List of 313 G4 structures auto-curated with DSSR from the PDB

Last updated on 2019-07-11 by Xiang-Jun Lu <xiangjun@x3dna.org>


Toggle column:    pdb_id · category · method · annotation · reference · authors · abstract
pdb_id category method annotation reference authors abstract
139d DNA NMR SOLUTION STRUCTURE OF A PARALLEL-STRANDED G-QUADRUPLEX DNA; 3Dmol view (1993) "Solution structure of a parallel-stranded G-quadruplex DNA." J.Mol.Biol., 234, 1171-1183. pubmed Wang, Y., Patel, D.J. This paper reports on the solution structure of a parallel-stranded G-quadruplex formed by the Tetrahymena telomeric sequence d(T-T-G-G-G-G-T) whose NMR parameters in potassium cation containing solution were previously published from our laboratory. The structure was determined by combining a quantitative analysis of the NMR data with molecular dynamics calculations including relaxation matrix refinement. The combined NMR-computational approach yielded a set of seven distance-refined structures with pairwise RMSDs ranging from 0.66 to 1.30 A for the central G-G-G-G tetranucleotide segment. Four of the seven structures were refined further using complete relaxation-matrix calculations to yield solution structures with pairwise RMSDs ranging from 0.64 to 1.04 A for the same tetranucleotide segment. The R-factors also decreased on proceeding from the distance-refined to relaxation matrix-refined structures. The four strands of the G-quadruplex are aligned in parallel and are related by a 4-fold symmetry axis coincident with the helix axis. Individual guanines from each strand form planar G.G.G.G tetrad arrangements with each tetrad stabilized by eight hydrogen bonds involving the Watson-Crick and Hoogsteen edges of the guanine bases. All guanines adopt anti glycosidic torsion angles and S type sugar puckers in this right-handed parallel-stranded G-quadruplex structure. The four G.G.G.G tetrad planes stack on each other with minimal overlap of adjacent guanine base planes within individual strands. The thymine residues are under-defined in the solution structure of the d(T-T-G-G-G-G-T) G-quadruplex and sample amongst multiple conformations in solution.
143d DNA NMR SOLUTION STRUCTURE OF THE HUMAN TELOMERIC REPEAT D(AG3[T2AG3]3) OF THE G-QUADRUPLEX; 3Dmol view (1993) "Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex." Structure, 1, 263-282. pubmed Wang, Y., Patel, D.J. BACKGROUND: Repeats of Gn sequences are detected as single strand overhangs at the ends of eukaryotic chromosomes together with associated binding proteins. Such telomere sequences have been implicated in the replication and maintenance of chromosomal termini. They may also mediate chromosomal organization and association during meiosis and mitosis.
RESULTS: We have determined the three-dimensional solution structure of the human telomere sequence, d[AG3(T2AG3)3] in Na(+)-containing solution using a combined NMR, distance geometry and molecular dynamics approach (including relaxation matrix refinement). The sequence, which contains four AG3 repeats, folds intramolecularly into a G-tetraplex stabilized by three stacked G-tetrads which are connected by two lateral loops and a central diagonal loop. Of the four grooves that are formed, one is wide, two are of medium width and one is narrow. The alignment of adjacent G-G-G segments in parallel generates the two grooves of medium width whilst the antiparallel arrangement results in one wide and one narrow groove. Three of the four adenines stack on top of adjacent G-tetrads while the majority of the thymines sample multiple conformations.
CONCLUSIONS: The availability of the d[AG3(T2AG3)3] solution structure containing four AG3 human telomeric repeats should permit the rational design of ligands that recognize and bind with specificity and affinity to the individual grooves of the G-tetraplex, as well as to either end containing the diagonal and lateral loops. Such ligands could modulate the equilibrium between folded G-tetraplex structures and their unfolded extended counterparts.
148d DNA NMR THREE-DIMENSIONAL SOLUTION STRUCTURE OF THE THROMBIN BINDING DNA APTAMER D(GGTTGGTGTGGTTGG); 3Dmol view (1994) "Three-dimensional solution structure of the thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG)." J.Mol.Biol., 235, 1532-1547. pubmed Schultze, P., Macaya, R.F., Feigon, J. The DNA oligonucleotide d(GGTTGGTGTGGTTGG) (thrombin aptamer) binds to thrombin and inhibits its enzymatic activity in the chain of reactions that lead to blood clotting. Two-dimensional 1H NMR studies indicate that the oligonucleotide forms a folded structure in solution, composed of two guanine quartets connected by two T-T loops spanning the narrow grooves at one end and a T-G-T loop spanning a wide groove at the other end. We present the assignment strategy used, methods for the structure determination, and the refined three-dimensional structure of the thrombin aptamer. The initial structures were generated by metric matrix distance geometry using distance and dihedral bond angle constraints from NOE and coupling constants, respectively, and refined by restrained molecular dynamics and direct NOE refinement. Knowledge of the three-dimensional structure of this thrombin aptamer may be relevant for the design of improved thrombin-inhibiting anti-coagulants with similar structural motifs.
156d DNA NMR REFINED SOLUTION STRUCTURE OF THE DIMERIC QUADRUPLEX FORMED FROM THE OXYTRICHA TELOMERIC OLIGONUCLEOTIDE D(GGGGTTTTGGGG); 3Dmol view (1994) "Refined solution structure of the dimeric quadruplex formed from the Oxytricha telomeric oligonucleotide d(GGGGTTTTGGGG)." Structure, 2, 221-233. pubmed Schultze, P., Smith, F.W., Feigon, J. BACKGROUND: Telomeres, the structures at the ends of linear eukaryotic chromosomes, are essential for chromosome replication and stability. The telomeres of the unicellular ciliate Oxytricha contain a 3' single strand overhang composed of two repeats of the telomere repeat sequence d(TTTTGGGG). It has been proposed that oligonucleotides containing this repeat can form DNA quadruplexes via hydrogen bonding of the guanines into quartets. Such structures may be relevant to the biological function of the telomere, and in G-rich sequences elsewhere in the genome.
RESULTS: We have previously determined from solution NMR data that the Oxy-1.5 Oxytricha repeat oligonucleotide d(GGGGTTTTGGGG) dimerizes to form an intermolecular quadruplex composed of four guanine quartets and with the thymines in loops across the diagonal at opposite ends of the quadruplex. We report here the refined solution structure of Oxy-1.5. This structure is compared with the previously published crystal structure of the same oligonucleotide.
CONCLUSIONS: Oxy-1.5 forms a well-defined, symmetrical structure with ordered thymine loops. Both the solution and crystal structures of Oxy-1.5 are quadruplexes with alternating syn and anti glycosyl conformation of guanines along each strand of the helix and have thymine loops at opposite ends. However, the topology of the two structures is fundamentally different, leading to significant structural differences. A topological pathway for the formation and interconversion of the two structures is proposed.
186d DNA NMR SOLUTION STRUCTURE OF THE TETRAHYMENA TELOMERIC REPEAT D(T2G4)4 G-TETRAPLEX; 3Dmol view (1994) "Solution structure of the Tetrahymena telomeric repeat d(T2G4)4 G-tetraplex." Structure, 2, 1141-1156. pubmed Wang, Y., Patel, D.J. BACKGROUND: Telomeres in eukaryotic organisms are protein-DNA complexes which are essential for the protection and replication of chromosomal termini. The telomeric DNA of Tetrahymena consists of T2G4 repeats, and models have been previously proposed for the intramolecular folded structure of the d(T2G4)4 sequence based on chemical footprinting and cross-linking data. A high-resolution solution structure of this sequence would allow comparison with the structures of related G-tetraplexes.
