald RA, Stevens MFG, Searle MS (2003) "Drug Recognition and Stabilisation of the Parallel-stranded DNA Quadruplex d(TTAGGGT)4 Containing the Human Telomeric Repeat." J.Mol.Biol., 334, 25-36. doi: 10.1016/j.jmb.2003.09.018. NMR structure of the parallel-stranded DNA quadruplex d(ttagggt)4 complexed with the telomerase inhibitor rhps4. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
1o0k DNA X-ray (1.17 Å) Clark GR, Pytel PD, Squire CJ, Neidle S (2003) "Structure of the First Parallel DNA Quadruplex-drug Complex." J.Am.Chem.Soc., 125, 4066-4067. doi: 10.1021/ja0297988. Structure of the first parallel DNA quadruplex-drug complex. 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
1oz8 DNA NMR Matsugami A, Okuizumi T, Uesugi S, Katahira M (2003) "Intramolecular Higher Order Packing of Parallel Quadruplexes Comprising a G:G:G:G Tetrad and a G(:A):G(:A):G(:A):G Heptad of GGA Triplet Repeat DNA." J.BIOL.CHEM., 278, 28147-28153. doi: 10.1074/jbc.M303694200. Intramolecular higher-order packing of parallel quadruplexes comprising a g:g:g:g tetrad and a g(:a):g(:a):g(:a):g heptad of gga triplet repeat DNA. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
1pa6 DNA binding protein-DNA X-ray (2.45 Å) Theobald DL, Schultz SC (2003) "Nucleotide shuffling and ssDNA recognition in Oxytricha nova telomere end-binding protein complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgagg. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1ph1 DNA binding protein-DNA X-ray (2.51 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and Ssdna Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttggggt. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1ph2 DNA binding protein-DNA X-ray (3.1 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttg. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1ph3 DNA binding protein-DNA X-ray (2.3 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttggtg. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1ph4 DNA binding protein-DNA X-ray (2.3 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttggcg. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1ph5 DNA binding protein-DNA X-ray (2.3 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttg(3dr)gg. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1ph6 DNA binding protein-DNA X-ray (2.1 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgtgg. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1ph7 DNA binding protein-DNA X-ray (2.9 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgigg. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1ph8 DNA binding protein-DNA X-ray (2.36 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and Ssdna Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgcgg. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1ph9 DNA binding protein-DNA X-ray (2.5 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgagg. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1phj DNA binding protein-DNA X-ray (2.5 Å) Theobald DL, Schultz SC (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA gg(3dr)gttttgggg. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1qdf DNA NMR Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan S, Bolton PH (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. doi: 10.1006/jmbi.1996.0408. The NMR study of DNA quadruplex structure, aptamer (15mer) DNA. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
1qdh DNA NMR Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan S, Bolton PH (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. doi: 10.1006/jmbi.1996.0408. The NMR study of DNA quadruplex structure, aptamer (15mer) DNA. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
1qdi DNA NMR Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan S, Bolton PH (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. doi: 10.1006/jmbi.1996.0408. The NMR study of DNA quadruplex structure, (12mer) DNA. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1qdk DNA NMR Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan S, Bolton PH (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. doi: 10.1006/jmbi.1996.0408. The NMR study of DNA quadruplex structure, (12mer) DNA. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
1rau RNA NMR Cheong C, Moore PB (1992) "Solution structure of an unusually stable RNA tetraplex containing G- and U-quartet structures." Biochemistry, 31, 8406-8414. doi: 10.1021/bi00151a003. Solution structure of an unusually stable RNA tetraplex containing g-and u-quartet structures. 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
1rde DNA NMR Mao X, Marky LA, Gmeiner WH (2004) "NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+." J.Biomol.Struct.Dyn., 22, 25-33. NMR structure of the thrombin-binding DNA aptamer stabilized by sr2+. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
1s45 DNA X-ray (2.2 Å) Caceres C, Wright G, Gouyette C, Parkinson G, Subirana JA (2004) "A Thymine tetrad in d(TGGGGT) quadruplexes stabilized with Tl+1/Na+1 ions." Nucleic Acids Res., 32, 1097-1102. doi: 10.1093/nar/gkh269. Crystal structure analysis of the DNA quadruplex d(tggggt) s1. 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5'
1s47 DNA X-ray (2.5 Å) Caceres C, Wright G, Gouyette C, Parkinson G, Subirana JA (2004) "A Thymine tetrad in d(TGGGGT) quadruplexes stabilized with Tl+1/Na+1 ions." Nucleic Acids Res., 32, 1097-1102. doi: 10.1093/nar/gkh269. Crystal structure analysis of the DNA quadruplex d(tggggt)s2. 12 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5'
1s9l RNA NMR Randazzo A, Esposito V, Ohlenschlager O, Ramachandran R, Mayola L (2004) "NMR solution structure of a parallel LNA quadruplex." Nucleic Acids Res., 32, 3083-3092. doi: 10.1093/nar/gkh629. NMR solution structure of a parallel lna quadruplex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
1u64 DNA NMR Sket P, Crnugelj M, Plavec J (2004) "d(G3T4G4) forms unusual dimeric G-quadruplex structure with the same general fold in the presence of K+, Na+ or NH4+ ions." Bioorg.Med.Chem., 12, 5735-5744. doi: 10.1016/j.bmc.2004.08.009. The solution structure of d(g3t4g4)2. 3 G-tetrads, 1 G4 helix, 1 G4 stem, (1+3), UDDD
1v3p DNA X-ray (2.3 Å) Kondo J, Adachi W, Umeda S, Sunami T, Takenaka A (2004) "Crystal structures of a DNA octaplex with I-motif of G-quartets and its splitting into two quadruplexes suggest a folding mechanism of eight tandem repeats." Nucleic Acids Res., 32, 2541-2549. doi: 10.1093/nar/gkh575. Crystal structure of d(gcgagagc): the DNA octaplex structure with i-motif of g-quartet. 2 G-tetrads, 1 G4 helix
1xav DNA NMR Ambrus A, Chen D, Dai J, Jones RA, Yang D (2005) "Solution structure of the biologically relevant G-Quadruplex element in the human c-MYC promoter. Implications for G-quadruplex stabilization." Biochemistry, 44, 2048-2058. doi: 10.1021/bi048242p. Major g-quadruplex structure formed in human c-myc promoter, a monomeric parallel-stranded quadruplex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
1xce DNA NMR Webba da Silva M (2005) "Experimental Demonstration of T:(G:G:G):T Hexad and T:A:A:T Tetrad Alignments within a DNA Quadruplex Stem." Biochemistry, 44, 3754-3764. doi: 10.1021/bi0478190. Helica structure of DNA by design: the t(gggg)t hexad alignment. 4 G-tetrads, 2 G4 helices, 2 G4 stems, parallel(4+0), UUUU
1y8d DNA NMR Phan AT, Kuryavyi VV, Ma J-B, Faure A, Andreola M-L, Patel DJ (2005) "An interlocked dimeric parallel-stranded DNA quadruplex: A potent inhibitor of HIV-1 integrase." Proc.Natl.Acad.Sci.USA, 102, 634-639. doi: 10.1073/pnas.0406278102. Dimeric parallel-stranded tetraplex with 3+1 5' g-tetrad interface, single-residue chain reversal loops and gag triad in the context of a(gggg) pentad. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED
201d DNA NMR Wang Y, Patel DJ (1995) "Solution structure of the Oxytricha telomeric repeat d[G4(T4G4)3] G-tetraplex." J.Mol.Biol., 251, 76-94. doi: 10.1006/jmbi.1995.0417. Solution structure of the oxytricha telomeric repeat d[g4(t4g4)3] g-tetraplex. 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-LwD+Ln), basket(2+2), UDDU
230d DNA NMR Smith FW, Schultze P, Feigon J (1995) "Solution structures of unimolecular quadruplexes formed by oligonucleotides containing Oxytricha telomere repeats." Structure, 3, 997-1008. doi: 10.1016/S0969-2126(01)00236-2. Solution structures of unimolecular quadruplexes formed by oligonucleotides containing oxytricha telomere repeats. 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-LwD+Ln), basket(2+2), UDDU
244d DNA X-ray (1.2 Å) Laughlan G, Murchie AI, Norman DG, Moore MH, Moody PC, Lilley DM, Luisi B (1994) "The high-resolution crystal structure of a parallel-stranded guanine tetraplex." Science, 265, 520-524. The high-resolution crystal structure of a parallel-stranded guanine tetraplex. 16 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, parallel(4+0), UUUU, coaxial interfaces: 5'/5'
2a5p DNA NMR Phan AT, Kuryavyi V, Gaw HY, Patel DJ (2005) "Small-molecule interaction with a five-guanine-tract G-quadruplex structure from the human MYC promoter." Nat.Chem.Biol., 1, 167-173. doi: 10.1038/nchembio723. Monomeric parallel-stranded DNA tetraplex with snap-back 3+1 3' g-tetrad, single-residue chain reversal loops, gag triad in the context of gaag diagonal loop, NMR, 8 struct.. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
2a5r DNA NMR Phan AT, Kuryavyi V, Gaw HY, Patel DJ (2005) "Small-molecule interaction with a five-guanine-tract G-quadruplex structure from the human MYC promoter." Nat.Chem.Biol., 1, 167-173. doi: 10.1038/nchembio723. Complex of tetra-(4-n-methylpyridyl) porphin with monomeric parallel-stranded DNA tetraplex, snap-back 3+1 3' g-tetrad, single-residue chain reversal loops, gag triad in the context of gaag diagonal loop, c-myc promoter, NMR, 6 struct.. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
2akg DNA NMR Gill ML, Strobel SA, Loria JP (2005) "(205)Tl NMR methods for the characterization of monovalent cation binding to nucleic acids." J.Am.Chem.Soc., 127, 16723-16732. doi: 10.1021/ja055358f. Thallium form of the g-quadruplex from oxytricha nova, d(g4t4g4)2. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
2aqy DNA NMR Zhang N, Phan AT, Patel DJ (2005) "(3 + 1) Assembly of three human telomeric repeats into an asymmetric dimeric G-quadruplex." J.Am.Chem.Soc., 127, 17277-17285. doi: 10.1021/ja0543090. (3+1) assembly of three human telomeric DNA repeats into an asymmetrical dimeric g-quadruplex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, (3+1), UUUD
2avh DNA X-ray (1.5 Å) Hazel P, Parkinson GN, Neidle S (2006) "Topology variation and loop structural homology in crystal and simulated structures of a bimolecular DNA quadruplex." J.Am.Chem.Soc., 128, 5480-5487. doi: 10.1021/ja058577+. G4t3g4 dimeric quadruplex structure. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD
2avj DNA X-ray (2.39 Å) Hazel P, Parkinson GN, Neidle S (2006) "Topology variation and loop structural homology in crystal and simulated structures of a bimolecular DNA quadruplex." J.Am.Chem.Soc., 128, 5480-5487. doi: 10.1021/ja058577+. G4(br)uttg4 dimeric quadruplex. 12 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, (2+2), UDDU; (2+2), UDUD; (2+2), UUDD, coaxial interfaces: mixed
2awe RNA X-ray (2.1 Å) Pan B, Shi K, Sundaralingam M (2006) "Base-tetrad swapping results in dimerization of RNA quadruplexes: implications for formation of the i-motif RNA octaplex." Proc.Natl.Acad.Sci.Usa, 103, 3130-3134. doi: 10.1073/pnas.0507730103. Base-tetrad swapping results in dimerization of RNA quadruplexes: implications for formation of i-motif RNA octaplex. 6 G-tetrads, 2 G4 helices, 2 G4 stems, parallel(4+0), UUUU
2chj nucleic acid NMR Nielsen JT, Arar K, Petersen M (2006) "NMR Solution Structures of Lna (Locked Nucleic Acid) Modified Quadruplexes." Nucleic Acids Res., 34, 2006. doi: 10.1093/NAR/GKL144. NMR structure of tglglt quadruplex. 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
2chk nucleic acid NMR Nielsen JT, Arar K, Petersen M (2006) "NMR Solution Structures of Lna (Locked Nucleic Acid) Modified Quadruplexes." Nucleic Acids Res., 34, 2006. doi: 10.1093/NAR/GKL144. NMR structure of tllllt quadruplex. 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
2e4i DNA NMR Matsugami A, Xu Y, Noguchi Y, Sugiyama H, Katahira M (2007) "Structure of a human telomeric DNA sequence stabilized by 8-bromoguanosine substitutions, as determined by NMR in a K+ solution." Febs J., 274, 3545-3556. doi: 10.1111/j.1742-4658.2007.05881.x. Human telomeric DNA mixed-parallel-antiparallel quadruplex under physiological ionic conditions stabilized by proper incorporation of 8-bromoguanosines. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU
2f8u DNA NMR Dai J, Chen D, Jones RA, Hurley LH, Yang D (2006) "NMR solution structure of the major G-quadruplex structure formed in the human BCL2 promoter region." Nucleic Acids Res., 34, 5133-5144. doi: 10.1093/nar/gkl610. G-quadruplex structure formed in human bcl-2 promoter, hybrid form. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU
2gku DNA NMR Luu KN, Phan AT, Kuryavyi VV, Lacroix L, Patel DJ (2006) "Structure of the human telomere in k(+) solution: an intramolecular (3 + 1) g-quadruplex scaffold." J.Am.Chem.Soc., 128, 9963-9970. doi: 10.1021/ja062791w. Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, NMR, 12 structures. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU
2grb RNA X-ray (1.4 Å) Pan B, Shi K, Sundaralingam M (2006) "Crystal structure of an RNA quadruplex containing inosine tetrad: implications for the roles of NH2 group in purine tetrads." J.Mol.Biol., 363, 451-459. doi: 10.1016/j.jmb.2006.08.022. Crystal structure of an RNA quadruplex containing inosine-tetrad. 8 G-tetrads, 2 G4 helices, 2 G4 stems, parallel(4+0), UUUU
2gw0 DNA X-ray (1.55 Å) Lee MP, Parkinson GN, Hazel P, Neidle S (2007) "Observation of the coexistence of sodium and calcium ions in a DNA G-quadruplex ion channel." J.Am.Chem.Soc., 129, 10106-10107. doi: 10.1021/ja0740869. A d(tggggt)- sodium and calcium complex.. 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5'
2gwe DNA X-ray (2.2 Å) Lee MPH, Haider S, Parkinson GN, Neidle S "Crystal structure of D(G4T4G4) with four and six quadruplexes in the asymmetric unit." Crystal structure of d(g4t4g4) with six quadruplexes in the asymmetric unit.. 24 G-tetrads, 6 G4 helices, 6 G4 stems, (2+2), UDDU
2gwq DNA X-ray (2.0 Å) Lee MPH, Haider S, Parkinson GN, Neidle S "Crystal structure of D(G4T4G4) with four and six quadruplexes in the asymmetric unit." Crystal structure of d(g4t4g4) with four quadruplexes in the asymmetric unit.. 16 G-tetrads, 4 G4 helices, 4 G4 stems, (2+2), UDDU
2hbn DNA X-ray (1.55 Å) Gill ML, Strobel SA, Loria JP (2006) "Crystallization and characterization of the thallium form of the Oxytricha nova G-quadruplex." Nucleic Acids Res., 34, 4506-4514. doi: 10.1093/nar/gkl616. Crystallization of the tl+-form of the oxytricha nova g-quadruplex. 8 G-tetrads, 2 G4 helices, 2 G4 stems, (2+2), UDDU
2hri DNA X-ray (2.09 Å) Parkinson GN, Ghosh R, Neidle S (2007) "Structural basis for binding of porphyrin to human telomeres." Biochemistry, 46, 2390-2397. doi: 10.1021/bi062244n. A parallel stranded human telomeric quadruplex in complex with the porphyrin tmpyp4. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
2hy9 DNA NMR Dai J, Punchihewa C, Ambrus A, Chen D, Jones RA, Yang D (2007) "Structure of the intramolecular human telomeric G-quadruplex in potassium solution: a novel adenine triple formation." Nucleic Acids Res., 35, 2440-2450. doi: 10.1093/nar/gkm009. Human telomere DNA quadruplex structure in k+ solution hybrid-1 form. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU
2idn DNA NMR Martino L, Virno A, Randazzo A, Virgilio A, Esposito V, Giancola C, Bucci M, Cirino G, Mayol L (2006) "A new modified thrombin binding aptamer containing a 5'-5' inversion of polarity site." Nucleic Acids Res., 34, 6653-6662. doi: 10.1093/nar/gkl915. NMR structure of a new modified thrombin binding aptamer containing a 5'-5' inversion of polarity site. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-Lw-Ln), UD3(1+3), DDUD
2jpz DNA NMR Dai J, Carver M, Punchihewa C, Jones RA, Yang D (2007) "Structure of the Hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: insights into structure polymorphism of the human telomeric sequence." Nucleic Acids Res., 35, 4927-4940. doi: 10.1093/nar/gkm522. Human telomere DNA quadruplex structure in k+ solution hybrid-2 form. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU
2jsk DNA NMR Phan AT, Kuryavyi V, Luu KN, Patel DJ (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. doi: 10.1093/nar/gkm706. Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, 16 g form 1, NMR, 10 structures. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU
2jsl DNA NMR Phan AT, Kuryavyi V, Luu KN, Patel DJ (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. doi: 10.1093/nar/gkm706. Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, form 2 natural, NMR, 10 structures. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU
2jsm DNA NMR Phan AT, Kuryavyi V, Luu KN, Patel DJ (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. doi: 10.1093/nar/gkm706. Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, NMR, 10 structures, form 1 natural. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU
2jsq DNA NMR Phan AT, Kuryavyi V, Luu KN, Patel DJ (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. doi: 10.1093/nar/gkm706. Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, form 2 15brg, NMR, 10 structures. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU
2jt7 DNA NMR Martino L, Virno A, Pagano B, Virgilio A, Di Micco S, Galeone A, Giancola C, Bifulco G, Mayol L, Randazzo A (2007) "Structural and thermodynamic studies of the interaction of distamycin A with the parallel quadruplex structure [d(TGGGGT)]4." J.Am.Chem.Soc., 129, 16048-16056. doi: 10.1021/ja075710k. NMR solution structure of the 4:1 distamycin a-[d(tggggt)]4 complex. 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
2jwq DNA NMR Hounsou C, Guittat L, Monchaud D, Jourdan M, Saettel N, Mergny JL, Teulade-Fichou M (2007) "G-Quadruplex Recognition by Quinacridines: a SAR, NMR, and Biological Study." ChemMedChem, 2, 655-666. doi: 10.1002/cmdc.200600286. G-quadruplex recognition by quinacridines: a sar, NMR and biological study. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
2kaz DNA NMR Balkwill GD, Garner TP, Williams HE, Searle MS (2009) "Folding topology of a bimolecular DNA quadruplex containing a stable mini-hairpin motif within the diagonal loop." J.Mol.Biol., 385, 1600-1615. doi: 10.1016/j.jmb.2008.11.050. Folding topology of a bimolecular DNA quadruplex containing a stable mini-hairpin motif within the connecting loop. 3 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UUDD
2kbp RNA NMR Martadinata H, Phan AT (2009) "Structure of propeller-type parallel-stranded RNA G-quadruplexes, formed by human telomeric RNA sequences in K+ solution." J.Am.Chem.Soc., 131, 2570-2578. doi: 10.1021/ja806592z. Solution structure of a g-quadruplex of human telomeric RNA. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
2kf7 DNA NMR Lim KW, Amrane S, Bouaziz S, Xu W, Mu Y, Patel DJ, Luu KN, Phan AT (2009) "Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers." J.Am.Chem.Soc., 131, 4301-4309. doi: 10.1021/ja807503g. Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by human telomeric repeats in k+ solution (with g7-to-brg substitution). 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU
2kf8 DNA NMR Lim KW, Amrane S, Bouaziz S, Xu W, Mu Y, Patel DJ, Luu KN, Phan AT (2009) "Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers." J.Am.Chem.Soc., 131, 4301-4309. doi: 10.1021/ja807503g. Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by human telomeric repeats in k+ solution. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU
2kka DNA NMR Zhang Z, Dai J, Veliath E, Jones RA, Yang D (2010) "Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution: insights into the interconversion of human telomeric G-quadruplex structures." Nucleic Acids Res., 38, 1009-1021. doi: 10.1093/nar/gkp1029. Human telomere DNA two-tetrad quadruplex structure in k+ solution. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU
2km3 DNA NMR Lim KW, Alberti P, Guedin A, Lacroix L, Riou JF, Royle NJ, Mergny JL, Phan AT (2009) "Sequence variant (CTAGGG)n in the human telomere favors a G-quadruplex structure containing a G.C.G.C tetrad." Nucleic Acids Res., 37, 6239-6248. doi: 10.1093/nar/gkp630. Structure of an intramolecular g-quadruplex containing a g.c.g.c tetrad formed by human telomeric variant ctaggg repeats. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
2kow DNA NMR Hu L, Lim KW, Bouaziz S, Phan AT (2009) "Giardia Telomeric Sequence d(TAGGG)(4) Forms Two Intramolecular G-Quadruplexes in K(+) Solution: Effect of Loop Length and Sequence on the Folding Topology." J.Am.Chem.Soc., 131, 16824-16831. doi: 10.1021/ja905611c. Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by giardia telomeric repeat d(taggg)4 in k+ solution (with g18-to-ino substitution). 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+LnD-Lw), basket(2+2), UUDD
2kpr DNA NMR Kuryavyi V, Patel DJ (2010) "Solution Structure of a Unique G-Quadruplex Scaffold Adopted by a Guanosine-Rich Human Intronic Sequence." Structure, 18, 73-82. doi: 10.1016/j.str.2009.10.015. Monomeric intronic human chl1 gene quadruplex DNA NMR, 17 structures. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD
2kqg DNA NMR Hsu S-TD, Varnai P, Bugaut A, Reszka AP, Neidle S, Balasubramanian S (2009) "A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics." J.Am.Chem.Soc., 131, 13399-13409. doi: 10.1021/ja904007p. A g-rich sequence within the c-kit oncogene promoter forms a parallel g-quadruplex having asymmetric g-tetrad dynamics. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+P+P+P), parallel(4+0), UUUU
2kqh DNA NMR Hsu S-TD, Varnai P, Bugaut A, Reszka AP, Neidle S, Balasubramanian S (2009) "A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics." J.Am.Chem.Soc., 131, 13399-13409. doi: 10.1021/ja904007p. A g-rich sequence within the c-kit oncogene promoter forms a parallel g-quadruplex having asymmetric g-tetrad dynamics. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2kvy DNA NMR Cosconati S, Marinelli L, Trotta R, Virno A, De Tito S, Romagnoli R, Pagano B, Limongelli V, Giancola C, Baraldi PG, Mayol L, Novellino E, Randazzo A (2010) "Structural and conformational requisites in DNA quadruplex groove binding: another piece to the puzzle." J.Am.Chem.Soc., 132, 6425-6433. doi: 10.1021/ja1003872. NMR solution structure of the 4:1 complex between an uncharged distamycin a analogue and [d(tggggt)]4. 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
2kyo DNA NMR Kuryavyi V, Phan AT, Patel DJ (2010) "Solution structures of all parallel-stranded monomeric and dimeric G-quadruplex scaffolds of the human c-kit2 promoter." Nucleic Acids Res., 38, 6757-6773. doi: 10.1093/nar/gkq558. Dimeric human ckit-2 proto-oncogene promoter quadruplex DNA NMR, 10 structures. 6 G-tetrads, 2 G4 helices, 2 G4 stems, parallel(4+0), UUUU
2kyp DNA NMR Kuryavyi V, Phan AT, Patel DJ (2010) "Solution structures of all parallel-stranded monomeric and dimeric G-quadruplex scaffolds of the human c-kit2 promoter." Nucleic Acids Res., 38, 6757-6773. doi: 10.1093/nar/gkq558. Monomeric human ckit-2 proto-oncogene promoter quadruplex DNA NMR, 12 structures. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2kzd DNA NMR Lim KW, Lacroix L, Yue DJE, Lim JKC, Lim JMW, Phan AT (2010) "Coexistence of two distinct G-quadruplex conformations in the hTERT promoter." J.Am.Chem.Soc., 132, 12331-12342. doi: 10.1021/ja101252n. Structure of a (3+1) g-quadruplex formed by htert promoter sequence. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU
2kze DNA NMR Lim KW, Lacroix L, Yue DJE, Lim JKC, Lim JMW, Phan AT (2010) "Coexistence of two distinct G-quadruplex conformations in the hTERT promoter." J.Am.Chem.Soc., 132, 12331-12342. doi: 10.1021/ja101252n. Structure of an all-parallel-stranded g-quadruplex formed by htert promoter sequence. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2l7v DNA-inhibitor NMR Dai J, Carver M, Hurley LH, Yang D (2011) "Solution Structure of a 2:1 Quindoline-c-MYC G-Quadruplex: Insights into G-Quadruplex-Interactive Small Molecule Drug Design." J.Am.Chem.Soc., 133, 17673-17680. doi: 10.1021/ja205646q. Quindoline-g-quadruplex complex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2l88 DNA NMR Tong X, Lan W, Zhang X, Wu H, Liu M, Cao C (2011) "Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence." Nucleic Acids Res., 39, 6753-6763. doi: 10.1093/nar/gkr233. Solution structure of all parallel g-quadruplex formed by the oncogene ret promoter sequence. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2la5 RNA binding protein-RNA NMR Phan AT, Kuryavyi V, Darnell JC, Serganov A, Majumdar A, Ilin S, Raslin T, Polonskaia A, Chen C, Clain D, Darnell RB, Patel DJ (2011) "Structure-function studies of FMRP RGG peptide recognition of an RNA duplex-quadruplex junction." Nat.Struct.Mol.Biol., 18, 796-804. doi: 10.1038/nsmb.2064. RNA duplex-quadruplex junction complex with fmrp rgg peptide. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
2lby DNA NMR Mathad RI, Hatzakis E, Dai J, Yang D (2011) "c-MYC promoter G-quadruplex formed at the 5'-end of NHE III1 element: insights into biological relevance and parallel-stranded G-quadruplex stability." Nucleic Acids Res., 39, 9023-9033. doi: 10.1093/nar/gkr612. G-quadruplex structure formed at the 5'-end of nheiii_1 element in human c-myc promoter. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2ld8 DNA NMR Heddi B, Phan AT (2011) "Structure of Human Telomeric DNA in Crowded Solution." J.Am.Chem.Soc. doi: 10.1021/ja200786q. Structure of human telomeric DNA in crowded solution. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2le6 DNA NMR Do NQ, Lim KW, Teo MH, Heddi B, Phan AT (2011) "Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity." Nucleic Acids Res. doi: 10.1093/nar/gkr539. Structure of a dimeric all-parallel-stranded g-quadruplex stacked via the 5'-to-5' interface. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
2led DNA NMR Trajkovski M, Webba da Silva M, Plavec J (2012) "Unique Structural Features of Interconverting Monomeric and Dimeric G-Quadruplexes Adopted by a Sequence from the Intron of the N-myc Gene." J.Am.Chem.Soc., 134, 4132-4141. doi: 10.1021/ja208483v. Unique structural features of interconverting monomeric and dimeric g-quadruplexes adopted by a sequence from intron of n-myc gene. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/5'
2lee DNA NMR Trajkovski M, Webba da Silva M, Plavec J (2012) "Unique Structural Features of Interconverting Monomeric and Dimeric G-Quadruplexes Adopted by a Sequence from the Intron of the N-myc Gene." J.Am.Chem.Soc., 134, 4132-4141. doi: 10.1021/ja208483v. Unique structural features of interconverting monomeric and dimeric g-quadruplexes adopted by a sequence from intron of n-myc gene. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2lk7 DNA NMR Do NQ, Phan AT (2012) "Monomer-Dimer Equilibrium for the 5'-5' Stacking of Propeller-Type Parallel-Stranded G-Quadruplexes: NMR Structural Study." Chemistry. doi: 10.1002/chem.201103295. Monomer-dimer equilibrium for 5'-5' stacking of propeller-type parallel-stranded g-quadruplexes: NMR structural study. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2lod DNA NMR Marusic M, Sket P, Bauer L, Viglasky V, Plavec J (2012) "Solution-state structure of an intramolecular G-quadruplex with propeller, diagonal and edgewise loops." Nucleic Acids Res., 40, 6946-6956. doi: 10.1093/nar/gks329. Solution-state structure of an intramolecular g-quadruplex with propeller, diagonal and edgewise loops. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-PD+Lw), U3D(3+1), UUUD
2lpw DNA NMR Amrane S, Adrian M, Heddi B, Serero A, Nicolas A, Mergny JL, Phan AT (2012) "Formation of Pearl-Necklace Monomorphic G-Quadruplexes in the Human CEB25 Minisatellite." J.Am.Chem.Soc., 134, 5807-5816. doi: 10.1021/ja208993r. Human ceb25 minisatellite g-quadruplex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2lxq DNA NMR Kuryavyi V, Cahoon LA, Seifert HS, Patel DJ (2012) "RecA-Binding pilE G4 Sequence Essential for Pilin Antigenic Variation Forms Monomeric and 5' End-Stacked Dimeric Parallel G-Quadruplexes." Structure, 20, 2090-2102. doi: 10.1016/j.str.2012.09.013. Monomeric pile g-quadruplex DNA from neisseria gonorrhoeae. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2lxv DNA NMR Kuryavyi V, Cahoon LA, Seifert HS, Patel DJ (2012) "RecA-Binding pilE G4 Sequence Essential for Pilin Antigenic Variation Forms Monomeric and 5' End-Stacked Dimeric Parallel G-Quadruplexes." Structure, 20, 2090-2102. doi: 10.1016/j.str.2012.09.013. Dimeric pil-e g-quadruplex DNA from neisseria gonorrhoeae, NMR 11 structures. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