RESULTS: The solution structure of the Na(+)-stabilized d(T2G4)4 sequence has been determined using a combined NMR-molecular dynamics approach. The sequence folds intramolecularly into a right-handed G-tetraplex containing three stacked G-tetrads connected by linker segments consisting of a G-T-T-G lateral loop, a central T-T-G lateral loop and a T-T segment that spans the groove through a double chain reversal. The latter T-T connectivity aligns adjacent G-G-G segments in parallel and introduces a new G-tetraplex folding topology with unprecedented combinations of strand directionalities and groove widths, as well as guanine syn/anti distributions along individual strands and around individual G-tetrads.
CONCLUSIONS: The four repeat Tetrahymena and human G-tetraplexes, which differ by a single guanine for adenine substitution, exhibit strikingly different folding topologies. The observed structural polymorphism establishes that G-tetraplexes can adopt topologies which project distinctly different groove dimensions, G-tetrad base edges and linker segments for recognition by, and interactions with, other nucleic acids and proteins.
1a6h DNA NMR DNA QUADRUPLEX CONTAINING GCGC TETRAD, NMR, 4 STRUCTURES; 3Dmol view (1995) "Solution structure of a DNA quadruplex containing the fragile X syndrome triplet repeat." J.Mol.Biol., 254, 638-656. pubmed Kettani, A., Kumar, R.A., Patel, D.J. Both X-ray and NMR structural studies have defined the polymorphic nature of G-quadruplexes generated through mutual stacking of G.G.G.G tetrads by guanine rich telomeric sequences. Recently, the fragile X syndrome d(C-G-G)n triplet nucleotide repeat has been shown to form a stable quadruplex of undefined structure in monovalent cation solution. We have undertaken a structural characterization of the d(G-C-G-G-T3-G-C-G-G) undecanucleotide to elucidate the structural alignments associated with quadruplex formation by this oligomer which contains sequence elements associated with the fragile X syndrome triplet repeat. d(G-C-G-G-T3-G-C-G-G) in Na+ cation solution forms a quadruplex through dimerization of two symmetry related hairpins with the lateral connecting T3 loops positioned at opposite ends of the quadruplex. This novel NMR-molecular dynamics based solution structure contains internal G.C.G.C tetrads sandwiched between terminal G.G.G.G tetrads. Watson-Crick G.C base-pairs within individual hairpins dimerize through their major groove edges using bifurcated hydrogen bonds to form internal G(anti).C(anti).G(anti).C(anti) tetrads. Adjacent strands are anti-parallel to each other around the symmetric G-quadruplex which contains two distinct narrow and two symmetric wide grooves. By contrast, the terminal G-tetrads adopt G(syn).G(anti).G(syn).G(anti) alignments. The structure of the d(G-C-G-G-T3-G-C-G-G) quadruplex with its multi-layer arrangement of G.G.G.G and G.C.G.C tetrads greatly expands on our current knowledge of quadruplex folding topologies. Our results establish the pairing alignments that can be potentially utilized by the fragile X syndrome triplet repeat to form quadruplex structures through dimerization of hairpin stems. The formation of novel G.C.G.C tetrads through dimerization of Watson-Crick G.C base-pairs is directly relevant to the potential pairing alignments of helical stems in genetic recombination.
1a8n DNA NMR SOLUTION STRUCTURE OF A NA+ CATION STABILIZED DNA QUADRUPLEX CONTAINING G.G.G.G AND G.C.G.C TETRADS FORMED BY G-G-G-C REPEATS OBSERVED IN AAV AND HUMAN CHROMOSOME 19, NMR, 8 STRUCTURES; 3Dmol view (1998) "Solution structure of a Na cation stabilized DNA quadruplex containing G.G.G.G and G.C.G.C tetrads formed by G-G-G-C repeats observed in adeno-associated viral DNA." J.Mol.Biol., 282, 619-636. pubmed Kettani, A., Bouaziz, S., Gorin, A., Zhao, H., Jones, R.A., Patel, D.J. We have applied NMR and molecular dynamics computations including intensity based refinement to define the structure of the d(G-G-G-C-T4-G-G-G-C) dodecanucleotide in 100 mM NaCl solution. The G-G-G-C sequence is of interest since it has been found as tandem repeats in the DNA sequence of human chromosome 19. The same G-G-G-C sequence is also seen as islands in adeno-associated virus, a human parvovirus, which is unique amongst eukaryotic DNA viruses in its ability to integrate site-specifically into a defined region of human chromosome 19. The d(G-G-G-C-T4-G-G-G-C) sequence forms a quadruplex in Na cation containing solution through head-to-tail dimerization of two symmetry-related stem-hairpin loops with adjacent strands antiparallel to each other around the quadruplex. The connecting T4 loops are of the lateral type, resulting in a quadruplex structure containing two internal G.G.G.G tetrads flanked by G.C.G.C tetrads. The G(anti).G(syn).G(anti).G(syn) tetrads are formed through dimerization associated hydrogen bonding alignments of a pair of Hoogsteen G(anti).G(syn) mismatch pairs, while the G(anti).C(anti).G(anti).C(anti) tetrads are formed through dimerization associated bifurcated hydrogen bonding alignments involving the major groove edges of a pair of Watson-Crick G.C base-pairs. The quadruplex contains two distinct narrow and two symmetric wide grooves with extensive stacking between adjacent tetrad planes. The structure of the quadruplex contains internal cavities that can potentially accommodate Na cations positioned between adjacent tetrad planes. Three such Na cations have been modeled into the structure of the d(G-G-G-C-T4-G-G-G-C) quadruplex. Finally, we speculate on the potential role of quadruplex formation involving G.G.G.G and G.C.G.C tetrads during the integration of the adeno-associated parvovirus into its target on human chromosome 19, both of which involve stretches of G-G-G-C sequence elements.
1a8w DNA NMR A K+ CATION-INDUCED CONFORMATIONAL SWITCH WITHIN A LOOP SPANNING SEGMENT OF A DNA QUADRUPLEX CONTAINING G-G-G-C REPEATS, NMR, 8 STRUCTURES; 3Dmol view (1998) "A K cation-induced conformational switch within a loop spanning segment of a DNA quadruplex containing G-G-G-C repeats." J.Mol.Biol., 282, 637-652. pubmed Bouaziz, S., Kettani, A., Patel, D.J. We have identified a unique structural transition (in slow exchange on the NMR time scale) in the tertiary fold of the d(G-G-G-C-T4-G-G-G-C) quadruplex on proceeding from Na+ to K+ as counterion in aqueous solution. Both monovalent cation-dependent conformations exhibit certain common structural features, which include head-to-tail dimerization of two symmetry-related stem-hairpin loops, adjacent strands which are antiparallel to each other and adjacent stacked G(syn).G(anti). G(syn).G(anti) tetrads in the central core of the quadruplexes. The Na and K cation stabilized structures of the d(G-G-G-C-T4-G-G-G-C) quadruplexes differ in the conformations of the T-T-T-T loops, the relative alignment of G.C base-pairs positioned opposite each other through their major groove edges and potentially in the number of monovalent cation binding sites. We have identified potential K cation binding cavities within the symmetry-related T-T-T-G segments, suggesting the potential for two additional monovalent cation binding sites in the K cation-stabilized quadruplex relative to its Na cation-stabilized counterpart. Modeling studies suggest that the major groove edges of guanine residues in Watson-Crick G.C base-pairs could potentially be bridged by coordinated K cations in the d(G-G-G-C-T4-G-G-G-C) quadruplex in KCl solution in contrast to formation of G.C.G.C tetrads for the corresponding quadruplex in NaCl solution. Our results defining the molecular basis of a Na to K cation-dependent conformational switch in the loop spanning segment of the d(G-G-G-C-T4-G-G-G-C) quadruplex may have relevance to recent observations that specific K cation coordinated loop conformations within quadruplexes exhibit inhibitory activity against HIV integrase.