2lyg DNA NMR Gomez-Pinto I, Vengut-Climent E, Lucas R, Avino A, Eritja R, Gonzalez C, Morales JC (2013) "Carbohydrate-DNA interactions at G-quadruplexes: folding and stability changes by attaching sugars at the 5'-end." Chemistry, 19, 1920-1927. doi: 10.1002/chem.201203902. Fuc_tba. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
2m18 RNA NMR Martadinata H, Phan AT (2013) "Structure of Human Telomeric RNA (TERRA): Stacking of Two G-Quadruplex Blocks in K(+) Solution." Biochemistry, 52, 2176-2183. doi: 10.1021/bi301606u. Structure of stacked g-quadruplex formed by human terra sequence in potassium solution. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5'
2m1g DNA NMR Martin-Pintado N, Yahyaee-Anzahaee M, Deleavey GF, Portella G, Orozco M, Damha MJ, Gonzalez C (2013) "Dramatic effect of furanose c2' substitution on structure and stability: directing the folding of the human telomeric quadruplex with a single fluorine atom." J.Am.Chem.Soc., 135, 5344-5347. doi: 10.1021/ja401954t. Parallel human telomeric quadruplex containing 2'f-ana substitutions. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
2m27 DNA NMR Agrawal P, Hatzakis E, Guo K, Carver M, Yang D (2013) "Solution structure of the major G-quadruplex formed in the human VEGF promoter in K+: insights into loop interactions of the parallel G-quadruplexes." Nucleic Acids Res., 41, 10584-10592. doi: 10.1093/nar/gkt784. Major g-quadruplex structure formed in human vegf promoter, a monomeric parallel-stranded quadruplex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2m4p DNA NMR Mukundan VT, Phan AT (2013) "Bulges in G-Quadruplexes: Broadening the Definition of G-Quadruplex-Forming Sequences." J.Am.Chem.Soc., 135, 5017-5028. doi: 10.1021/ja310251r. Solution structure of an intramolecular propeller-type g-quadruplex containing a single bulge. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2m53 DNA NMR Marusic M, Veedu RN, Wengel J, Plavec J (2013) "G-rich VEGF aptamer with locked and unlocked nucleic acid modifications exhibits a unique G-quadruplex fold." Nucleic Acids Res. doi: 10.1093/nar/gkt697. G-rich vegf aptamer with lna modifications. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
2m6v DNA NMR Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. Solution NMR structure of the d(gggttgggttttgggtggg) quadruplex in sodium conditions. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU
2m6w DNA NMR Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. Solution NMR structure of the d(ggggttggggttttggggaagggg) quadruplex in sodium conditions. 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-LwD+Ln), basket(2+2), UDDU
2m8z DNA NMR Lim KW, Phan AT (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. doi: 10.1002/anie.201302995. Structure of d[ggttggcgcgaagcattcgcgggttgg] quadruplex-duplex hybrid. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
2m90 DNA NMR Lim KW, Phan AT (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. doi: 10.1002/anie.201302995. Structure of d[gcgcgaagcattcgcggggaggtggggaaggg] quadruplex-duplex hybrid. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
2m91 DNA NMR Lim KW, Phan AT (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. doi: 10.1002/anie.201302995. Structure of d[gggaagggcgcgaagcattcgcgaggtagg] quadruplex-duplex hybrid. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU
2m92 DNA NMR Lim KW, Phan AT (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. doi: 10.1002/anie.201302995. Structure of d[agggtgggtgctggggcgcgaagcattcgcgagg] quadruplex-duplex hybrid. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PX+P), parallel(4+0), UUUU
2m93 DNA NMR Lim KW, Phan AT (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. doi: 10.1002/anie.201302995. Structure of d[ttgggtgggcgcgaagcattcgcggggtgggt] quadruplex-duplex hybrid. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2may DNA NMR Li Z, Lech C, Adrian M, Heddi B, Phan AT "Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes." Structure of a g-quadruplex containing a single lna modification. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU
2mb2 DNA NMR Sengar A, Heddi B, Phan AT (2014) "Formation of g-quadruplexes in poly-g sequences: structure of a propeller-type parallel-stranded g-quadruplex formed by a g15 stretch." Biochemistry, 53, 7718-7723. doi: 10.1021/bi500990v. Parallel-stranded g-quadruplex in DNA poly-g stretches. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2mb3 DNA-DNA inhibitor NMR Chung WJ, Heddi B, Tera M, Iida K, Nagasawa K, Phan AT (2013) "Solution structure of an intramolecular (3 + 1) human telomeric g-quadruplex bound to a telomestatin derivative." J.Am.Chem.Soc., 135, 13495-13501. doi: 10.1021/ja405843r. Solution structure of an intramolecular (3+1) human telomeric g-quadruplex bound to a telomestatin derivative. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU
2mb4 DNA NMR Adrian M, Ang DJ, Lech CJ, Heddi B, Nicolas A, Phan AT (2014) "Structure and Conformational Dynamics of a Stacked Dimeric G-Quadruplex Formed by the Human CEB1 Minisatellite." J.Am.Chem.Soc., 136, 6297-6305. doi: 10.1021/ja4125274. Solution structure of a stacked dimeric g-quadruplex formed by a segment of the human ceb1 minisatellite. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
2mbj DNA NMR Lim KW, Ng VC, Martin-Pintado N, Heddi B, Phan AT (2013) "Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity." Nucleic Acids Res., 41, 10556-10562. doi: 10.1093/nar/gkt771. Structure of an antiparallel (2+2) g-quadruplex formed by human telomeric repeats in na+ solution (with g22-to-brg substitution). 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+Ln+P+Lw), (2+2), UUDD
2mcc DNA NMR Wilson T, Costa PJ, Felix V, Williamson MP, Thomas JA (2013) "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence." J.Med.Chem., 56, 8674-8683. doi: 10.1021/jm401119b. Structural studies on dinuclear ruthenium(ii) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-LxD+Ln), (2+2), UDDU
2mco DNA NMR Wilson T, Costa PJ, Felix V, Williamson MP, Thomas JA (2013) "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence." J.Med.Chem., 56, 8674-8683. doi: 10.1021/jm401119b. Structural studies on dinuclear ruthenium(ii) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-LwD+Ln), basket(2+2), UDDU
2mft DNA NMR Karsisiotis AI, Webba da Silva M "Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions." Solution NMR structure of the d(gggttttgggtgggttttggg) quadruplex in sodium conditions. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(D+PD), (2+2), UDDU
2mfu DNA NMR Karsisiotis A, Dillon P, Webba da Silva M "Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions." Solution NMR structure of quadruplex d(tgggtttgggttgggtttggg) in sodium conditions. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-Lw-Ln-P), hybrid-2(3+1), UDUU
2mgn DNA NMR Chung WJ, Heddi B, Hamon F, Teulade-Fichou MP, Phan AT (2014) "Solution Structure of a G-quadruplex Bound to the Bisquinolinium Compound Phen-DC3." Angew.Chem.Int.Ed.Engl., 53, 999-1002. doi: 10.1002/anie.201308063. Solution structure of a g-quadruplex bound to the bisquinolinium compound phen-dc3. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
2ms6 DNA NMR Tawani A, Kumar A (2015) "Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence." Sci Rep, 5, 17574. doi: 10.1038/srep17574. Human telomeric g-quadruplex DNA sequence (ttagggt)4 complexed with flavonoid quercetin. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
2ms9 DNA NMR Chung WJ, Heddi B, Schmitt E, Lim KW, Mechulam Y, Phan AT (2015) "Structure of a left-handed DNA G-quadruplex." Proc.Natl.Acad.Sci.USA. Solution structure of a g-quadruplex. 4 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+P+P+P), parallel(4+0), UUUU, negative twist
2mwz DNA NMR Cheong VV, Heddi B, Lech CJ, Phan AT (2015) "Xanthine and 8-oxoguanine in G-quadruplexes: formation of a GGXO tetrad." Nucleic Acids Res., 43, 10506-10514. doi: 10.1093/nar/gkv826. Xanthine and 8-oxoguanine in g-quadruplexes: formation of a g g x o tetrad. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU
2n21 hydrolase-DNA NMR Heddi B, Cheong VV, Martadinata H, Phan AT (2015) "Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex." Proc.Natl.Acad.Sci.USA. doi: 10.1073/pnas.1422605112. Solution structure of complex between DNA g-quadruplex and g-quadruplex recognition domain of rhau. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2n2d DNA NMR Brcic J, Plavec J (2015) "Solution structure of a DNA quadruplex containing ALS and FTD related GGGGCC repeat stabilized by 8-bromodeoxyguanosine substitution." Nucleic Acids Res., 43, 8590-8600. doi: 10.1093/nar/gkv815. Structure of DNA g-quadruplex adopted by als and ftd related ggggcc repeat with g21 to br-g21 substitution. 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(+Ln+Lw+Ln), chair(2+2), UDUD
2n3m DNA NMR Do NQ, Chung WJ, Truong THA, Heddi B, Phan AT "G-quadruplex structure of an anti-proliferative DNA sequence." G-quadruplex structure of an anti-proliferative DNA sequence. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 3'/5'
2n4y DNA NMR De Nicola B, Lech CJ, Heddi B, Regmi S, Frasson I, Perrone R, Richter SN, Phan AT (2016) "Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome." Nucleic Acids Res., 44, 6442-6451. doi: 10.1093/nar/gkw432. Structure and possible function of a g-quadruplex in the long terminal repeat of the proviral hiv-1 genome. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
2n60 DNA NMR Heddi B, Martin-Pintado N, Serimbetov Z, Kari TM, Phan AT (2016) "G-quadruplexes with (4n - 1) guanines in the G-tetrad core: formation of a G-triadwater complex and implication for small-molecule binding." Nucleic Acids Res., 44, 910-916. doi: 10.1093/nar/gkv1357. G-quadruplexes with (4n-1) guanines in the g-tetrad core: formation of a g-triad water complex and implication for small-molecule binding. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
2n6c DNA NMR Kumar A, Tawani A "Solution structure for quercetin complexed with c-myc G-quadruplex DNA." Solution structure for quercetin complexed with c-myc g-quadruplex DNA. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
2n9q DNA NMR Thevarpadam J, Bessi I, Binas O, Goncalves DP, Slavov C, Jonker HR, Richter C, Wachtveitl J, Schwalbe H, Heckel A (2016) "Photoresponsive Formation of an Intermolecular Minimal G-Quadruplex Motif." Angew.Chem.Int.Ed.Engl., 55, 2738-2742. doi: 10.1002/anie.201510269. Photoswitchable g-quadruplex. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, (2+2), UDUD, coaxial interfaces: mixed
2o3m DNA NMR Phan AT, Kuryavyi VV, Burge S, Neidle S, Patel DJ (2007) "Structure of an unprecedented G-quadruplex scaffold in the human c-kit promoter." J.Am.Chem.Soc., 129, 4386-4392. doi: 10.1021/ja068739h. Monomeric g-DNA tetraplex from human c-kit promoter. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PX+P), parallel(4+0), UUUU
2o4f DNA X-ray (1.5 Å) Creze C, Rinaldi B, Haser R, Bouvet P, Gouet P (2007) "Structure of a d(TGGGGT) quadruplex crystallized in the presence of Li+ ions." Acta Crystallogr.,Sect.D, 63, 682-688. doi: 10.1107/S0907444907013315. Structure of a parallel-stranded guanine tetraplex crystallised with monovalent ions. 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5'
2rqj RNA NMR Mashima T, Matsugami A, Nishikawa F, Nishikawa S, Katahira M (2009) "Unique quadruplex structure and interaction of an RNA aptamer against bovine prion protein." Nucleic Acids Res., 37, 6249-6258. doi: 10.1093/nar/gkp647. Quadruplex structure of an RNA aptamer against bovine prion protein. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
2rsk membrane protein-RNA NMR Mashima T, Nishikawa F, Kamatari YO, Fujiwara H, Saimura M, Nagata T, Kodaki T, Nishikawa S, Kuwata K, Katahira M (2013) "Anti-prion activity of an RNA aptamer and its structural basis." Nucleic Acids Res., 41, 1355-1362. doi: 10.1093/nar/gks1132. RNA aptamer against prion protein in complex with the partial binding peptide. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
2ru7 membrane protein-RNA NMR Hayashi T, Oshima H, Mashima T, Nagata T, Katahira M, Kinoshita M (2014) "Binding of an RNA aptamer and a partial peptide of a prion protein: crucial importance of water entropy in molecular recognition." Nucleic Acids Res. doi: 10.1093/nar/gku382. Refined structure of RNA aptamer in complex with the partial binding peptide of prion protein. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
2wcn DNA NMR Nielsen JT, Arar K, Petersen M (2009) "Solution Structure of a Locked Nucleic Acid Modified Quadruplex: Introducing the V4 Folding Topology." Angew.Chem.Int.Ed.Engl., 48, 3099. doi: 10.1002/ANIE.200806244. Solution structure of an lna-modified quadruplex. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD
352d DNA X-ray (0.95 Å) Phillips K, Dauter Z, Murchie AI, Lilley DM, Luisi B (1997) "The crystal structure of a parallel-stranded guanine tetraplex at 0.95 A resolution." J.Mol.Biol., 273, 171-182. doi: 10.1006/jmbi.1997.1292. The crystal structure of a parallel-stranded parallel-stranded guanine tetraplex at 0.95 angstrom resolution. 16 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, parallel(4+0), UUUU, coaxial interfaces: 5'/5'
3cco DNA X-ray (2.2 Å) Parkinson GN, Cuenca F, Neidle S (2008) "Topology conservation and loop flexibility in quadruplex-drug recognition: crystal structures of inter- and intramolecular telomeric DNA quadruplex-drug complexes." J.Mol.Biol., 381, 1145-1156. doi: 10.1016/j.jmb.2008.06.022. Structural adaptation and conservation in quadruplex-drug recognition. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
3cdm DNA X-ray (2.1 Å) Parkinson GN, Cuenca F, Neidle S (2008) "Topology conservation and loop flexibility in quadruplex-drug recognition: crystal structures of inter- and intramolecular telomeric DNA quadruplex-drug complexes." J.Mol.Biol., 381, 1145-1156. doi: 10.1016/j.jmb.2008.06.022. Structural adaptation and conservation in quadruplex-drug recognition. 6 G-tetrads, 2 G4 helices, 2 G4 stems, 3(-P-P-P), parallel(4+0), UUUU