1aff DNA NMR DNA QUADRUPLEX CONTAINING GGGG TETRADS AND (T.A).A TRIADS, NMR, 8 STRUCTURES; 3Dmol view (1997) "Bombyx mori single repeat telomeric DNA sequence forms a G-quadruplex capped by base triads." Nat.Struct.Mol.Biol., 4, 382-389. pubmed Kettani, A., Bouaziz, S., Wang, W., Jones, R.A., Patel, D.J. A combined NMR-molecular dynamics approach has been applied to determine the solution structure of a truncated analogue of the Bombyx mori telomeric d(TTAGG) single repeat sequence in Na+ cation-containing aqueous solution. The two-fold symmetric four-stranded d(TAGG) quadruplex contains two adjacent G(syn).G(syn).G(anti).G(anti) G-tetrads sandwiched between novel (T.A).A triads with individual strands having both a parallel and antiparallel neighbour around the quadruplex. The (T.A).A triad represents the first experimental verification of a base triad alignment which constitutes a key postulate in the recently proposed model of triad-DNA. Further, the (T.A).A triad is generated by positioning an A residue through hydrogen bonding in the minor groove of a Watson-Crick T.A base pair and includes a T-A platform related to an A-A platform recently observed in the structure of the P4-P6 domain of the Tetrahymena self splicing group I ribozyme. The novel architecture of the truncated Bombyx mori quadruplex structure sets the stage for the design and potential identification of additional base tetrads and triads that could participate in pairing alignments of multi-stranded DNA structures during chromosome association and genetic recombination.
1bub DNA NMR DETERMINATION OF INTERNUCLEAR ANGLES OF DNA USING PARAMAGNETIC ASSISTED MAGNETIC ALIGNMENT; 3Dmol view (1998) "Determination of internuclear angles of DNA using paramagnetic-assisted magnetic alignment." J.Magn.Reson., 135, 256-259. pubmed Beger, R.D., Marathias, V.M., Volkman, B.F., Bolton, P.H. Paramagnetic ions have been used to assist the magnetic alignment of DNA. The anisotropy of the binding sites is sufficient to give rise to significant alignment of the DNA with the observed proton-carbon dipolar couplings spanning a 70-Hz range. The dipolar couplings have been used to determine the positions of the axial and rhombic alignment axes. The positions of the alignment axes relative to the positions of the binding sites of the paramagnetic europium ions have also been determined.
1c32 DNA NMR SOLUTION STRUCTURE OF A QUADRUPLEX FORMING DNA AND ITS INTERMIDIATE; 3Dmol view (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. pubmed Marathias, V.M., Bolton, P.H. Potassium can stabilize the formation of chair- or edge-type quadruplex DNA structures and appears to be the only naturally occurring cation that can do so. As quadruplex DNAs may be important in the structure of telomere, centromere, triplet repeat and other DNAs, information about the details of the potassium-quadruplex DNA interactions are of interest. The structures of the 1:1 and the fully saturated, 2:1, potassium-DNA complexes of d(GGTTGGTGTGGTTGG) have been determined using the combination of experimental NMR results and restrained molecular dynamics simulations. The refined structures have been used to model the interactions at the potassium binding sites. Comparison of the 1:1 and 2:1 potassium:DNA structures indicates how potassium binding can determine the folding pattern of the DNA. In each binding site potassium interacts with the carbonyl oxygens of both the loop thymine residues and the guanine residues of the adjacent quartet.
1c34 DNA NMR SOLUTION STRUCTURE OF A QUADRUPLEX FORMING DNA AND ITS INTERMIDIATE; 3Dmol view (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. pubmed Marathias, V.M., Bolton, P.H. Potassium can stabilize the formation of chair- or edge-type quadruplex DNA structures and appears to be the only naturally occurring cation that can do so. As quadruplex DNAs may be important in the structure of telomere, centromere, triplet repeat and other DNAs, information about the details of the potassium-quadruplex DNA interactions are of interest. The structures of the 1:1 and the fully saturated, 2:1, potassium-DNA complexes of d(GGTTGGTGTGGTTGG) have been determined using the combination of experimental NMR results and restrained molecular dynamics simulations. The refined structures have been used to model the interactions at the potassium binding sites. Comparison of the 1:1 and 2:1 potassium:DNA structures indicates how potassium binding can determine the folding pattern of the DNA. In each binding site potassium interacts with the carbonyl oxygens of both the loop thymine residues and the guanine residues of the adjacent quartet.
1c35 DNA NMR SOLUTION STRUCTURE OF A QUADRUPLEX FORMING DNA AND ITS INTERMIDIATE; 3Dmol view (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. pubmed Marathias, V.M., Bolton, P.H. Potassium can stabilize the formation of chair- or edge-type quadruplex DNA structures and appears to be the only naturally occurring cation that can do so. As quadruplex DNAs may be important in the structure of telomere, centromere, triplet repeat and other DNAs, information about the details of the potassium-quadruplex DNA interactions are of interest. The structures of the 1:1 and the fully saturated, 2:1, potassium-DNA complexes of d(GGTTGGTGTGGTTGG) have been determined using the combination of experimental NMR results and restrained molecular dynamics simulations. The refined structures have been used to model the interactions at the potassium binding sites. Comparison of the 1:1 and 2:1 potassium:DNA structures indicates how potassium binding can determine the folding pattern of the DNA. In each binding site potassium interacts with the carbonyl oxygens of both the loop thymine residues and the guanine residues of the adjacent quartet.
1c38 DNA NMR SOLUTION STRUCTURE OF A QUADRUPLEX FORMING DNA AND ITS INTERMEDIATE; 3Dmol view (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. pubmed Marathias, V.M., Bolton, P.H. Potassium can stabilize the formation of chair- or edge-type quadruplex DNA structures and appears to be the only naturally occurring cation that can do so. As quadruplex DNAs may be important in the structure of telomere, centromere, triplet repeat and other DNAs, information about the details of the potassium-quadruplex DNA interactions are of interest. The structures of the 1:1 and the fully saturated, 2:1, potassium-DNA complexes of d(GGTTGGTGTGGTTGG) have been determined using the combination of experimental NMR results and restrained molecular dynamics simulations. The refined structures have been used to model the interactions at the potassium binding sites. Comparison of the 1:1 and 2:1 potassium:DNA structures indicates how potassium binding can determine the folding pattern of the DNA. In each binding site potassium interacts with the carbonyl oxygens of both the loop thymine residues and the guanine residues of the adjacent quartet.
1d59 DNA X-ray (2.3 Å) CRYSTAL STRUCTURE OF 4-STRANDED OXYTRICHA TELOMERIC DNA; 3Dmol view (1992) "Crystal structure of four-stranded Oxytricha telomeric DNA." Nature, 356, 126-131. pubmed Kang, C., Zhang, X., Ratliff, R., Moyzis, R., Rich, A. The sequence d(GGGGTTTTGGGG) from the 3' overhang of the Oxytricha telomere has been crystallized and its three-dimensional structure solved to 2.5 A resolution. The oligonucleotide forms hairpins, two of which join to make a four-stranded helical structure with the loops containing four thymine residues at either end. The guanine residues are held together by cyclic hydrogen bonding and an ion is located in the centre. The four guanine residues in each segment have a glycosyl conformation that alternates between anti and syn. There are two four-stranded molecules in the asymmetric unit showing that the structure has some intrinsic flexibility.