3ce5 DNA X-ray (2.5 Å) Campbell NH, Parkinson GN, Reszka AP, Neidle S (2008) "Structural basis of DNA quadruplex recognition by an acridine drug." J.Am.Chem.Soc., 130, 6722-6724. doi: 10.1021/ja8016973. A bimolecular parallel-stranded human telomeric quadruplex in complex with a 3,6,9-trisubstituted acridine molecule braco19. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
3em2 DNA X-ray (2.3 Å) Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6038. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
3eqw DNA X-ray (2.2 Å) Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6042 in small unit cell. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
3eru DNA X-ray (2.0 Å) Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6045. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
3es0 DNA X-ray (2.2 Å) Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6048. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
3et8 DNA X-ray (2.45 Å) Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6054. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
3eui DNA X-ray (2.2 Å) Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6042 in a large unit cell. 8 G-tetrads, 2 G4 helices, 2 G4 stems, (2+2), UDDU
3eum DNA X-ray (1.78 Å) Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6066. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
3ibk RNA X-ray (2.2 Å) Collie GW, Haider SM, Neidle S, Parkinson GN (2010) "A crystallographic and modelling study of a human telomeric RNA (TERRA) quadruplex." Nucleic Acids Res., 38, 5569-5580. doi: 10.1093/nar/gkq259. Crystal structure of a telomeric RNA quadruplex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
3mij RNA X-ray (2.6 Å) Collie GW, Sparapani S, Parkinson GN, Neidle S (2011) "Structural basis of telomeric RNA quadruplex-acridine ligand recognition." J.Am.Chem.Soc., 133, 2721-2728. doi: 10.1021/ja109767y. Crystal structure of a telomeric RNA g-quadruplex complexed with an acridine-based ligand.. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
3nyp DNA X-ray (1.179 Å) Campbell NH, Smith DL, Reszka AP, Neidle S, O'Hagan D (2011) "Fluorine in medicinal chemistry: beta-fluorination of peripheral pyrrolidines attached to acridine ligands affects their interactions with G-quadruplex DNA." Org.Biomol.Chem., 9, 1328-1331. doi: 10.1039/c0ob00886a. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine ligand containing bis-3-fluoropyrrolidine end side chains. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
3nz7 DNA X-ray (1.1 Å) Campbell NH, Smith DL, Reszka AP, Neidle S, O'Hagan D (2011) "Fluorine in medicinal chemistry: beta-fluorination of peripheral pyrrolidines attached to acridine ligands affects their interactions with G-quadruplex DNA." Org.Biomol.Chem., 9, 1328-1331. doi: 10.1039/c0ob00886a. A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine ligand containing bis-3-fluoropyrrolidine end side chains. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
3qcr DNA X-ray (3.2 Å) Collie GW, Sparapani S, Parkinson GN, Neidle S (2011) "Structural basis of telomeric RNA quadruplex-acridine ligand recognition." J.Am.Chem.Soc., 133, 2721-2728. doi: 10.1021/ja109767y. Incomplete structural model of a human telomeric DNA quadruplex-acridine complex.. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
3qlp hydrolase-hydrolase inhibitor-DNA X-ray (2.14 Å) Russo Krauss I, Merlino A, Giancola C, Randazzo A, Mazzarella L, Sica F (2011) "Thrombin-aptamer recognition: a revealed ambiguity." Nucleic Acids Res., 39, 7858-7867. doi: 10.1093/nar/gkr522. X-ray structure of the complex between human alpha thrombin and a modified thrombin binding aptamer (mtba). 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-Lw-Ln), UD3(1+3), DDUD
3qsc DNA X-ray (2.4 Å) Campbell NH, Karim NH, Parkinson GN, Gunaratnam M, Petrucci V, Todd AK, Vilar R, Neidle S (2012) "Molecular basis of structure-activity relationships between salphen metal complexes and human telomeric DNA quadruplexes." J.Med.Chem., 55, 209-222. doi: 10.1021/jm201140v. The first crystal structure of a human telomeric g-quadruplex DNA bound to a metal-containing ligand (a copper complex). 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
3qsf DNA X-ray (2.4 Å) Campbell NH, Karim NH, Parkinson GN, Gunaratnam M, Petrucci V, Todd AK, Vilar R, Neidle S (2012) "Molecular basis of structure-activity relationships between salphen metal complexes and human telomeric DNA quadruplexes." J.Med.Chem., 55, 209-222. doi: 10.1021/jm201140v. The first crystal structure of a human telomeric g-quadruplex DNA bound to a metal-containing ligand (a nickel complex). 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
3qxr DNA X-ray (1.62 Å) Wei D, Parkinson GN, Reszka AP, Neidle S (2012) "Crystal structure of a c-kit promoter quadruplex reveals the structural role of metal ions and water molecules in maintaining loop conformation." Nucleic Acids Res., 40, 4691-4700. doi: 10.1093/nar/gks023. Crystal structure of the brominated ckit-1 proto-oncogene promoter quadruplex DNA. 6 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-PX+P), parallel(4+0), UUUU
3r6r DNA-antibiotic X-ray (2.4 Å) Bazzicalupi C, Ferraroni M, Bilia AR, Scheggi F, Gratteri P (2013) "The crystal structure of human telomeric DNA complexed with berberine: an interesting case of stacked ligand to G-tetrad ratio higher than 1:1." Nucleic Acids Res., 41, 632-638. doi: 10.1093/nar/gks1001. Structure of the complex of an intramolecular human telomeric DNA with berberine formed in k+ solution. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
3sc8 DNA X-ray (2.302 Å) Collie GW, Promontorio R, Hampel SM, Micco M, Neidle S, Parkinson GN (2012) "Structural basis for telomeric g-quadruplex targeting by naphthalene diimide ligands." J.Am.Chem.Soc., 134, 2723-2731. doi: 10.1021/ja2102423. Crystal structure of an intramolecular human telomeric DNA g-quadruplex bound by the naphthalene diimide bmsg-sh-3. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
3t5e DNA X-ray (2.1 Å) Collie GW, Promontorio R, Hampel SM, Micco M, Neidle S, Parkinson GN (2012) "Structural basis for telomeric g-quadruplex targeting by naphthalene diimide ligands." J.Am.Chem.Soc., 134, 2723-2731. doi: 10.1021/ja2102423. Crystal structure of an intramolecular human telomeric DNA g-quadruplex bound by the naphthalene diimide bmsg-sh-4. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
3tvb DNA-antibiotic X-ray (1.08 Å) Clark GR, Pytel PD, Squire CJ (2012) "The high-resolution crystal structure of a parallel intermolecular DNA G-4 quadruplex/drug complex employing syn glycosyl linkages." Nucleic Acids Res., 40, 5731-5738. doi: 10.1093/nar/gks193. A highly symmetric DNA g-4 quadruplex-drug complex. 8 G-tetrads, 2 G4 helices, 2 G4 stems, parallel(4+0), UUUU
3uyh DNA X-ray (1.95 Å) Micco M, Collie GW, Dale AG, Ohnmacht SA, Pazitna I, Gunaratnam M, Reszka AP, Neidle S (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. doi: 10.1021/jm301899y. Crystal structure of an intramolecular human telomeric DNA g-quadruplex bound by the naphthalene diimide compound, mm41. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
4da3 DNA X-ray (2.4 Å) Micco M, Collie GW, Dale AG, Ohnmacht SA, Pazitna I, Gunaratnam M, Reszka AP, Neidle S (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. doi: 10.1021/jm301899y. Crystal structure of an intramolecular human telomeric DNA g-quadruplex 21-mer bound by the naphthalene diimide compound mm41.. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
4daq DNA X-ray (2.754 Å) Micco M, Collie GW, Dale AG, Ohnmacht SA, Pazitna I, Gunaratnam M, Reszka AP, Neidle S (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. doi: 10.1021/jm301899y. Crystal structure of an intramolecular human telomeric DNA g-quadruplex 21-mer bound by the naphthalene diimide compound bmsg-sh-3. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
4dih hydrolase-hydrolase inhibitor-DNA X-ray (1.8 Å) Russo Krauss I, Merlino A, Randazzo A, Novellino E, Mazzarella L, Sica F (2012) "High-resolution structures of two complexes between thrombin and thrombin-binding aptamer shed light on the role of cations in the aptamer inhibitory activity." Nucleic Acids Res., 40, 8119-8128. doi: 10.1093/nar/gks512. X-ray structure of the complex between human alpha thrombin and thrombin binding aptamer in the presence of sodium ions. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
4dii hydrolase-hydrolase inhibitor-DNA X-ray (2.05 Å) Russo Krauss I, Merlino A, Randazzo A, Novellino E, Mazzarella L, Sica F (2012) "High-resolution structures of two complexes between thrombin and thrombin-binding aptamer shed light on the role of cations in the aptamer inhibitory activity." Nucleic Acids Res., 40, 8119-8128. doi: 10.1093/nar/gks512. X-ray structure of the complex between human alpha thrombin and thrombin binding aptamer in the presence of potassium ions. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
4fxm DNA X-ray (1.651 Å) Nicoludis JM, Miller ST, Jeffrey PD, Barrett SP, Rablen PR, Lawton TJ, Yatsunyk LA (2012) "Optimized End-Stacking Provides Specificity of N-Methyl Mesoporphyrin IX for Human Telomeric G-Quadruplex DNA." J.Am.Chem.Soc., 134, 20446-20456. doi: 10.1021/ja3088746. Crystal structure of the complex of a human telomeric repeat g-quadruplex and n-methyl mesoporphyrin ix (p21212). 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
4g0f DNA X-ray (2.15 Å) Nicoludis JM, Miller ST, Jeffrey PD, Barrett SP, Rablen PR, Lawton TJ, Yatsunyk LA (2012) "Optimized End-Stacking Provides Specificity of N-Methyl Mesoporphyrin IX for Human Telomeric G-Quadruplex DNA." J.Am.Chem.Soc., 134, 20446-20456. doi: 10.1021/ja3088746. Crystal structure of the complex of a human telomeric repeat g-quadruplex and n-methyl mesoporphyrin ix (p6). 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
4h29 DNA X-ray (1.991 Å) Wei D, Todd AK, Zloh M, Gunaratnam M, Parkinson GN, Neidle S (2013) "Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex." J.Am.Chem.Soc., 135, 19319-19329. doi: 10.1021/ja4101358. B-raf dimer DNA quadruplex. 7 G-tetrads, 1 G4 helix, 3 G4 stems, 1 G4 coaxial stack, (2+2), UDUD; parallel(4+0), UUUU, coaxial interfaces: mixed; 3'/5'
4i7y hydrolase-hydrolase inhibitor-DNA X-ray (2.4 Å) Russo Krauss I, Pica A, Merlino A, Mazzarella L, Sica F (2013) "Duplex-quadruplex motifs in a peculiar structural organization cooperatively contribute to thrombin binding of a DNA aptamer." Acta Crystallogr.,Sect.D, 69, 2403-2411. doi: 10.1107/S0907444913022269. Crystal structure of human alpha thrombin in complex with a 27-mer aptamer bound to exosite ii. 1 G-tetrad
4kzd immune system-RNA X-ray (2.186 Å) Huang H, Suslov NB, Li NS, Shelke SA, Evans ME, Koldobskaya Y, Rice PA, Piccirilli JA (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. doi: 10.1038/nchembio.1561. Crystal structure of an RNA aptamer in complex with fluorophore and fab. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD
4kze immune system-RNA X-ray (2.404 Å) Huang H, Suslov NB, Li NS, Shelke SA, Evans ME, Koldobskaya Y, Rice PA, Piccirilli JA (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. doi: 10.1038/nchembio.1561. Crystal structure of an RNA aptamer in complex with fab. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD
4l0a DNA, RNA X-ray (1.7 Å) Russo Krauss I, Parkinson GN, Merlino A, Mattia CA, Randazzo A, Novellino E, Mazzarella L, Sica F (2014) "A regular thymine tetrad and a peculiar supramolecular assembly in the first crystal structure of an all-LNA G-quadruplex." Acta Crystallogr.,Sect.D, 70, 362-370. doi: 10.1107/S1399004713028095. X-ray structure of an all lna quadruplex. 6 G-tetrads, 2 G4 helices, 2 G4 stems, parallel(4+0), UUUU
4lz1 hydrolase-hydrolase inhibitor-DNA X-ray (1.65 Å) Pica A, Russo Krauss I, Merlino A, Nagatoishi S, Sugimoto N, Sica F (2013) "Dissecting the contribution of thrombin exosite I in the recognition of thrombin binding aptamer." Febs J., 280, 6581-6588. doi: 10.1111/febs.12561. X-ray structure of the complex between human thrombin and the tba deletion mutant lacking thymine 12 nucleobase. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
4lz4 hydrolase-hydrolase inhibitor-DNA X-ray (2.56 Å) Pica A, Russo Krauss I, Merlino A, Nagatoishi S, Sugimoto N, Sica F (2013) "Dissecting the contribution of thrombin exosite I in the recognition of thrombin binding aptamer." Febs J., 280, 6581-6588. doi: 10.1111/febs.12561. X-ray structure of the complex between human thrombin and the tba deletion mutant lacking thymine 3 nucleobase. 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(+Ln+Lw+Ln), chair(2+2), UDUD
4ni7 cytokine-DNA X-ray (2.4 Å) Gelinas AD, Davies DR, Edwards TE, Rohloff JC, Carter JD, Zhang C, Gupta S, Ishikawa Y, Hirota M, Nakaishi Y, Jarvis TC, Janjic N (2014) "Crystal structure of interleukin-6 in complex with a modified nucleic Acid ligand." J.Biol.Chem., 289, 8720-8734. doi: 10.1074/jbc.M113.532697. Crystal structure of human interleukin 6 in complex with a modified nucleotide aptamer (somamer sl1025). 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw), chair(2+2), UDUD
4ni9 cytokine-DNA X-ray (2.55 Å) Gelinas AD, Davies DR, Edwards TE, Rohloff JC, Carter JD, Zhang C, Gupta S, Ishikawa Y, Hirota M, Nakaishi Y, Jarvis TC, Janjic N (2014) "Crystal structure of interleukin-6 in complex with a modified nucleic Acid ligand." J.Biol.Chem., 289, 8720-8734. doi: 10.1074/jbc.M113.532697. Crystal structure of human interleukin 6 in complex with a modified nucleotide aptamer (somamer sl1025), form 2. 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(+Ln+Lw+Ln), chair(2+2), UDUD
4p1d DNA X-ray (1.55 Å) Ferraroni M, Bazzicalupi C, Gratteri P, Bilia AR, Sissi C "Crystal Structure of the complex of a bimolecular human telomeric DNA with Coptisine." Structure of the complex of a bimolecular human telomeric DNA with coptisine. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
4q9q RNA X-ray (2.45 Å) Huang H, Suslov NB, Li NS, Shelke SA, Evans ME, Koldobskaya Y, Rice PA, Piccirilli JA (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. doi: 10.1038/nchembio.1561. Crystal structure of an RNA aptamer bound to bromo-ligand analog in complex with fab. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD
4q9r RNA-immune system X-ray (3.12 Å) Huang H, Suslov NB, Li NS, Shelke SA, Evans ME, Koldobskaya Y, Rice PA, Piccirilli JA (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. doi: 10.1038/nchembio.1561. Crystal structure of an RNA aptamer bound to trifluoroethyl-ligand analog in complex with fab. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD
4r44 DNA X-ray (2.695 Å) Mandal PK, Collie GW, Kauffmann B, Huc I (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. doi: 10.1002/anie.201409014. Racemic crystal structure of a tetramolecular DNA g-quadruplex. 16 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, parallel(4+0), UUUU, coaxial interfaces: 5'/5'
4r45 DNA X-ray (1.9 Å) Mandal PK, Collie GW, Kauffmann B, Huc I (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. doi: 10.1002/anie.201409014. Racemic crystal structure of a bimolecular DNA g-quadruplex (p-1). 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
4r47 DNA X-ray (1.85 Å) Mandal PK, Collie GW, Kauffmann B, Huc I (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. doi: 10.1002/anie.201409014. Racemic crystal structure of a bimolecular DNA g-quadruplex (p21-n). 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
4rj1 RNA X-ray (0.92 Å) Fyfe AC, Dunten PW, Martick MM, Scott WG (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. doi: 10.1016/j.jmb.2015.03.022. Structural variations and solvent structure of uggggu quadruplexes stabilized by sr2+ ions. 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5'
4rkv RNA X-ray (0.88 Å) Fyfe AC, Dunten PW, Martick MM, Scott WG (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. doi: 10.1016/j.jmb.2015.03.022. Structural variations and solvent structure of uggggu quadruplexes stabilized by sr2+ ions. 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5'
4rne RNA X-ray (1.01 Å) Fyfe AC, Dunten PW, Martick MM, Scott WG (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. doi: 10.1016/j.jmb.2015.03.022. Structural variations and solvent structure of uggggu quadruplexes stabilized by sr2+ ions. 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
4ts0 RNA X-ray (2.8 Å) Warner KD, Chen MC, Song W, Strack RL, Thorn A, Jaffrey SR, Ferre-D'Amare AR (2014) "Structural basis for activity of highly efficient RNA mimics of green fluorescent protein." Nat.Struct.Mol.Biol., 21, 658-663. doi: 10.1038/nsmb.2865. Crystal structure of the spinach RNA aptamer in complex with dfhbi, barium ions. 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UUDD
4ts2 RNA X-ray (2.884 Å) Warner KD, Chen MC, Song W, Strack RL, Thorn A, Jaffrey SR, Ferre-D'Amare AR (2014) "Structural basis for activity of highly efficient RNA mimics of green fluorescent protein." Nat.Struct.Mol.Biol., 21, 658-663. doi: 10.1038/nsmb.2865. Crystal structure of the spinach RNA aptamer in complex with dfhbi, magnesium ions. 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UUDD
4u5m DNA X-ray (1.5 Å) Chung WJ, Heddi B, Schmitt E, Lim KW, Mechulam Y, Phan AT (2015) "Structure of a left-handed DNA G-quadruplex." Proc.Natl.Acad.Sci.USA, 112, 2729-2733. doi: 10.1073/pnas.1418718112. Structure of a left-handed DNA g-quadruplex. 4 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+P+P+P), parallel(4+0), UUUU, negative twist
4u92 DNA X-ray (1.5 Å) Zhang D, Huang T, Lukeman PS, Paukstelis PJ (2014) "Crystal structure of a DNA/Ba2+ G-quadruplex containing a water-mediated C-tetrad." Nucleic Acids Res., 42, 13422-13429. doi: 10.1093/nar/gku1122. Crystal structure of a DNA-ba2+ g-quadruplex containing a water-mediated c-tetrad. 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/3'
4wb2 DNA-RNA hybrid X-ray (1.8 Å) Yatime L, Maasch C, Hoehlig K, Klussmann S, Andersen GR, Vater A (2015) "Structural basis for the targeting of complement anaphylatoxin C5a using a mixed L-RNA/L-DNA aptamer." Nat Commun, 6, 6481. doi: 10.1038/ncomms7481. Crystal structure of the mirror-image l-RNA-l-DNA aptamer nox-d20 in complex with mouse c5a complement anaphylatoxin. 4 G-tetrads, 2 G4 helices
4wb3 DNA-RNA hybrid X-ray (2.0 Å) Yatime L, Maasch C, Hoehlig K, Klussmann S, Andersen GR, Vater A (2015) "Structural basis for the targeting of complement anaphylatoxin C5a using a mixed L-RNA/L-DNA aptamer." Nat Commun, 6, 6481. doi: 10.1038/ncomms7481. Crystal structure of the mirror-image l-RNA-l-DNA aptamer nox-d20 in complex with mouse c5a-desarg complement anaphylatoxin. 4 G-tetrads, 2 G4 helices
4wo2 DNA X-ray (1.82 Å) Wei D, Parkinson GN, Neidle S "CRYSTAL STRUCTURE OF HUMAN NATIVE CKIT-1 PROTO-ONCOGENE PROMOTER QUADRUPLEX DNA." Crystal structure of human native ckit proto-oncogene promoter quadruplex DNA. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-PX+P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED
4wo3 DNA X-ray (2.73 Å) Wei D, Neidle S "THE SECOND C-KIT1 DNA QUADRUPLEX CRYSTAL STRUCTURE." The second c-kit DNA quadruplex crystal structure. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-PX+P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED
4xk0 RNA X-ray (1.08 Å) Chen MC, Murat P, Abecassis K, Ferre-D'Amare AR, Balasubramanian S (2015) "Insights into the mechanism of a G-quadruplex-unwinding DEAH-box helicase." Nucleic Acids Res., 43, 2223-2231. doi: 10.1093/nar/gkv051. Crystal structure of a tetramolecular RNA g-quadruplex in potassium. 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5'
5bjo RNA X-ray (2.35 Å) Warner KD, Sjekloca L, Song W, Filonov GS, Jaffrey SR, Ferre-D'Amare AR (2017) "A homodimer interface without base pairs in an RNA mimic of red fluorescent protein." Nat. Chem. Biol., 13, 1195-1201. doi: 10.1038/nchembio.2475. Crystal structure of the corn RNA aptamer in complex with dfho, site-specific 5-iodo-u. 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU
5bjp RNA X-ray (2.51 Å) Warner KD, Sjekloca L, Song W, Filonov GS, Jaffrey SR, Ferre-D'Amare AR (2017) "A homodimer interface without base pairs in an RNA mimic of red fluorescent protein." Nat. Chem. Biol., 13, 1195-1201. doi: 10.1038/nchembio.2475. Crystal structure of the corn RNA aptamer in complex with dfho, iridium hexammine soak. 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU
5ccw drug-DNA X-ray (1.89 Å) Bazzicalupi C, Ferraroni M, Papi F, Massai L, Bertrand B, Messori L, Gratteri P, Casini A (2016) "Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation." Angew.Chem.Int.Ed.Engl., 55, 4256-4259. doi: 10.1002/anie.201511999. Structure of the complex of a human telomeric DNA with au(caffein-2-ylidene)2. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P), parallel(4+0), UUUU
5cdb DNA X-ray (1.7 Å) Ferraroni M, Bazzicalupi C, Papi F, Fiorillo G, Guaman-Ortiz LM, Nocentini A, Scovassi AI, Lombardi P, Gratteri P (2016) "Solution and Solid-State Analysis of Binding of 13-Substituted Berberine Analogues to Human Telomeric G-quadruplexes." Chem Asian J, 11, 1107-1115. doi: 10.1002/asia.201600116. Structure of the complex of a bimolecular human telomeric DNA with a 13-diphenylalkyl berberine derivative. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
5cmx hydrolase X-ray (2.98 Å) Russo Krauss I, Spiridonova V, Pica A, Napolitano V, Sica F (2016) "Different duplex/quadruplex junctions determine the properties of anti-thrombin aptamers with mixed folding." Nucleic Acids Res., 44, 983-991. doi: 10.1093/nar/gkv1384. X-ray structure of the complex between human alpha thrombin and a duplex-quadruplex 31-mer DNA aptamer. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
5de5 RNA binding protein-RNA X-ray (3.0011 Å) Vasilyev N, Polonskaia A, Darnell JC, Darnell RB, Patel DJ, Serganov A (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. doi: 10.1073/pnas.1515737112. Crystal structure of the complex between human fmrp rgg motif and g-quadruplex RNA.. 6 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU
5de8 RNA binding protein-RNA X-ray (3.1003 Å) Vasilyev N, Polonskaia A, Darnell JC, Darnell RB, Patel DJ, Serganov A (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. doi: 10.1073/pnas.1515737112. Crystal structure of the complex between human fmrp rgg motif and g-quadruplex RNA, iridium hexammine bound form.. 6 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU
5dea RNA binding protein-RNA X-ray (2.7973 Å) Vasilyev N, Polonskaia A, Darnell JC, Darnell RB, Patel DJ, Serganov A (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. doi: 10.1073/pnas.1515737112. Crystal structure of the complex between human fmrp rgg motif and g-quadruplex RNA, cesium bound form.. 6 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU
5dww DNA X-ray (2.79 Å) Russo Krauss I, Ramaswamy S, Neidle S, Haider S, Parkinson GN (2016) "Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target." J.Am.Chem.Soc., 138, 1226-1233. doi: 10.1021/jacs.5b10492. Structural insights into the quadruplex-duplex 3' interface formed from a telomeric repeat - ttloop. 12 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
5dwx DNA X-ray (2.71 Å) Russo Krauss I, Ramaswamy S, Neidle S, Haider S, Parkinson GN (2016) "Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target." J.Am.Chem.Soc., 138, 1226-1233. doi: 10.1021/jacs.5b10492. Structural insights into the quadruplex-duplex 3' interface formed from a telomeric repeat - tloop. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
5ew1 protein-DNA X-ray (2.95 Å) Pica A, Russo Krauss I, Parente V, Tateishi-Karimata H, Nagatoishi S, Tsumoto K, Sugimoto N, Sica F (2017) "Through-bond effects in the ternary complexes of thrombin sandwiched by two DNA aptamers." Nucleic Acids Res., 45, 461-469. doi: 10.1093/nar/gkw1113. Human thrombin sandwiched between two DNA aptamers: hd22 and hd1-deltat3. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
5ew2 protein-DNA X-ray (3.59 Å) Pica A, Russo Krauss I, Parente V, Tateishi-Karimata H, Nagatoishi S, Tsumoto K, Sugimoto N, Sica F (2017) "Through-bond effects in the ternary complexes of thrombin sandwiched by two DNA aptamers." Nucleic Acids Res., 45, 461-469. doi: 10.1093/nar/gkw1113. Human thrombin sandwiched between two DNA aptamers: hd22 and hd1-deltat12. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
5hix DNA X-ray (2.48 Å) Mandal PK, Baptiste B, Langlois d'Estaintot B, Kauffmann B, Huc I (2016) "Multivalent Interactions between an Aromatic Helical Foldamer and a DNA G-Quadruplex in the Solid State." Chembiochem, 17, 1911-1914. doi: 10.1002/cbic.201600281. Cocrystal structure of an anti-parallel DNA g-quadruplex and a tetra-quinoline foldamer. 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU
5i2v DNA NMR Kerkour A, Marquevielle J, Ivashchenko S, Yatsunyk LA, Mergny JL, Salgado GF (2017) "High-resolution three-dimensional NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation." J. Biol. Chem., 292, 8082-8091. doi: 10.1074/jbc.M117.781906. NMR structure of a new g-quadruplex forming sequence within the kras proto-oncogene promoter region. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
5j05 DNA NMR Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. Diy g-quadruplexes: solution structure of d(gggtttgggttttgggaggg) in sodium. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-LwD+Ln), basket(2+2), UDDU
5j4p DNA NMR Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. Diy g-quadruplexes: solution structure of d(ggtttggttttggtttgg) in sodium. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU
5j4w DNA NMR Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. Diy g-quadruplexes: solution structure of d(ggtttggttttggttgg) in sodium. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU
5j6u DNA NMR Dvorkin SA, Karsisiotis AI, Webba da Silva M (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. Diy g-quadruplexes: solution structure of d(ggggtttggggttttggggaagggg) in sodium. 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-LwD+Ln), basket(2+2), UDDU
5lig DNA NMR Kotar A, Wang B, Shivalingam A, Gonzalez-Garcia J, Vilar R, Plavec J (2016) "NMR Structure of a Triangulenium-Based Long-Lived Fluorescence Probe Bound to a G-Quadruplex." Angew.Chem.Int.Ed.Engl., 55, 12508-12511. doi: 10.1002/anie.201606877. G-quadruplex formed at the 5'-end of nheiii_1 element in human c-myc promoter bound to triangulenium based fluorescence probe daota-m2. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
5lqg DNA NMR Galer P, Wang B, Sket P, Plavec J (2016) "Reversible pH Switch of Two-Quartet G-Quadruplexes Formed by Human Telomere." Angew.Chem.Int.Ed.Engl., 55, 1993-1997. doi: 10.1002/anie.201507569. A two-quartet g-quadruplex formed by human telomere in kcl solution at neutral ph. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU
5lqh DNA NMR Galer P, Wang B, Sket P, Plavec J (2016) "Reversible pH Switch of Two-Quartet G-Quadruplexes Formed by Human Telomere." Angew.Chem.Int.Ed.Engl., 55, 1993-1997. doi: 10.1002/anie.201507569. A two-quartet g-quadruplex formed by human telomere in kcl solution at ph 5.0. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+LnD-Lw), basket(2+2), UUDD
5ls8 DNA X-ray (1.78 Å) McQuaid K, Abell H, Gurung SP, Allan DR, Winter G, Sorensen T, Cardin DJ, Brazier JA, Cardin CJ, Hall JP (2019) "Structural Studies Reveal Enantiospecific Recognition of a DNA G-Quadruplex by a Ruthenium Polypyridyl Complex." Angew.Chem.Int.Ed.Engl., 58, 9881-9885. doi: 10.1002/anie.201814502. Light-activated ruthenium complex bound to a DNA quadruplex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD
5m2l DNA NMR Kocman V, Plavec J (2017) "Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions." Nat Commun, 8, 15355. doi: 10.1038/ncomms15355. Structure of DNA tetrameric agcga-quadruplex adopted by 15-mer d(gcgagggagcgaggg), vk34, oligonucleotide found in regulatory region of the plekhg3 human gene. 2 G-tetrads
5mbr DNA NMR Dickerhoff J, Haase L, Langel W, Weisz K (2017) "Tracing Effects of Fluorine Substitutions on G-Quadruplex Conformational Changes." ACS Chem. Biol., 12, 1308-1315. doi: 10.1021/acschembio.6b01096. Quadruplex with flipped tetrad formed by a human telomeric sequence. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU
5mcr DNA NMR Dickerhoff J, Haase L, Langel W, Weisz K (2017) "Tracing Effects of Fluorine Substitutions on G-Quadruplex Conformational Changes." ACS Chem. Biol., 12, 1308-1315. doi: 10.1021/acschembio.6b01096. Quadruplex with flipped tetrad formed by an artificial sequence. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-PD+Lw), U3D(3+1), UUUD