1d6d DNA NMR SOLUTION DNA STRUCTURE CONTAINING (A-A)-T TRIADS INTERDIGITATED BETWEEN A-T BASE PAIRS AND GGGG TETRADS; NMR, 8 STRUCT.; 3Dmol view (2000) "A diamond-shaped zipper-like DNA architecture containing triads sandwiched between mismatches and tetrads." J.Mol.Biol., 295, 455-469. pubmed Kuryavyi, V., Kettani, A., Wang, W., Jones, R., Patel, D.J. The present study reports on the solution structure of the guanine plus adenine rich d(A(2)G(2)T(4)A(2)G(2)) 12-mer sequence which forms a unique fold in moderate NaCl solution. Proton resonance assignments for this sequence, which contains a pair of AAGG repeats separated by a T(4) linker segment, were aided by site-specific (15)N-labeling of guanine and adenine bases, as well as site-specific incorporation of 2,6-diaminopurine and 8-bromoadenine for adenine, 8-bromoguanine, 7-deazaguanine and inosine for guanine, and uracil and 5-bromouracil for thymine. The solution structure, which was solved by a combined NMR and intensity-refined computational approach, consists of a diamond-shaped architecture formed through dimerization of a pair of d(A(2)G(2)T(4)A(2)G(2)) hairpins. This 2-fold symmetric structure contains a quadruplex core consisting of a pair of symmetry-related G(syn).G(syn).G(anti). G(anti) tetrads, where adjacent strands have both parallel and anti-parallel neighbors and connecting T(4) segments which form diagonal loops. Each of the G(syn).G(syn).G(anti).G(anti) tetrads forms a platform on which stacks a T(anti).[A(syn)-A(anti)] triad containing a novel A(syn)-A(anti) platform step and a reversed Hoogsteen A(syn).T(anti) pair. We observe both base-base and base-sugar stacking interactions, with the latter occuring at a sheared A-G step where the sugar of the A stacks on the purine plane of the G. Unexpectedly, the topology of this sheared A(anti)-G(syn) step has many similarities with the C(anti)-G(syn) step in left-handed Z-DNA. The T.(A-A) triad is sandwiched between the G-tetrad on one side and a reversed Hoogsteen A(anti).T(anti) pair on the other. This intercalative topology is facilitated by a zipper-like motif where the A(anti) residue of the triad is interdigitated within a stretched A(anti)-G(syn) step. Our structural study reports on new aspects of A-A platforms, base triads, zipper-like interdigitation and sheared base steps, together with base-base and base-sugar stacking defining a diamond-like architecture for the d(A(2)G(2)T(4)A(2)G(2)) sequence. One can anticipate that mixed guanine-adenine sequences will exhibit a rich diversity of polymorphic architectures that will provide unique topologies for recognition by both nucleic acids and proteins.
1eeg DNA NMR A(GGGG)A HEXAD PAIRING ALIGMENT FOR THE D(G-G-A-G-G-A-G) SEQUENCE; 3Dmol view (2000) "A dimeric DNA interface stabilized by stacked A.(G.G.G.G).A hexads and coordinated monovalent cations." J.Mol.Biol., 297, 627-644. pubmed Kettani, A., Gorin, A., Majumdar, A., Hermann, T., Skripkin, E., Zhao, H., Jones, R., Patel, D.J. We report on the identification of an A.(G.G.G.G).A hexad pairing alignment which involves recognition of the exposed minor groove of opposing guanines within a G.G.G.G tetrad through sheared G.A mismatch formation. This unexpected hexad pairing alignment was identified for the d(G-G-A-G-G-A-G) sequence in 150 mM Na(+) (or K(+)) cation solution where four symmetry-related strands align into a novel dimeric motif. Each symmetric half of the dimeric "hexad" motif is composed of two strands and contains a stacked array of an A.(G.G.G.G).A hexad, a G.G.G.G tetrad, and an A.A mismatch. Each strand in the hexad motif contains two successive turns, that together define an S-shaped double chain reversal fold, which connects the two G-G steps aligned parallel to each other along adjacent edges of the quadruplex. Our studies also establish a novel structural transition for the d(G-G-A-G-G-A-N) sequence, N=T and G, from an "arrowhead" motif stabilized through cross-strand stacking and mismatch formation in 10 mM Na(+) solution (reported previously), to a dimeric hexad motif stabilized by extensive inter-subunit stacking of symmetry-related A.(G.G.G.G).A hexads in 150 mM Na(+) solution. Potential monovalent cation binding sites within the arrowhead and hexad motifs have been probed by a combination of Brownian dynamics and unconstrained molecular dynamics calculations. We could not identify stable monovalent cation-binding sites in the low salt arrowhead motif. By contrast, five electronegative pockets were identified in the moderate salt dimeric hexad motif. Three of these are involved in cation binding sites sandwiched between G.G.G. G tetrad planes and two others, are involved in water-mediated cation binding sites spanning the unoccupied grooves associated with the adjacent stacked A.(G.G.G.G).A hexads. Our demonstration of A.(G. G.G.G).A hexad formation opens opportunities for the design of adenine-rich G-quadruplex-interacting oligomers that could potentially target base edges of stacked G.G.G.G tetrads. Such an approach could complement current efforts to design groove-binding and intercalating ligands that target G-quadruplexes in attempts designed to block the activity of the enzyme telomerase.
1emq DNA NMR NMR OBSERVATION OF T-TETRADS IN A PARALLEL STRANDED DNA QUADRUPLEX FORMED BY SACCHAROMYCES CEREVISIAE TELOMERE REPEATS; 3Dmol view (1999) "NMR observation of T-tetrads in a parallel stranded DNA quadruplex formed by Saccharomyces cerevisiae telomere repeats." Nucleic Acids Res., 27, 2457-2464. pubmed Patel, P.K., Hosur, R.V. We report here the NMR structure of the DNA sequence d-TGGTGGC containing two repeats of Saccharomyces cerevisiae telomere DNA which is unique in that it has a single thymine in the repeat sequence and the number of Gs can vary from one to three. The structure is a novel quadruplex incor-porating T-tetrads formed by symmetrical pairing of four Ts via O4-H3 H-bonds in a plane. This is in contrast to the previous results on other telomeric sequences which contained more than one T in the repeat sequences and they were seen mostly in the flexible regions of the structures. We observed that the T4-tetrad was nicely accommodated in the center of the G-quadruplex, but it caused a small underwinding of the right handed helix. The T tetrad stacked well on the adjacent G3-tetrad, but poorly on the G5 tetrad. Likewise, T1 also formed a stable T-tetrad at the 5' end of the quadruplex. To our knowledge, this is the first report of T-tetrad formation in DNA structures. These observations are of significance from the points of view of both structural diversity and specific recognitions.
1evm DNA NMR NMR OBSERVATION OF A-TETRAD; 3Dmol view (1999) "NMR studies on truncated sequences of human telomeric DNA: observation of a novel A-tetrad." Nucleic Acids Res., 27, 3836-3843. pubmed Patel, P.K., Koti, A.S., Hosur, R.V. The structure of the telomeric DNA has been a subject of extensive investigation in recent years due to the realization that it has important functional roles to play in vivo and the observations that truncated telomeric sequences exhibit a great variety of 3D structures in aqueous solutions. In this context, we describe here NMR structural studies on two truncated human telomeric DNA sequences, d-AG(3)T and d-TAG(3)T in solutions containing K(+)ions. The G(3)stretches in both the oligonucleotides were seen to form parallel-stranded quadruplexes. However, the AG(3)segment as a whole, had different structural characteristics. The structure of d-AG(3)T revealed the formation of a novel A-tetrad, which was not seen in d-TAG(3)T. The A's in the tetrad had syn glycosidic conformation as opposed to the anti conformation of the G's in the G-tetrads. The A-tetrad stacked well over the adjacent G-tetrad and the twist angle at this step was smaller in d-AG(3)T than in d-TAG(3)T. These observations are expected to be significant from the point of view of structural diversity and recognition in telomeres.
1evn DNA NMR NMR OBSERVATION OF A-TETRAD; 3Dmol view (1999) "NMR studies on truncated sequences of human telomeric DNA: observation of a novel A-tetrad." Nucleic Acids Res., 27, 3836-3843. pubmed Patel, P.K., Koti, A.S., Hosur, R.V. The structure of the telomeric DNA has been a subject of extensive investigation in recent years due to the realization that it has important functional roles to play in vivo and the observations that truncated telomeric sequences exhibit a great variety of 3D structures in aqueous solutions. In this context, we describe here NMR structural studies on two truncated human telomeric DNA sequences, d-AG(3)T and d-TAG(3)T in solutions containing K(+)ions. The G(3)stretches in both the oligonucleotides were seen to form parallel-stranded quadruplexes. However, the AG(3)segment as a whole, had different structural characteristics. The structure of d-AG(3)T revealed the formation of a novel A-tetrad, which was not seen in d-TAG(3)T. The A's in the tetrad had syn glycosidic conformation as opposed to the anti conformation of the G's in the G-tetrads. The A-tetrad stacked well over the adjacent G-tetrad and the twist angle at this step was smaller in d-AG(3)T than in d-TAG(3)T. These observations are expected to be significant from the point of view of structural diversity and recognition in telomeres.
1evo DNA NMR NMR OBSERVATION OF A NOVEL C-TETRAD; 3Dmol view (2000) "NMR observation of a novel C-tetrad in the structure of the SV40 repeat sequence GGGCGG." Biochem.Biophys.Res.Commun., 270, 967-971. pubmed Patel, P.K., Bhavesh, N.S., Hosur, R.V. We report the NMR structure of the DNA sequence d-TGGGCGGT in Na(+) solutions at neutral pH, containing a repeat sequence from SV40 viral genome. The structure is a novel quadruplex incorporating the C-tetrad formed by symmetrical pairing of four Cs via NH(2)&bond;O(2) H-bonds in a plane. The C-tetrad has a wider cavity compared to G-tetrads and stacks well over the adjacent G4-tetrad, but poorly on the G6 tetrad. The quadruplex helix is largely underwound by 8-10 degrees compared to B-DNA except at the C5-G6 step. To our knowledge this is the first report of C-tetrad formation in DNA structures, and would be of significance from the point of view of both structural diversity and specific recognition.
1f3s DNA NMR Solution Structure of DNA Sequence GGGTTCAGG Forms GGGG Tetrade and G(C-A) Triad.; 3Dmol view (2000) "A two-stranded template-based approach to G.(C-A) triad formation: designing novel structural elements into an existing DNA framework." J.Mol.Biol., 301, 129-146. pubmed Kettani, A., Basu, G., Gorin, A., Majumdar, A., Skripkin, E., Patel, D.J. We have designed a DNA sequence, d(G-G-G-T-T-C-A-G-G), which dimerizes to form a 2-fold symmetric G-quadruplex in which G(syn). G(anti).G(syn).G(anti) tetrads are sandwiched between all trans G. (C-A) triads. The NMR-based solution structural analysis was greatly aided by monitoring hydrogen bond alignments across N-H...N and N-H...O==C hydrogen bonds within the triad and tetrad, in a uniformly ((13)C,(15)N)-labeled sample of the d(G-G-G-T-T-C-A-G-G) sequence. The solution structure establishes that the guanine base-pairs with the cytosine through Watson-Crick G.C pair formation and with adenine through sheared G.A mismatch formation within the G.(C-A) triad. A model of triad DNA was constructed that contains the experimentally determined G.(C-A) triad alignment as the repeating stacked unit.
1fqp DNA NMR INTRAMOLECULAR QUADRUPLEX DNA WITH THREE GGGG REPEATS, NMR, PH 6.7, 0.1 M NA+ AND 4 MM (STRAND CONCENTRATION), 5 STRUCTURES; 3Dmol view (1995) "Solution structure of the Na+ form of the dimeric guanine quadruplex [d(G3T4G3)]2." Eur.J.Biochem., 233, 631-643. pubmed Keniry, M.A., Strahan, G.D., Owen, E.A., Shafer, R.H. The solution structure of the DNA quadruplex formed by the association of two strands of the DNA oligonucleotide, d(G3T4G3), in NaCl solution has been determined by 1H two-dimensional NMR techniques, full relaxation matrix calculations and restrained molecular dynamics. The refined structure incorporates the sequences 5'-G1sG2AG3AT4AT5AT6AT7AG8sG9AG10A-3' and 5'-G11sG12AG13AT14AT15AT16AT17AG18sG19sG20A-3' (where S and A denote syn and anti, respectively) in a three-quartet, diagonal-looped structure that we [Strahan, G. D., Shafer, R. H. & Keniry, M. A. (1994) Nucleic Acids Res. 22, 5447-5455] and others [Smith, F. W., Lau, F. W. & Feigon, J. (1994) Proc. Natl. Acad. Sci. USA 91, 10546-10550] have described. The loop structure is compact and incorporates many of the features found in duplex hairpin loops including base stacking, intraloop hydrogen bonding and extensive van der Waals' interactions. The first and third loop thymines stack over the outermost G-quartet and are also associated by hydrogen bonding. The second and the fourth loop thymines fold inwards in order to enhance van der Waals' interactions. The unexpected sequential syn-syn deoxyguanosines in the quadruplex stem appear to be a direct consequence of the way DNA oligonucleotides fold and the subsequent search for the most stable loop structure. The implications of loop sequence and length on the structure of quadruplexes are discussed.
1hao hydrolase-hydrolase inhibitor-DNA X-ray (2.8 Å) COMPLEX OF HUMAN ALPHA-THROMBIN WITH A 15MER OLIGONUCLEOTIDE GGTTGGTGTGGTTGG (BASED ON NMR MODEL OF DNA); 3Dmol view (1996) "An ambiguous structure of a DNA 15-mer thrombin complex." Acta Crystallogr.,Sect.D, 52, 272-282. pubmed Padmanabhan, K., Tulinsky, A. The structure of a complex between thrombin and a GGTTGGTGTGGTTGG DNA 15-mer has been analyzed crystallographically. The solution NMR structure of the 15-mer has two stacked G-quartets similar to that found in the previous X-ray structure determination of the 15-mer-thrombin complex [Padmanabhan, Padmanabhan, Ferrara, Sadler & Tulinsky (1993). J. Biol. Chem. 268, 17651-17654]; the strand polarity, however, is reversed from that of the crystallographic structure. The structure of the complex here has been redetermined with better diffraction data confirming the previous crystallographic structure but also indicating that the NMR solution structure fits equally well. Both 15-mer complex structures refined to an R value of about 0.16 presenting a disconcerting ambiguity. Since the two 15-mer structures associate with thrombin in different ways (through the TGT loop in the X-ray and TT loop in the NMR model), other independent lines of physical or chemical evidence are required to resolve the ambiguity.