5mjx DNA NMR Lietard J, Abou Assi H, Gomez-Pinto I, Gonzalez C, Somoza MM, Damha MJ (2017) "Mapping the affinity landscape of Thrombin-binding aptamers on 2 F-ANA/DNA chimeric G-Quadruplex microarrays." Nucleic Acids Res., 45, 1619-1632. doi: 10.1093/nar/gkw1357. 2'f-ana-DNA chimeric tba quadruplex structure. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
5mta DNA NMR Juribasic Kulcsar M, Gabelica V, Plavec J "Stabilizing interactions in long-loop G-quadruplex formed within promoters of Plasmodium falciparum B var genes." G-quadruplex formed within promoters of plasmodium falciparum b var genes. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-PD+Lw), U3D(3+1), UUUD
5mtg DNA NMR Juribasic Kulcsar M, Gabelica V, Plavec J "Stabilizing interactions in long-loop G-quadruplex formed within promoters of Plasmodium falciparum B var genes." G-quadruplex formed within promoters of plasmodium falciparum b var genes - form i. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-PD+Lw), U3D(3+1), UUUD
5mvb DNA NMR Wirmer-Bartoschek J, Bendel LE, Jonker HRA, Grun JT, Papi F, Bazzicalupi C, Messori L, Gratteri P, Schwalbe H (2017) "Solution NMR Structure of a Ligand/Hybrid-2-G-Quadruplex Complex Reveals Rearrangements that Affect Ligand Binding." Angew. Chem. Int. Ed. Engl., 56, 7102-7106. doi: 10.1002/anie.201702135. Solution structure of a human g-quadruplex hybrid-2 form in complex with a gold-ligand.. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU
5nys DNA NMR Trajkovski M, Endoh T, Tateishi-Karimata H, Ohyama T, Tanaka S, Plavec J, Sugimoto N (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. doi: 10.1093/nar/gky250. M2 g-quadruplex dilute solution. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
5nyt DNA NMR Trajkovski M, Endoh T, Tateishi-Karimata H, Ohyama T, Tanaka S, Plavec J, Sugimoto N (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. doi: 10.1093/nar/gky250. M2 g-quadruplex 20 wt% ethylene glycol. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
5nyu DNA NMR Trajkovski M, Endoh T, Tateishi-Karimata H, Ohyama T, Tanaka S, Plavec J, Sugimoto N (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. doi: 10.1093/nar/gky250. M2 g-quadruplex 10 wt% peg8000. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
5o4d DNA NMR Marusic M, Plavec J (2019) "Towards Understanding of Polymorphism of the G-rich Region of Human Papillomavirus Type 52." Molecules, 24. doi: 10.3390/molecules24071294. G-quadruplex of human papillomavirus type 52. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD
5ob3 RNA X-ray (2.004 Å) Fernandez-Millan P, Autour A, Ennifar E, Westhof E, Ryckelynck M (2017) "Crystal structure and fluorescence properties of the iSpinach aptamer in complex with DFHBI." RNA, 23, 1788-1795. doi: 10.1261/rna.063008.117. Ispinach aptamer. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD
5oph DNA NMR Brcic J, Plavec J (2018) "NMR structure of a G-quadruplex formed by four d(G4C2) repeats: insights into structural polymorphism." Nucleic Acids Res., 46, 11605-11617. doi: 10.1093/nar/gky886. G-quadruplex structure of DNA oligonucleotide containing ggggcc repeats linked to als and ftd. 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-Lw-Ln-Lw), chair(2+2), UDUD
5ov2 DNA NMR Dickerhoff J, Weisz K (2017) "Nonconventional C-HF Hydrogen Bonds Support a Tetrad Flip in Modified G-Quadruplexes." J Phys Chem Lett, 8, 5148-5152. doi: 10.1021/acs.jpclett.7b02428. 2'f-ana-g modified quadruplex with a flipped tetrad. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-PD+Lw), U3D(3+1), UUUD
5ua3 DNA X-ray (1.8802 Å) Meier M, Moya-Torres A, Krahn NJ, McDougall MD, Orriss GL, McRae EKS, Booy EP, McEleney K, Patel TR, McKenna SA, Stetefeld J (2018) "Structure and hydrodynamics of a DNA G-quadruplex with a cytosine bulge." Nucleic Acids Res., 46, 5319-5331. doi: 10.1093/nar/gky307. Crystal structure of a DNA g-quadruplex with a cytosine bulge. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
5v3f RNA X-ray (1.7 Å) Trachman RJ, Demeshkina NA, Lau MWL, Panchapakesan SSS, Jeng SCY, Unrau PJ, Ferre-D'Amare AR (2017) "Structural basis for high-affinity fluorophore binding and activation by RNA Mango." Nat. Chem. Biol., 13, 807-813. doi: 10.1038/nchembio.2392. Co-crystal structure of the fluorogenic RNA mango. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
5vhe hydrolase X-ray (3.793 Å) Chen MC, Tippana R, Demeshkina NA, Murat P, Balasubramanian S, Myong S, Ferre-D'Amare AR (2018) "Structural basis of G-quadruplex unfolding by the DEAH/RHA helicase DHX36." Nature, 558, 465-469. doi: 10.1038/s41586-018-0209-9. Dhx36 in complex with the c-myc g-quadruplex. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
5w77 DNA-inhibitor NMR Calabrese DR, Chen X, Leon EC, Gaikwad SM, Phyo Z, Hewitt WM, Alden S, Hilimire TA, He F, Michalowski AM, Simmons JK, Saunders LB, Zhang S, Connors D, Walters KJ, Mock BA, Schneekloth Jr JS (2018) "Chemical and structural studies provide a mechanistic basis for recognition of the MYC G-quadruplex." Nat Commun, 9, 4229. doi: 10.1038/s41467-018-06315-w. Complex of DNA and compounds. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
5yey DNA NMR Liu C, Zhou B, Geng Y, Yan Tam D, Feng R, Miao H, Xu N, Shi X, You Y, Hong Y, Tang BZ, Kwan Lo P, Kuryavyi V, Zhu G (2019) "A chair-type G-quadruplex structure formed by a human telomeric variant DNA in K+solution." Chem Sci, 10, 218-226. doi: 10.1039/c8sc03813a. The structure of a chair-type g-quadruplex of the human telomeric variant in k+ solution. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+Ln+Lw+Ln), chair(2+2), UDUD
5z80 DNA NMR Liu W, Zhong YF, Liu LY, Shen CT, Zeng W, Wang F, Yang D, Mao ZW (2018) "Solution structures of multiple G-quadruplex complexes induced by a platinum(II)-based tripod reveal dynamic binding." Nat Commun, 9, 3496. doi: 10.1038/s41467-018-05810-4. Solution structure for the 1:1 complex of a platinum(ii)-based tripod bound to a hybrid-1 human telomeric g-quadruplex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+P+Lw+Ln), (3+1), UUDU
5z8f DNA NMR Liu W, Zhong YF, Liu LY, Shen CT, Zeng W, Wang F, Yang D, Mao ZW (2018) "Solution structures of multiple G-quadruplex complexes induced by a platinum(II)-based tripod reveal dynamic binding." Nat Commun, 9, 3496. doi: 10.1038/s41467-018-05810-4. Solution structure for the unique dimeric 4:2 complex of a platinum(ii)-based tripod bound to a hybrid-1 human telomeric g-quadruplex. 6 G-tetrads, 2 G4 helices, 2 G4 stems, 3(+P+Lw+Ln), (3+1), UUDU
5zev DNA NMR Liu Y, Lan W, Wang C, Cao C (2018) "A putative G-quadruplex structure in the proximal promoter ofVEGFR-2has implications for drug design to inhibit tumor angiogenesis." J. Biol. Chem., 293, 8947-8955. doi: 10.1074/jbc.RA118.002666. Solution structure of g-quadruplex formed in vegfr-2 proximal promoter sequence. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(D+PX), UD3(1+3), UDDD
6a7y DNA NMR Wan C, Fu W, Jing H, Zhang N (2019) "NMR solution structure of an asymmetric intermolecular leaped V-shape G-quadruplex: selective recognition of the d(G2NG3NG4) sequence motif by a short linear G-rich DNA probe." Nucleic Acids Res., 47, 1544-1556. doi: 10.1093/nar/gky1167. Solution structure of an intermolecular leaped v-shape g-quadruplex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, (1+3), UDDD
6a85 DNA X-ray (1.45 Å) Liu HH, Wang R, Yu X, Shen FS, Lan WX, Haruehanroengra P, Yao QQ, Zhang J, Chen YQ, Li SH, Wu BX, Zheng LN, Ma JB, Lin JZ, Cao CY, Li JX, Sheng J, Gan JH (2018) "High-resolution DNA quadruplex structure containing all the A-, G-, C-, T-tetrads." Nucleic Acids Res., 46, 11627-11638. doi: 10.1093/nar/gky902. Crystal structure of a novel DNA quadruplex. 8 G-tetrads, 2 G4 helices, 1 G4 stem, parallel(4+0), UUUU
6ac7 DNA NMR Sengar A, Vandana JJ, Chambers VS, Di Antonio M, Winnerdy FR, Balasubramanian S, Phan AT (2019) "Structure of a (3+1) hybrid G-quadruplex in the PARP1 promoter." Nucleic Acids Res., 47, 1564-1572. doi: 10.1093/nar/gky1179. Structure of a (3+1) hybrid g-quadruplex in the parp1 promoter. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU
6au4 DNA X-ray (2.35 Å) Stump S, Mou TC, Sprang SR, Natale NR, Beall HD (2018) "Crystal structure of the major quadruplex formed in the promoter region of the human c-MYC oncogene." PLoS ONE, 13, e0205584. doi: 10.1371/journal.pone.0205584. Crystal structure of the major quadruplex formed in the human c-myc promoter. 6 G-tetrads, 2 G4 helices, 2 G4 stems, 3(-P-P-P), parallel(4+0), UUUU
6b14 immune system-RNA X-ray (1.64 Å) Koirala D, Shelke SA, Dupont M, Ruiz S, DasGupta S, Bailey LJ, Benner SA, Piccirilli JA (2018) "Affinity maturation of a portable Fab-RNA module for chaperone-assisted RNA crystallography." Nucleic Acids Res., 46, 2624-2635. doi: 10.1093/nar/gkx1292. Crystal structure of spinach RNA aptamer in complex with fab bl3-6s97n. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD
6b3k immune system-RNA X-ray (2.09 Å) Koirala D, Shelke SA, Dupont M, Ruiz S, DasGupta S, Bailey LJ, Benner SA, Piccirilli JA (2018) "Affinity maturation of a portable Fab-RNA module for chaperone-assisted RNA crystallography." Nucleic Acids Res., 46, 2624-2635. doi: 10.1093/nar/gkx1292. Crystal structure of mutant spinach RNA aptamer in complex with fab bl3-6. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD
6c63 RNA X-ray (2.90002801531 Å) Trachman 3rd RJ, Abdolahzadeh A, Andreoni A, Cojocaru R, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. doi: 10.1021/acs.biochem.8b00399. Crystal structure of the mango-ii fluorescent aptamer bound to to1-biotin. 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
6c64 RNA X-ray (3.00014879601 Å) Trachman 3rd RJ, Abdolahzadeh A, Andreoni A, Cojocaru R, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. doi: 10.1021/acs.biochem.8b00399. Crystal structure of the mango-ii fluorescent aptamer bound to to3-biotin. 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
6c65 RNA X-ray (2.8000516274 Å) Trachman 3rd RJ, Abdolahzadeh A, Andreoni A, Cojocaru R, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. doi: 10.1021/acs.biochem.8b00399. Crystal structure of the mango-ii-a22u fluorescent aptamer bound to to1-biotin. 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
6ccw DNA NMR Lin C, Wu G, Wang K, Onel B, Sakai S, Shao Y, Yang D (2018) "Molecular Recognition of the Hybrid-2 Human Telomeric G-Quadruplex by Epiberberine: Insights into Conversion of Telomeric G-Quadruplex Structures." Angew. Chem. Int. Ed. Engl., 57, 10888-10893. doi: 10.1002/anie.201804667. Hybrid-2 form human telomeric g quadruplex in complex with epiberberine. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU
6e80 RNA X-ray (2.901 Å) Sjekloca L, Ferre-D'Amare AR (2019) "Binding between G Quadruplexes at the Homodimer Interface of the Corn RNA Aptamer Strongly Activates Thioflavin T Fluorescence." Cell Chem Biol, 26, 1159. doi: 10.1016/j.chembiol.2019.04.012. Crystal structure of the corn aptamer in unliganded state. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
6e81 RNA X-ray (2.721 Å) Sjekloca L, Ferre-D'Amare AR (2019) "Binding between G Quadruplexes at the Homodimer Interface of the Corn RNA Aptamer Strongly Activates Thioflavin T Fluorescence." Cell Chem Biol, 26, 1159. doi: 10.1016/j.chembiol.2019.04.012. Crystal structure of the corn aptamer in complex with tht. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
6e82 RNA X-ray (3.101 Å) Sjekloca L, Ferre-D'Amare AR (2019) "Binding between G Quadruplexes at the Homodimer Interface of the Corn RNA Aptamer Strongly Activates Thioflavin T Fluorescence." Cell Chem Biol, 26, 1159. doi: 10.1016/j.chembiol.2019.04.012. Crystal structure of the corn aptamer mutant a14u in complex with tht. 1 G-tetrad
6e84 RNA X-ray (2.901 Å) Sjekloca L, Ferre-D'Amare AR (2019) "Binding between G Quadruplexes at the Homodimer Interface of the Corn RNA Aptamer Strongly Activates Thioflavin T Fluorescence." Cell Chem Biol, 26, 1159. doi: 10.1016/j.chembiol.2019.04.012. Crystal structure of the corn aptamer in complex with to. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
6e8s RNA X-ray (2.35 Å) Trachman 3rd RJ, Autour A, Jeng SCY, Abdolahzadeh A, Andreoni A, Cojocaru R, Garipov R, Dolgosheina EV, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. doi: 10.1038/s41589-019-0267-9. Structure of the imango-iii aptamer bound to to1-biotin. 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-Lw), (3+1), UUUD
6e8t RNA X-ray (2.9 Å) Trachman 3rd RJ, Autour A, Jeng SCY, Abdolahzadeh A, Andreoni A, Cojocaru R, Garipov R, Dolgosheina EV, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. doi: 10.1038/s41589-019-0267-9. Structure of the mango-iii (a10u) aptamer bound to to1-biotin. 8 G-tetrads, 4 G4 helices, 4 G4 stems, 2(-P-Lw), hybrid-1(3+1), UUUD; 2(-P-P-Lw), (3+1), UUUD
6e8u RNA X-ray (1.55 Å) Trachman 3rd RJ, Autour A, Jeng SCY, Abdolahzadeh A, Andreoni A, Cojocaru R, Garipov R, Dolgosheina EV, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. doi: 10.1038/s41589-019-0267-9. Structure of the mango-iii (a10u) aptamer bound to to1-biotin. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-Lw), (3+1), UUUD
6eo6 hydrolase-DNA X-ray (1.69 Å) Dolot R, Lam CH, Sierant M, Zhao Q, Liu FW, Nawrot B, Egli M, Yang X (2018) "Crystal structures of thrombin in complex with chemically modified thrombin DNA aptamers reveal the origins of enhanced affinity." Nucleic Acids Res., 46, 4819-4830. doi: 10.1093/nar/gky268. X-ray structure of the complex between human alpha-thrombin and modified 15-mer DNA aptamer containing 5-(3-(2-(1h-indol-3-yl)acetamide-n-yl)-1-propen-1-yl)-2'-deoxyuridine residue. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
6eo7 hydrolase-DNA X-ray (2.24 Å) Dolot R, Lam CH, Sierant M, Zhao Q, Liu FW, Nawrot B, Egli M, Yang X (2018) "Crystal structures of thrombin in complex with chemically modified thrombin DNA aptamers reveal the origins of enhanced affinity." Nucleic Acids Res., 46, 4819-4830. doi: 10.1093/nar/gky268. X-ray structure of the complex between human alpha-thrombin and modified 15-mer DNA aptamer containing 5-(3-(acetamide-n-yl)-1-propen-1-yl)-2'-deoxyuridine residue. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