1hap hydrolase-hydrolase inhibitor-DNA X-ray (2.8 Å) COMPLEX OF HUMAN ALPHA-THROMBIN WITH A 15MER OLIGONUCLEOTIDE GGTTGGTGTGGTTGG (BASED ON X-RAY MODEL OF DNA); 3Dmol view (1996) "An ambiguous structure of a DNA 15-mer thrombin complex." Acta Crystallogr.,Sect.D, 52, 272-282. pubmed Padmanabhan, K., Tulinsky, A. The structure of a complex between thrombin and a GGTTGGTGTGGTTGG DNA 15-mer has been analyzed crystallographically. The solution NMR structure of the 15-mer has two stacked G-quartets similar to that found in the previous X-ray structure determination of the 15-mer-thrombin complex [Padmanabhan, Padmanabhan, Ferrara, Sadler & Tulinsky (1993). J. Biol. Chem. 268, 17651-17654]; the strand polarity, however, is reversed from that of the crystallographic structure. The structure of the complex here has been redetermined with better diffraction data confirming the previous crystallographic structure but also indicating that the NMR solution structure fits equally well. Both 15-mer complex structures refined to an R value of about 0.16 presenting a disconcerting ambiguity. Since the two 15-mer structures associate with thrombin in different ways (through the TGT loop in the X-ray and TT loop in the NMR model), other independent lines of physical or chemical evidence are required to resolve the ambiguity.
1hut hydrolase-hydrolase inhibitor-DNA X-ray (2.9 Å) THE STRUCTURE OF ALPHA-THROMBIN INHIBITED BY A 15-MER SINGLE-STRANDED DNA APTAMER; 3Dmol view (1993) "The structure of alpha-thrombin inhibited by a 15-mer single-stranded DNA aptamer." J.Biol.Chem., 268, 17651-17654. pubmed Padmanabhan, K., Padmanabhan, K.P., Ferrara, J.D., Sadler, J.E., Tulinsky, A. The structure of a complex between human alpha-thrombin and a GGTTGGTGTGGTTGG 15-nucleotide consensus sequence has been solved by x-ray crystallography and refined at 2.9-A resolution to an R value of 0.159. As in solution, in the complex the single-stranded DNA folds into a structure with two G-quartets. The DNA is sandwiched between two different positively charged regions of two symmetry-related thrombin molecules in the crystal structure making ionic and hydrophobic interactions. One region is the fibrinogen recognition exosite and the other, the putative heparin binding site. The lack of inhibition of fibrinogen clotting and platelet activation by the DNA 15-mer with the Arg75-->Glu mutant of thrombin is consistent with the several salt bridges of the DNA in the fibrinogen exosite. The association of DNA with the heparin site of a neighboring molecule appears to simply compensate residual charge. Differences in the 15-mer loop conformations between the complex and NMR solution structures can be attributed to conformational changes upon thrombin binding. Although G-quadruplexes are favored in the presence of monovalent cations, there is no evidence of the latter in the thrombin complex.
1i34 DNA NMR SOLUTION DNA QUADRUPLEX WITH DOUBLE CHAIN REVERSAL LOOP AND TWO DIAGONAL LOOPS CONNECTING GGGG TETRADS FLANKED BY G-(T-T) TRIAD AND T-T-T TRIPLE; 3Dmol view (2001) "A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple." J.Mol.Biol., 310, 181-194. pubmed Kuryavyi, V., Majumdar, A., Shallop, A., Chernichenko, N., Skripkin, E., Jones, R., Patel, D.J. The architecture of G-G-G-G tetrad-aligned DNA quadruplexes in monovalent cation solution is dependent on the directionality of the four strands, which in turn are defined by loop connectivities and the guanine syn/anti distribution along individual strands and within individual G-G-G-G tetrads. The smallest unimolecular G-quadruplex belongs to the d(G2NnG2NnG2NnG2) family, which has the potential to form two stacked G-tetrads linked by Nn loop connectivities. Previous studies have focused on the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), where Nn was T2 for the first and third connecting loops and TGT for the middle connecting loop. This DNA aptamer in K(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(anti)-G(syn)-G(anti) tetrads, adjacent strands which are antiparallel to each other and edge-wise connecting T2, TGT and T2 loops. We now report on the NMR-based solution structure of the d(G2T4G2CAG2GT4G2T) sequence, which differs from the thrombin-binding DNA aptamer sequence in having longer first (T4) and third (GT4) loops and a shorter (CA) middle loop. This d(G2T4G2CAG2GT4G2T) sequence in Na(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads, adjacent strands which have one parallel and one antiparallel neighbors and distinct non-edge-wise loop connectivities. Specifically, the longer first (T4) and third (GT4) loops are of the diagonal type while the shorter middle loop is of the double chain reversal type. In addition, the pair of stacked G-G-G-G tetrads are flanked on one side by a G-(T-T) triad and on the other side by a T-T-T triple. The distinct differences in strand directionalities, loop connectivities and syn/anti distribution within G-G-G-G tetrads between the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2) quadruplex reported previously, and the d(G2T4G2CAG2GT4G2T) quadruplex reported here, reinforces the polymorphic nature of higher-order DNA architectures. Further, these two small unimolecular G-quadruplexes, which are distinct from each other and from parallel-stranded G-quadruplexes, provide novel targets for ligand recognition. Our results demonstrate that the double chain reversal loop connectivity identified previously by our laboratory within the Tetrahymena telomere d(T2G4)4 quadruplex, is a robust folding topology, since it has now also been observed within the d(G2T4G2CAG2GT4G2T) quadruplex. The identification of a G-(T-T) triad and a T-T-T triple, expands on the available recognition alignments for base triads and triples.
1j6s RNA X-ray (1.4 Å) Crystal Structure of an RNA Tetraplex (UGAGGU)4 with A-tetrads, G-tetrads, U-tetrads and G-U octads; 3Dmol view (2003) "Crystal structure of an RNA purine-rich tetraplex containing adenine tetrads: implications for specific binding in RNA tetraplexes." Structure, 11, 815-823. pubmed Pan, B., Xiong, Y., Shi, K., Deng, J., Sundaralingam, M. Purine-rich regions in DNA and RNA may contain both guanines and adenines, which have various biological functions. Here we report the crystal structure of an RNA purine-rich fragment containing both guanine and adenine at 1.4 A resolution. Adenines form an adenine tetrad in the N6-H em leader N7 conformation. Substitution of an adenine tetrad in the guanine tetraplex does not change the global conformation but introduces irregularity in both the hydrogen bonding interaction pattern in the groove and the metal ion binding pattern in the central cavity of the tetraplex. The irregularity in groove binding may be critical for specific binding in tetraplexes. The formation of G-U octads provides a mechanism for interaction in the groove. Ba(2+) ions prefer to bind guanine tetrads, and adenine tetrads can only be bound by Na(+) ions, illustrating the binding selectivity of metal ions for the tetraplex.
1j8g RNA X-ray (0.61 Å) X-ray Analysis of a RNA Tetraplex r(uggggu)4 at Ultra-High Resolution; 3Dmol view (2001) "X-ray analysis of an RNA tetraplex (UGGGGU)(4) with divalent Sr(2+) ions at subatomic resolution (0.61 A)." Proc.Natl.Acad.Sci.USA, 98, 13665-13670. pubmed Deng, J., Xiong, Y., Sundaralingam, M. Four-stranded guanine tetraplexes in RNA have been identified to be involved in crucial biological functions, such as dimerization of retroviral RNA, translational repression, and mRNA turnover. However, the structural basis for these biological processes is still largely unknown. Here we report the RNA tetraplex structure (UGGGGU)(4) at ultra-high resolution (0.61 A). The space group is P42(1)2, and cell constants are a = b = 36.16 A and c = 74.09 A. The structure was solved by the multiple-wavelength anomalous dispersion method using a set of three-wavelength data of the isomorphous bromo derivative (br)UGGGGU and refined to 0.61-A resolution. Each of the four strands in the asymmetric unit forms a parallel tetraplex with symmetry-related molecules. The tetraplex molecules stack on one another in opposite polarity (head-to-head or tail-to-tail) to form a pseudocontinuous column. All of the 5'-end uridines rotate around the backbone of G2, swing out, and form unique octaplexes with the neighboring G tetraplexes, whereas the 3'-end uridines are stacked-in and form uridine tetrads. All of the bases are anti, and the riboses are in the mixed C2'- and C3'-puckering mode. Strontium ions are observed in every other guanine tetrad plane, sitting on the fourfold axis and associated to the eight O6 atoms of neighboring guanine bases in a bipyramidal-antiprism geometry. The hydrogens are clearly observed in the structure.
1jb7 DNA-binding protein-DNA X-ray (1.86 Å) DNA G-Quartets in a 1.86 A Resolution Structure of an Oxytricha nova Telomeric Protein-DNA Complex; 3Dmol view (2001) "DNA G-quartets in a 1.86 A resolution structure of an Oxytricha nova telomeric protein-DNA complex." J.Mol.Biol., 310, 367-377. pubmed Horvath, M.P., Schultz, S.C. The Oxytricha nova telomere end binding protein (OnTEBP) recognizes, binds and protects the single-stranded 3'-terminal DNA extension found at the ends of macronuclear chromosomes. The structure of this complex shows that the single strand GGGGTTTTGGGG DNA binds in a deep cleft between the two protein subunits of OnTEBP, adopting a non-helical and irregular conformation. In extending the resolution limit of this structure to 1.86 A, we were surprised to find a G-quartet linked dimer of the GGGGTTTTGGGG DNA also packing within the crystal lattice and interacting with the telomere end binding protein. The G-quartet DNA exhibits the same structure and topology as previously observed in solution by NMR with diagonally crossing d(TTTT) loops at either end of the four-stranded helix. Additionally, the crystal structure reveals clearly visible Na(+), and specific patterns of bound water molecules in the four non-equivalent grooves. Although the G-quartet:protein contact surfaces are modest and might simply represent crystal packing interactions, it is interesting to speculate that the two types of telomeric DNA-protein interactions observed here might both be important in telomere biology.
1jjp DNA NMR A(GGGG) Pentad-Containing Dimeric DNA Quadruplex Involving Stacked G(anti)G(anti)G(anti)G(syn) Tetrads; 3Dmol view (2001) "V-shaped scaffold: a new architectural motif identified in an A x (G x G x G x G) pentad-containing dimeric DNA quadruplex involving stacked G(anti) x G(anti) x G(anti) x G(syn) tetrads." J.Mol.Biol., 311, 1063-1079. pubmed Zhang, N., Gorin, A., Majumdar, A., Kettani, A., Chernichenko, N., Skripkin, E., Patel, D.J. We report the results of an NMR study of unlabeled and uniformly (13)C,(15)N-labeled d(G(3)AG(2)T(3)G(3)AT) in 100 mM NaCl, conditions under which it forms a dimeric quadruplex containing several new topological features. The DNA oligomer chain in each symmetry-related monomer subunit undergoes three sharp turns to form a compact domain, with all the purine bases involved in pairing alignments. The first turn is of the double chain reversal type, the second is of the edgewise type, and the third represents a new alignment, the V-shaped type. Each monomer of the dimeric quadruplex contains two stacked G(anti) x G(anti) x G(anti) x G(syn) tetrads, one of which forms a newly identified A x (G x G x G x G) pentad, through sheared G.A mismatch formation. There is a break in one of the four G-G columns that link adjacent G x G x G x G tetrads within each monomer. This architectural interruption is compensated by a new topological feature of quadruplex architecture, the V-shaped scaffold. The missing G-G column results in an opening that could facilitate insertion of planar ligands into the quadruplex. The dimeric interface contains stacked A.(G.G.G.G) pentads, with each pentad containing four bases from one monomer and a syn G1 from the partner monomer. Several potential ligand-binding pockets, positioned towards either end of the folded architecture, were identifiable in a surface view of the solution structure of the dimeric d(G(3)AG(2)T(3)G(3)AT) quadruplex.
1jpq DNA X-ray (1.6 Å) Crystal Structure of the Oxytricha Telomeric DNA at 1.6A; 3Dmol view (2002) "Crystal structure of the potassium form of an Oxytricha nova G-quadruplex." J.Mol.Biol., 320, 189-200. pubmed Haider, S., Parkinson, G.N., Neidle, S. The crystal structures of the potassium-containing quadruplex formed from the Oxytricha nova sequence d(GGGGTTTTGGGG) are reported, in two space groups, the orthorhombic P2(1)2(1)2(1) and the trigonal P3(2)21, which diffract to 2.0 A and 1.49 A, respectively. The orthorhombic form contains two independent quadruplexes in the asymmetric unit, and the trigonal form contains one. All three of these quadruplexes adopt an identical fold, with two strands forming an antiparallel diagonal arrangement. This is identical with that observed previously in NMR studies of the native sodium and potassium forms, and a crystallographic analysis of it complexed with an O. nova protein. The present analysis demonstrates that the native structure is the same in solution and in the crystalline state and, moreover, that the nature of the counter-ion does not affect the overall fold of this quadruplex. The analysis corrects an earlier crystallographic study of this quadruplex. The conformation of the tetra-thymine loop is described in detail, which involves the third thymine base folding back to interact with the first thymine base. The water networks in the grooves and loops are described and, in particular, the ability of water molecules to form a continuous spine of hydration in the narrow groove is detailed. Each quadruplex has five potassium ions organised in a linear channel, with square antiprismatic coordination to each ion from oxygen atoms.
1jrn DNA X-ray (2.0 Å) Orthorhombic form of Oxytricha telomeric DNA at 2.0A; 3Dmol view (2002) "Crystal structure of the potassium form of an Oxytricha nova G-quadruplex." J.Mol.Biol., 320, 189-200. pubmed Haider, S., Parkinson, G.N., Neidle, S. The crystal structures of the potassium-containing quadruplex formed from the Oxytricha nova sequence d(GGGGTTTTGGGG) are reported, in two space groups, the orthorhombic P2(1)2(1)2(1) and the trigonal P3(2)21, which diffract to 2.0 A and 1.49 A, respectively. The orthorhombic form contains two independent quadruplexes in the asymmetric unit, and the trigonal form contains one. All three of these quadruplexes adopt an identical fold, with two strands forming an antiparallel diagonal arrangement. This is identical with that observed previously in NMR studies of the native sodium and potassium forms, and a crystallographic analysis of it complexed with an O. nova protein. The present analysis demonstrates that the native structure is the same in solution and in the crystalline state and, moreover, that the nature of the counter-ion does not affect the overall fold of this quadruplex. The analysis corrects an earlier crystallographic study of this quadruplex. The conformation of the tetra-thymine loop is described in detail, which involves the third thymine base folding back to interact with the first thymine base. The water networks in the grooves and loops are described and, in particular, the ability of water molecules to form a continuous spine of hydration in the narrow groove is detailed. Each quadruplex has five potassium ions organised in a linear channel, with square antiprismatic coordination to each ion from oxygen atoms.