6erl DNA NMR Karg B, Weisz K (2018) "Loop Length Affects Syn-Anti Conformational Rearrangements in Parallel G-Quadruplexes." Chemistry. doi: 10.1002/chem.201801851. Quadruplex with flipped tetrad formed by the c-myc promoter sequence. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
6evv hydrolase X-ray (2.5 Å) Troisi R, Napolitano V, Spiridonova V, Russo Krauss I, Sica F (2018) "Several structural motifs cooperate in determining the highly effective anti-thrombin activity of NU172 aptamer." Nucleic Acids Res., 46, 12177-12185. doi: 10.1093/nar/gky990. X-ray structure of the complex between human alpha thrombin and nu172, a duplex-quadruplex 26-mer DNA aptamer, in the presence of potassium ions.. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
6f4z DNA NMR Dickerhoff J, Weisz K (2018) "Fluorine-Mediated Editing of a G-Quadruplex Folding Pathway." Chembiochem, 19, 927-930. doi: 10.1002/cbic.201800099. 2'f-arag modified quadruplex with flipped g-tract and central tetrad. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+LnD-Lw), basket(2+2), UUDD
6fc9 DNA NMR Santana A, Serrano I, Montalvillo-Jimenez L, Corzana F, Bastida A, Jimenez-Barbero J, Gonzalez C, Asensio JL "Minimalistic scaffolds for the selective recognition of Quad-ruplex-Duplex Junctions: Targeting the G4 Hot-Spot." The 1,8-bis(aminomethyl)anthracene and quadruplex-duplex junction complex. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
6ffr DNA-RNA hybrid NMR Haase L, Dickerhoff J, Weisz K (2018) "DNA-RNA Hybrid Quadruplexes Reveal Interactions that Favor RNA Parallel Topologies." Chemistry, 24, 15365-15371. doi: 10.1002/chem.201803367. DNA-RNA hybrid quadruplex with flipped tetrad. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-PD+Lw), U3D(3+1), UUUD
6fq2 DNA X-ray (2.31 Å) Bakalar B, Heddi B, Schmitt E, Mechulam Y, Phan AT (2019) "A Minimal Sequence for Left-Handed G-Quadruplex Formation." Angew. Chem. Int. Ed. Engl., 58, 2331-2335. doi: 10.1002/anie.201812628. Structure of minimal sequence for left -handed g-quadruplex formation. 4 G-tetrads, 1 G4 helix
6ftu DNA X-ray (2.95 Å) Guedin A, Lin LY, Armane S, Lacroix L, Mergny JL, Thore S, Yatsunyk LA (2018) "Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome." Nucleic Acids Res., 46, 5297-5307. doi: 10.1093/nar/gky290. Structure of a quadruplex forming sequence from d. discoideum. 28 G-tetrads, 7 G4 helices, 7 G4 stems, 4(+Ln-Lw), (2+2), UUDD; 4(+LnD), basket(2+2), UUDD; 4(+LnD-Lw), basket(2+2), UUDD
6ge1 RNA NMR Andralojc W, Malgowska M, Sarzynska J, Pasternak K, Szpotkowski K, Kierzek R, Gdaniec Z (2019) "Unraveling the structural basis for the exceptional stability of RNA G-quadruplexes capped by a uridine tetrad at the 3' terminus." RNA, 25, 121-134. doi: 10.1261/rna.068163.118. Solution structure of the r(ugguggu)4 RNA quadruplex. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/5'
6gh0 DNA NMR Kotar A, Rigo R, Sissi C, Plavec J (2019) "Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure." Nucleic Acids Res., 47, 2641-2653. doi: 10.1093/nar/gky1269. Two-quartet kit* g-quadruplex is formed via double-stranded pre-folded structure. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-Lw-Ln-Lw), chair(2+2), UDUD
6gn7 hydrolase X-ray (2.8 Å) Troisi R, Napolitano V, Spiridonova V, Russo Krauss I, Sica F (2018) "Several structural motifs cooperate in determining the highly effective anti-thrombin activity of NU172 aptamer." Nucleic Acids Res., 46, 12177-12185. doi: 10.1093/nar/gky990. X-ray structure of the complex between human alpha thrombin and nu172, a duplex-quadruplex 26-mer DNA aptamer, in the presence of sodium ions.. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
6gz6 DNA X-ray (2.006 Å) Bakalar B, Heddi B, Schmitt E, Mechulam Y, Phan AT (2019) "A Minimal Sequence for Left-Handed G-Quadruplex Formation." Angew.Chem.Int.Ed.Engl., 58, 2331-2335. doi: 10.1002/anie.201812628. Structure of a left-handed g-quadruplex. 4 G-tetrads, 1 G4 helix
6gzn DNA NMR Lenarcic Zivkovic M, Rozman J, Plavec J (2018) "Adenine-Driven Structural Switch from a Two- to Three-Quartet DNA G-Quadruplex." Angew. Chem. Int. Ed. Engl., 57, 15395-15399. doi: 10.1002/anie.201809328. Adenine-driven structural switch from two- to three-quartet DNA g-quadruplex. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU
6h1k DNA NMR Butovskaya E, Heddi B, Bakalar B, Richter SN, Phan AT (2018) "Major G-Quadruplex Form of HIV-1 LTR Reveals a (3 + 1) Folding Topology Containing a Stem-Loop." J. Am. Chem. Soc., 140, 13654-13662. doi: 10.1021/jacs.8b05332. The major g-quadruplex form of hiv-1 ltr. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(D+PX), UD3(1+3), UDDD
6h5r DNA X-ray (2.0 Å) Guarra F, Marzo T, Ferraroni M, Papi F, Bazzicalupi C, Gratteri P, Pescitelli G, Messori L, Biver T, Gabbiani C (2018) "Interaction of a gold(i) dicarbene anticancer drug with human telomeric DNA G-quadruplex: solution and computationally aided X-ray diffraction analysis." Dalton Trans, 47, 16132-16138. doi: 10.1039/c8dt03607a. Structure of the complex of a human telomeric DNA with bis(1-butyl-3-methyl-imidazole-2-ylidene) gold(i). 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
6ia0 DNA NMR Bielskute S, Plavec J, Podbevsek P (2019) "Impact of Oxidative Lesions on the Human Telomeric G-Quadruplex." J. Am. Chem. Soc., 141, 2594-2603. doi: 10.1021/jacs.8b12748. Human telomeric g-quadruplex with 8-oxo-g substitution in the central g-quartet. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU
6ia4 DNA NMR Bielskute S, Plavec J, Podbevsek P (2019) "Impact of Oxidative Lesions on the Human Telomeric G-Quadruplex." J. Am. Chem. Soc., 141, 2594-2603. doi: 10.1021/jacs.8b12748. Human telomeric g-quadruplex with 8-oxo-g substitution in the outer g-quartet. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU
6ims DNA NMR Jing HT, Fu WQ, Wan CJ, Zhang N "Antiparallel tetrameric G-quadruplex with alternating strand orientations assembled by single-repeat of human telomeric DNA d(GGGTTA) in K+ or Na+ solution." NMR structure of an alternating antiparallel tetrameric g-quadruplex assembled by the single-repeat of human telomeric DNA d(gggtta). 3 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD
6ip3 DNA X-ray (1.4 Å) Nuthanakanti A, Ahmed I, Khatik SY, Saikrishnan K, Srivatsan SG (2019) "Probing G-quadruplex topologies and recognition concurrently in real time and 3D using a dual-app nucleoside probe." Nucleic Acids Res., 47, 6059-6072. doi: 10.1093/nar/gkz419. Structure of human telomeric DNA at 1.4 angstroms resolution. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
6ip7 DNA X-ray (1.55 Å) Nuthanakanti A, Ahmed I, Khatik SY, Saikrishnan K, Srivatsan SG (2019) "Probing G-quadruplex topologies and recognition concurrently in real time and 3D using a dual-app nucleoside probe." Nucleic Acids Res., 47, 6059-6072. doi: 10.1093/nar/gkz419. Structure of human telomeric DNA with 5-selenophene-modified deoxyuridine at residue 11. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P), parallel(4+0), UUUU
6isw DNA X-ray (2.3 Å) Nuthanakanti A, Ahmed I, Khatik SY, Saikrishnan K, Srivatsan SG (2019) "Probing G-quadruplex topologies and recognition concurrently in real time and 3D using a dual-app nucleoside probe." Nucleic Acids Res., 47, 6059-6072. doi: 10.1093/nar/gkz419. Structure of human telomeric DNA with 5-selenophene-modified deoxyuridine at residue 12. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P), parallel(4+0), UUUU
6jcd DNA NMR Truong THA, Winnerdy FR, Phan AT (2019) "An Unprecedented Knot-like G-Quadruplex Peripheral Motif." Angew.Chem.Int.Ed.Engl., 58, 13834-13839. doi: 10.1002/anie.201907740. G-quadruplex peripheral knot. 2 G-tetrads, 1 G4 helix
6jce DNA NMR Winnerdy FR, Bakalar B, Maity A, Vandana JJ, Mechulam Y, Schmitt E, Phan AT (2019) "NMR solution and X-ray crystal structures of a DNA molecule containing both right- and left-handed parallel-stranded G-quadruplexes." Nucleic Acids Res., 47, 8272-8281. doi: 10.1093/nar/gkz349. NMR solution and x-ray crystal structures of a DNA containing both right-and left-handed parallel-stranded g-quadruplexes. 4 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
6jj0 DNA NMR Liu W, Lin C, Wu G, Dai J, Chang TC, Yang D (2019) "Structures of 1:1 and 2:1 complexes of BMVC and MYC promoter G-quadruplex reveal a mechanism of ligand conformation adjustment for G4-recognition." Nucleic Acids Res., 47, 11931-11942. doi: 10.1093/nar/gkz1015. NMR structure of the 1:1 complex of a carbazole derivative bmvc bound to c-myc g-quadruplex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
6jje DNA X-ray (1.378 Å) Zhang YS, Parkinson GN, Wagner A, Wei DG "Crystal structure of a two-quartet DNA mixed-parallel/antiparallel G-quadruplex (BrU)." Crystal structure of a two-quartet DNA mixed-parallel-antiparallel g-quadruplex (bru). 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, (2+2), UDUD; parallel(4+0), UUUU, coaxial interfaces: mixed
6jjf DNA X-ray (1.47 Å) Zhang Y, El Omari K, Duman R, Liu S, Haider S, Wagner A, Parkinson GN, Wei D (2020) "Native de novo structural determinations of non-canonical nucleic acid motifs by X-ray crystallography at long wavelengths." Nucleic Acids Res., 48, 9886-9898. doi: 10.1093/nar/gkaa439. Crystal structure of a two-quartet DNA mixed-parallel-antiparallel g-quadruplex. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, (2+2), UDUD; parallel(4+0), UUUU, coaxial interfaces: mixed
6jjg DNA X-ray (1.969 Å) Zhang YS, Parkinson GN, Wagner A, Wei DG "Crystal structure of a two-quartet DNA mixed-parallel/antiparallel G-quadruplex." Crystal structure of a two-quartet DNA mixed-parallel-antiparallel g-quadruplex. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, (2+2), UDUD; parallel(4+0), UUUU, coaxial interfaces: mixed
6jjh RNA X-ray (1.74 Å) Zhang Y, El Omari K, Duman R, Liu S, Haider S, Wagner A, Parkinson GN, Wei D (2020) "Native de novo structural determinations of non-canonical nucleic acid motifs by X-ray crystallography at long wavelengths." Nucleic Acids Res., 48, 9886-9898. doi: 10.1093/nar/gkaa439. Crystal structure of a two-quartet RNA parallel g-quadruplex complexed with the porphyrin tmpyp4. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/5'
6jji RNA X-ray (3.1 Å) Zhang Y, El Omari K, Duman R, Liu S, Haider S, Wagner A, Parkinson GN, Wei D (2020) "Native de novo structural determinations of non-canonical nucleic acid motifs by X-ray crystallography at long wavelengths." Nucleic Acids Res., 48, 9886-9898. doi: 10.1093/nar/gkaa439. Crystal structure of a two-quartet RNA parallel g-quadruplex complexed with the porphyrin tmpyp4 (1:1). 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/5'
6jkn DNA X-ray (1.401 Å) Geng Y, Liu C, Zhou B, Cai Q, Miao H, Shi X, Xu N, You Y, Fung CP, Din RU, Zhu G (2019) "The crystal structure of an antiparallel chair-type G-quadruplex formed by Bromo-substituted human telomeric DNA." Nucleic Acids Res., 47, 5395-5404. doi: 10.1093/nar/gkz221. Crystal structure of g-quadruplex formed by bromo-substituted human telomeric DNA. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-Lw), chair(2+2), UDUD
6jwd DNA NMR Wang F, Wang C, Liu Y, Lan W, Han H, Wang R, Huang S, Cao C (2020) "Colchicine selective interaction with oncogene RET G-quadruplex revealed by NMR." Chem.Commun.(Camb.), 56, 2099-2102. doi: 10.1039/d0cc00221f. Structure of ret g-quadruplex in complex with berberine. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
6jwe DNA NMR Wang F, Wang C, Liu Y, Lan W, Han H, Wang R, Huang S, Cao C (2020) "Colchicine selective interaction with oncogene RET G-quadruplex revealed by NMR." Chem.Commun.(Camb.), 56, 2099-2102. doi: 10.1039/d0cc00221f. Structure of ret g-quadruplex in complex with colchicine. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
6k3x DNA NMR Winnerdy FR, Das P, Heddi B, Phan AT (2019) "Solution Structures of a G-Quadruplex Bound to Linear- and Cyclic-Dinucleotides." J.Am.Chem.Soc., 141, 18038-18047. doi: 10.1021/jacs.9b05642. G-quadruplex complex with linear dinucleotide d(ag). 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
6k3y DNA NMR Winnerdy FR, Das P, Heddi B, Phan AT (2019) "Solution Structures of a G-Quadruplex Bound to Linear- and Cyclic-Dinucleotides." J.Am.Chem.Soc., 141, 18038-18047. doi: 10.1021/jacs.9b05642. G-quadruplex complex with cyclic dinucleotide 3'-3' cgamp. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
6k84 RNA NMR Mashima T, Lee JH, Kamatari YO, Hayashi T, Nagata T, Nishikawa F, Nishikawa S, Kinoshita M, Kuwata K, Katahira M (2020) "Development and structural determination of an anti-PrPCaptamer that blocks pathological conformational conversion of prion protein." Sci Rep, 10, 4934. doi: 10.1038/s41598-020-61966-4. Structure of anti-prion RNA aptamer. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
6kfi DNA NMR Liu LY, Liu W, Wang KN, Zhu BC, Xia XY, Ji LN, Mao ZW (2020) "Quantitative Detection of G-Quadruplex DNA in Live Cells Based on Photon Counts and Complex Structure Discrimination." Angew.Chem.Int.Ed.Engl., 59, 9719-9726. doi: 10.1002/anie.202002422. NMR solution structure of the 1:1 complex of tel26 g-quadruplex and a tripodal cationic fluorescent probe nbte. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+P+Lw+Ln), (3+1), UUDU
6kfj DNA NMR Liu LY, Liu W, Wang KN, Zhu BC, Xia XY, Ji LN, Mao ZW (2020) "Quantitative Detection of G-Quadruplex DNA in Live Cells Based on Photon Counts and Complex Structure Discrimination." Angew.Chem.Int.Ed.Engl., 59, 9719-9726. doi: 10.1002/anie.202002422. NMR solution structure of the 1:1 complex of wttel26 g-quadruplex and a tripodal cationic fluorescent probe nbte. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU
6kfl DNA X-ray (1.92 Å) Zhang YS, Parkinson GN, Wei DG "Crystal structure of a two-quartet DNA G-quadruplex complexed with the porphyrin TMPyP4." Crystal structure of a two-quartet DNA g-quadruplex complexed with the porphyrin tmpyp4. 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, (2+2), UDUD; parallel(4+0), UUUU, coaxial interfaces: mixed
6kn4 DNA NMR Barthwal R, Raje S, Pandav K (2020) "Structural basis for stabilization of human telomeric G-quadruplex [d-(TTAGGGT)]4by anticancer drug adriamycin." J.Biomol.Struct.Dyn., 1-21. doi: 10.1080/07391102.2020.1730969. Human parallel stranded 7-mer g-quadruplex complexed with 2 adriamycin (dm2) molecules. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
6kvb DNA NMR Maity A, Winnerdy FR, Chang WD, Chen G, Phan AT (2020) "Intra-locked G-quadruplex structures formed by irregular DNA G-rich motifs." Nucleic Acids Res., 48, 3315-3327. doi: 10.1093/nar/gkaa008. Structure of an intra-locked g-quadruplex. 4 G-tetrads, 1 G4 helix
6kxz DNA NMR Barthwal R, Raje S, Pandav K "HUMAN PARALLEL STRANDED 7-MER G-QUADRUPLEX COMPLEXED WITH 2 EPIRUBICIN (DM6) MOLECULES." Human parallel stranded 7-mer g-quadruplex complexed with 2 epirubicin (epi) molecules. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
6l8m DNA NMR Wang ZF, Li MH, Chu IT, Winnerdy FR, Phan AT, Chang TC (2020) "Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter." Nucleic Acids Res., 48, 1120-1130. doi: 10.1093/nar/gkz1207. Wnt DNA promoter mutant g-quadruplex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD
6l92 DNA NMR Wang ZF, Li MH, Chu IT, Winnerdy FR, Phan AT, Chang TC (2020) "Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter." Nucleic Acids Res., 48, 1120-1130. doi: 10.1093/nar/gkz1207. A basket type g-quadruplex in wnt DNA promoter. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+LnD-P), (3+1), UUUD
6ldm DNA binding protein-DNA X-ray (2.4 Å) Traczyk A, Liew CW, Gill DJ, Rhodes D (2020) "Structural basis of G-quadruplex DNA recognition by the yeast telomeric protein Rap1." Nucleic Acids Res., 48, 4562-4571. doi: 10.1093/nar/gkaa171. Structural basis of g-quadruplex DNA recognition by the yeast telomeric protein rap1. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
6n65 DNA X-ray (1.6 Å) Ou A, Schmidberger JW, Wilson KA, Evans CW, Hargreaves JA, Grigg M, O'Mara ML, Iyer KS, Bond CS, Smith NM (2020) "High resolution crystal structure of a KRAS promoter G-quadruplex reveals a dimer with extensive poly-A pi-stacking interactions for small-molecule recognition." Nucleic Acids Res., 48, 5766-5776. doi: 10.1093/nar/gkaa262. Kras g-quadruplex g16t mutant.. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
6neb DNA NMR Dickerhoff J, Onel B, Chen L, Chen Y, Yang D (2019) "Solution Structure of a MYC Promoter G-Quadruplex with 1:6:1 Loop Length." Acs Omega, 4, 2533-2539. doi: 10.1021/acsomega.8b03580. Myc promoter g-quadruplex with 1:6:1 loop length. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
6o2l DNA NMR Liu W, Lin C, Wu G, Dai J, Chang TC, Yang D (2019) "Structures of 1:1 and 2:1 complexes of BMVC and MYC promoter G-quadruplex reveal a mechanism of ligand conformation adjustment for G4-recognition." Nucleic Acids Res., 47, 11931-11942. doi: 10.1093/nar/gkz1015. NMR structure of the 2:1 complex of a carbazole derivative bmvc bound to c-myc g-quadruplex. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
6p45 DNA X-ray (2.339 Å) Yatsunyk LA, Lin LY, Powell B "Biophysical and X-ray structural characterization of the (GGGTT)3GGG G-quadruplex in complex with N-methylmesoporphryin IX." Crystal structure of the g-quadruplex formed by (tgggt)4 in complex with n-methylmesoporphryin ix. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
6pnk DNA X-ray (2.39 Å) Yatsunyk LA, Lin LY "Biophysical and X-ray structural characterization of the (GGGTT)3GGG G-quadruplex in complex with N-methylmesoporphryin IX." Crystal structure of the g-quadruplex formed by (gggtt)3ggg in complex with n-methylmesoporphryin ix. 6 G-tetrads, 2 G4 helices, 2 G4 stems, 3(-P-P), parallel(4+0), UUUU; 3(-P-P-P), parallel(4+0), UUUU
6pq7 RNA X-ray (3.0 Å) Trachman III RJ, Stagno JR, Conrad C, Jones CP, Fischer P, Meents A, Wang YX, Ferre-D'Amare AR (2019) "Co-crystal structure of the iMango-III fluorescent RNA aptamer using an X-ray free-electron laser." Acta Crystallogr.,Sect.F, 75, 547-551. doi: 10.1107/S2053230X19010136. Structure of the imango-iii fluorescent aptamer at room temperature.. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-Lw), (3+1), UUUD
6q6r DNA binding protein X-ray (1.5 Å) Heddi B, Cheong VV, Schmitt E, Mechulam Y, Phan AT (2020) "Recognition of different base tetrads by RHAU (DHX36): X-ray crystal structure of the G4 recognition motif bound to the 3'-end tetrad of a DNA G-quadruplex." J.Struct.Biol., 209, 107399. doi: 10.1016/j.jsb.2019.10.001. Recognition of different base tetrads by rhau: x-ray crystal structure of g4 recognition motif bound to the 3-end tetrad of a DNA g-quadruplex. 12 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
6qjo DNA X-ray (1.8 Å) Winnerdy FR, Bakalar B, Maity A, Vandana JJ, Mechulam Y, Schmitt E, Phan AT (2019) "NMR solution and X-ray crystal structures of a DNA molecule containing both right- and left-handed parallel-stranded G-quadruplexes." Nucleic Acids Res., 47, 8272-8281. doi: 10.1093/nar/gkz349. DNA containing both right- and left-handed parallel-stranded g-quadruplexes. 16 G-tetrads, 4 G4 helices, 4 G4 stems, 2(-P-P-P), parallel(4+0), UUUU
6r9k DNA NMR Karg B, Mohr S, Weisz K (2019) "Duplex-Guided Refolding into Novel G-Quadruplex (3+1) Hybrid Conformations." Angew.Chem.Int.Ed.Engl., 58, 11068-11071. doi: 10.1002/anie.201905372. A quadruplex hybrid structure with lpp loop orientation and 3 syn residues. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+Ln+P+P), hybrid-1R(1+3), UDDD
6r9l DNA NMR Karg B, Mohr S, Weisz K (2019) "Duplex-Guided Refolding into Novel G-Quadruplex (3+1) Hybrid Conformations." Angew.Chem.Int.Ed.Engl., 58, 11068-11071. doi: 10.1002/anie.201905372. A quadruplex hybrid structure with lpp loop orientation and 5 syn residues. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+Ln+P+P), hybrid-1R(1+3), UDDD
6rnl DNA X-ray (1.88 Å) McQuaid K, Hall JP, Baumgaertner L, Cardin DJ, Cardin CJ (2019) "Three thymine/adenine binding modes of the ruthenium complex Lambda-[Ru(TAP)2(dppz)]2+to the G-quadruplex forming sequence d(TAGGGTT) shown by X-ray crystallography." Chem.Commun.(Camb.), 55, 9116-9119. doi: 10.1039/c9cc04316k. L-[ru(tap)2(dppz)]2+ bound to the g-quadruplex forming sequence d(tagggtt). 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
6rs3 DNA NMR Haase L, Dickerhoff J, Weisz K (2020) "Sugar Puckering Drives G-Quadruplex Refolding: Implications for V-Shaped Loops." Chemistry, 26, 524-533. doi: 10.1002/chem.201904044. 2'-f-riboguanosine modified g-quadruplex with v-loop. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD
6s15 DNA X-ray (1.7 Å) Papi F, Bazzicalupi C, Ferraroni M, Ciolli G, Lombardi P, Khan AY, Kumar GS, Gratteri P (2020) "Pyridine Derivative of the Natural Alkaloid Berberine as Human Telomeric G4-DNA Binder: A Solution and Solid-State Study." Acs Med.Chem.Lett., 11, 645-650. doi: 10.1021/acsmedchemlett.9b00516. Pyridine derivative of the natural alkaloid berberine as human telomeric g-quadruplex binder. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
6suu DNA NMR Marquevielle J, Robert C, Lagrabette O, Wahid M, Bourdoncle A, Xodo LE, Mergny JL, Salgado GF (2020) "Structure of two G-quadruplexes in equilibrium in the KRAS promoter." Nucleic Acids Res., 48, 9336-9345. doi: 10.1093/nar/gkaa387. NMR structure of kras32r g9t conformer g-quadruplex within kras promoter region. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
6sx6 DNA NMR Pavc D, Wang B, Spindler L, Drevensek-Olenik I, Plavec J, Sket P (2020) "GC ends control topology of DNA G-quadruplexes and their cation-dependent assembly." Nucleic Acids Res., 48, 2749-2761. doi: 10.1093/nar/gkaa058. Guanine-rich oligonucleotide with 5'-gc end form g-quadruplex with a(gggg)a hexad, gcgc- and g-quartets and two symmetric gg and aa base pairs. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
6syk DNA NMR Pavc D, Wang B, Spindler L, Drevensek-Olenik I, Plavec J, Sket P (2020) "GC ends control topology of DNA G-quadruplexes and their cation-dependent assembly." Nucleic Acids Res., 48, 2749-2761. doi: 10.1093/nar/gkaa058. Guanine-rich oligonucleotide with 5'- and 3'-gc ends form g-quadruplex with a(gggg)a hexad, gcgc- and g-quartets and two symmetric gg and aa base pair. 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU
6t2g DNA NMR Marquevielle J, Robert C, Lagrabette O, Wahid M, Bourdoncle A, Xodo LE, Mergny JL, Salgado GF (2020) "Structure of two G-quadruplexes in equilibrium in the KRAS promoter." Nucleic Acids Res., 48, 9336-9345. doi: 10.1093/nar/gkaa387. NMR structure of kras32r g25t conformer g-quadruplex within kras promoter region. 2 G-tetrads
6t51 DNA NMR Marquevielle J, Kumar MVV, Mergny JL, Salgado GF (2018) "1H,13C, and15N chemical shift assignments of a G-quadruplex forming sequence within the KRAS proto-oncogene promoter region." Biomol.Nmr Assign., 12, 123-127. doi: 10.1007/s12104-017-9793-0. NMR structure of kras22rt g-quadruplex forming within kras promoter region at physological temperature. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
6tc8 DNA NMR Haase L, Weisz K (2020) "Switching the type of V-loop in sugar-modified G-quadruplexes through altered fluorine interactions." Chem.Commun.(Camb.), 56, 4539-4542. doi: 10.1039/d0cc01285h. 2'-f-arabinoguanosine and 2'-f-riboguanosine modified hybrid type g-quadruplex with v-loop. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD
6tcg DNA NMR Haase L, Weisz K (2020) "Switching the type of V-loop in sugar-modified G-quadruplexes through altered fluorine interactions." Chem.Commun.(Camb.), 56, 4539-4542. doi: 10.1039/d0cc01285h. 2'-f-riboguanosine and 2'-f-arabinoguanosine modified g-quadruplex with v-loop and all-syn g-tract. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD
6tzq DNA X-ray (2.29 Å) Chu B, Zhang D, Paukstelis PJ (2019) "A DNA G-quadruplex/i-motif hybrid." Nucleic Acids Res., 47, 11921-11930. doi: 10.1093/nar/gkz1008. A DNA g-quadruplex-i-motif hybrid. 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD
6tzr DNA X-ray (2.4 Å) Chu B, Zhang D, Paukstelis PJ (2019) "A DNA G-quadruplex/i-motif hybrid." Nucleic Acids Res., 47, 11921-11930. doi: 10.1093/nar/gkz1008. A DNA g-quadruplex-i-motif hybrid. 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD
6up0 RNA X-ray (2.8 Å) Trachman RJ, Ferre-D'Amare AR "RNA aptamer FRET pair." Structure of the mango-iii fluorescent aptamer bound to yo3-biotin. 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-Lw), (3+1), UUUD
6v0l DNA NMR Wang KB, Dickerhoff J, Wu G, Yang D (2020) "PDGFR-beta Promoter Forms a Vacancy G-Quadruplex that Can Be Filled in by dGMP: Solution Structure and Molecular Recognition of Guanine Metabolites and Drugs." J.Am.Chem.Soc., 142, 5204-5211. doi: 10.1021/jacs.9b12770. Pdgfr-b promoter forms a g-vacancy quadruplex that can be complemented by dgmp: molecular structure and recognition of guanine derivatives and metabolites. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
6v9b RNA X-ray (2.4 Å) Trachman 3rd RJ, Cojocaru R, Wu D, Piszczek G, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2020) "Structure-Guided Engineering of the Homodimeric Mango-IV Fluorescence Turn-on Aptamer Yields an RNA FRET Pair." Structure, 28, 776-785.e3. doi: 10.1016/j.str.2020.04.007. Co-crystal structure of the fluorogenic mango-iv homodimer bound to to1-biotin. 6 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU
6v9d RNA X-ray (2.8 Å) Trachman 3rd RJ, Cojocaru R, Wu D, Piszczek G, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR (2020) "Structure-Guided Engineering of the Homodimeric Mango-IV Fluorescence Turn-on Aptamer Yields an RNA FRET Pair." Structure, 28, 776-785.e3. doi: 10.1016/j.str.2020.04.007. Co-crystal structure of the fluorogenic mango-iv homodimer bound to to1-biotin. 6 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU
6wck DNA X-ray (1.801 Å) Ou A, Schmidberger JW, Wilson KA, Evans CW, Hargreaves JA, Grigg M, O'Mara ML, Iyer KS, Bond CS, Smith NM (2020) "High resolution crystal structure of a KRAS promoter G-quadruplex reveals a dimer with extensive poly-A pi-stacking interactions for small-molecule recognition." Nucleic Acids Res., 48, 5766-5776. doi: 10.1093/nar/gkaa262. Kras g-quadruplex g16t mutant with bromo uracil replacing t8 and t16.. 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'
6ycv DNA NMR Haase L, Weisz K (2020) "Locked nucleic acid building blocks as versatile tools for advanced G-quadruplex design." Nucleic Acids Res., 48, 10555-10566. doi: 10.1093/nar/gkaa720. 2'-f-riboguanosine and lna modified hybrid type g-quadruplex with v-loop. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD
6yep DNA NMR Haase L, Weisz K (2020) "Locked nucleic acid building blocks as versatile tools for advanced G-quadruplex design." Nucleic Acids Res., 48, 10555-10566. doi: 10.1093/nar/gkaa720. Lna modified g-quadruplex with flipped g-tract and central tetrad. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+LnD-Lw), basket(2+2), UUDD
6zl2 DNA NMR Vianney YM, Preckwinkel P, Mohr S, Weisz K (2020) "Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands." Chemistry. doi: 10.1002/chem.202003540. Structure of a parallel c-myc modified with 3' duplex stem-loop overhang. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
6zl9 DNA NMR Vianney YM, Preckwinkel P, Mohr S, Weisz K (2020) "Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands." Chemistry. doi: 10.1002/chem.202003540. Structure of a parallel c-myc modified with 5' duplex stem-loop overhang. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU
6zte DNA NMR Vianney YM, Preckwinkel P, Mohr S, Weisz K (2020) "Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands." Chemistry. doi: 10.1002/chem.202003540. Structure of a parallel c-myc modified with 5' duplex stem-loop and 3' diagonal snap-back loop. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
7cls DNA NMR Ngoc Nguyen TQ, Lim KW, Phan AT (2020) "Duplex formation in a G-quadruplex bulge." Nucleic Acids Res., 48, 10567-10575. doi: 10.1093/nar/gkaa738. Solution structure of an intramolecular g-quadruplex containing a duplex bulge. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU
7cv3 DNA NMR Tan DJY, Winnerdy FR, Lim KW, Phan AT (2020) "Coexistence of two quadruplex-duplex hybrids in the PIM1 gene." Nucleic Acids Res. doi: 10.1093/nar/gkaa752. Quadruplex-duplex hybrid structure in the pim1 gene, form 1. 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU
7cv4 DNA NMR Tan DJY, Winnerdy FR, Lim KW, Phan AT (2020) "Coexistence of two quadruplex-duplex hybrids in the PIM1 gene." Nucleic Acids Res. doi: 10.1093/nar/gkaa752. Quadruplex-duplex hybrid structure in the pim1 gene, form 2. 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD
pdb id class method authors reference annotation