1jvc DNA NMR Dimeric DNA Quadruplex Containing Major Groove-Aligned A.T.A.T and G.C.G.C Tetrads Stabilized by Inter-Subunit Watson-Crick A:T and G:C Pairs; 3Dmol view (2001) "Dimeric DNA quadruplex containing major groove-aligned A-T-A-T and G-C-G-C tetrads stabilized by inter-subunit Watson-Crick A-T and G-C pairs." J.Mol.Biol., 312, 1073-1088. pubmed Zhang, N., Gorin, A., Majumdar, A., Kettani, A., Chernichenko, N., Skripkin, E., Patel, D.J. We report on an NMR study of unlabeled and uniformly 13C,15N-labeled d(GAGCAGGT) sequence in 1 M NaCl solution, conditions under which it forms a head-to-head dimeric quadruplex containing sequentially stacked G-C-G-C, G-G-G-G and A-T-A-T tetrads. We have identified, for the first time, a slipped A-T-A-T tetrad alignment, involving recognition of Watson-Crick A-T pairs along the major groove edges of opposing adenine residues. Strikingly, both Watson-Crick G-C and A-T pairings within the direct G-C-G-C and slipped A-T-A-T tetrads, respectively, occur between rather than within hairpin subunits of the dimeric d(GAGCAGGT) quadruplex. The hairpin turns in the head-to-head dimeric quadruplex involve single adenine residues and adds to our knowledge of chain reversal involving edgewise loops in DNA quadruplexes. Our structural studies, together with those from other laboratories, definitively establish that DNA quadruplex formation is not restricted to G(n) repeat sequences, with their characteristic stacked uniform G-G-G-G tetrad architectures. Rather, the quadruplex fold is a more versatile and robust architecture, accessible to a range of mixed sequences, with the potential to facilitate G-C-G-C and A-T-A-T tetrad through major and minor groove alignment, in addition to G-G-G-G tetrad formation. The definitive experimental identification of such major groove-aligned mixed A-T-A-T and G-C-G-C tetrads within a quadruplex scaffold, has important implications for the potential alignment of duplex segments during homologous recombination.
1k4x DNA NMR POTASSIUM FORM OF OXY-1.5 QUADRUPLEX DNA; 3Dmol view (1999) "The effect of sodium, potassium and ammonium ions on the conformation of the dimeric quadruplex formed by the Oxytricha nova telomere repeat oligonucleotide d(G(4)T(4)G(4))." Nucleic Acids Res., 27, 3018-3028. pubmed Schultze, P., Hud, N.V., Smith, F.W., Feigon, J. The DNA sequence d(G(4)T(4)G(4)) [Oxy-1.5] consists of 1.5 units of the repeat in telomeres of Oxytricha nova and has been shown by NMR and X-ray crystallographic analysis to form a dimeric quadruplex structure with four guanine-quartets. However, the structure reported in the X-ray study has a fundamentally different conformation and folding topology compared to the solution structure. In order to elucidate the possible role of different counterions in this discrepancy and to investigate the conformational effects and dynamics of ion binding to G-quadruplex DNA, we compare results from further experiments using a variety of counterions, namely K(+), Na(+)and NH(4)(+). A detailed structure determination of Oxy-1.5 in solution in the presence of K(+)shows the same folding topology as previously reported with the same molecule in the presence of Na(+). Both conformations are symmetric dimeric quadruplexes with T(4)loops which span the diagonal of the end quartets. The stack of quartets shows only small differences in the presence of K(+)versus Na(+)counterions, but the T(4)loops adopt notably distinguishable conformations. Dynamic NMR analysis of the spectra of Oxy-1.5 in mixed Na(+)/K(+)solution reveals that there are at least three K(+)binding sites. Additional experiments in the presence of NH(4)(+)reveal the same topology and loop conformation as in the K(+)form and allow the direct localization of three central ions in the stack of quartets and further show that there are no specific NH(4)(+)binding sites in the T(4)loop. The location of bound NH(4)(+)with respect to the expected coordination sites for Na(+)binding provides a rationale for the difference observed for the structure of the T(4)loop in the Na(+)form, with respect to that observed for the K(+)and NH(4)(+)forms.
1k8p DNA X-ray (2.4 Å) Structure of the Human G-quadruplex reveals a novel topology; 3Dmol view (2002) "Crystal structure of parallel quadruplexes from human telomeric DNA." Nature, 417, 876-880. pubmed Parkinson, G.N., Lee, M.P., Neidle, S. Comment in Nature. 2002 Jun 20;417(6891):807-8.
1kf1 DNA X-ray (2.1 Å) Structure and Packing of Human Telomeric DNA; 3Dmol view (2002) "Crystal structure of parallel quadruplexes from human telomeric DNA." Nature, 417, 876-880. pubmed Parkinson, G.N., Lee, M.P., Neidle, S. Comment in Nature. 2002 Jun 20;417(6891):807-8.
1l1h DNA X-ray (1.75 Å) Crystal Structure of the Quadruplex DNA-Drug Complex; 3Dmol view (2003) "Structure of a G-quadruplex-Ligand Complex." J.Mol.Biol., 326, 117-125. pubmed Haider, S.M., Parkinson, G.N., Neidle, S. Stabilisation of G-quadruplex structures formed from telomeric DNA, by means of quadruplex-selective ligands, is a means of inhibiting the telomerase enzyme from catalysing the synthesis of telomeric DNA repeats. In order to understand the molecular basis of ligand-quadruplex recognition, the crystal structure has been determined of such a complex, at 1.75A resolution. This complex is between a dimeric antiparallel G-quadruplex formed from the Oxytricha nova telomeric DNA sequence d(GGGGTTTTGGGG), and a di-substituted aminoalkylamido acridine compound. The structure shows that the acridine moiety is bound at one end of the stack of G-quartets, within one of the thymine loops. It is held in place by a combination of stacking interactions and specific hydrogen bonds with thymine bases. The stability of the ligand in this binding site has been confirmed by a 2ns molecular dynamics simulation.
1lvs DNA NMR THE SOLUTION STRUCTURE OF D(G4T4G3)2; 3Dmol view (2002) "The solution structure of d(G(4)T(4)G(3))(2): a bimolecular G-quadruplex with a novel fold." J.Mol.Biol., 320, 911-924. pubmed Crnugelj, M., Hud, N.V., Plavec, J. The G-rich 11-mer oligonucleotide d(G(4)T(4)G(3)) forms a bimolecular G-quadruplex in the presence of sodium ions with a topology that is distinct from the folds of the closely related and well-characterized sequences d(G(4)T(4)G(4)) and d(G(3)T(4)G(3)). The solution structure of d(G(4)T(4)G(3))(2) has been determined using a combination of NMR spectroscopy and restrained molecular dynamics calculations. d(G(4)T(4)G(3))(2) forms an asymmetric dimeric fold-back structure consisting of three stacked G-quartets. The two T(4) loops that span diagonally across the outer faces of the G-quartets assume different conformations. The glycosidic torsion angle conformations of the guanine bases are 5'-syn-anti-syn-anti-(T(4) loop)-anti-syn-anti in one strand and 5'-syn-anti-syn-anti-(T(4) loop)-syn-anti-syn in the other strand. The guanine bases of the two outer G-quartets exhibit a clockwise donor-acceptor hydrogen-bonding directionality, while those of the middle G-quartet exhibit the anti-clockwise directionality. The topology of this G-quadruplex, like other bimolecular fold-back structures with diagonal loops, places each strand of the G-quartet region next to a neighboring parallel and an anti-parallel strand. The two guanine residues not involved in G-quartet formation, G4 and G12 (i.e. the fourth guanine base of one strand and the first guanine base of the other strand), adopt distinct conformations. G4 is stacked on top of an adjacent G-quartet, and this base-stacking continues along with the bases of the loop residues T5 and T6. G12 is orientated away from the core of G-quartets; stacked on the T7 base and apparently involved in hydrogen-bonding interactions with the phosphodiester group of this same residue. The cation-dependent folding of the d(G(4)T(4)G(3))(2) quadruplex structure is distinct from that observed for similar sequences. While both d(G(4)T(4)G(4)) and d(G(3)T(4)G(3)) form bimolecular, diagonally looped G-quadruplex structures in the presence of Na(+), K(+) and NH(4)(+), we have observed this folding to be favored for d(G(4)T(4)G(3)) in the presence of Na(+), but not in the presence of K(+) or NH(4)(+). The structure of d(G(4)T(4)G(3))(2) exhibits a "slipped-loop" element that is similar to what has been proposed for structural intermediates in the folding pathway of some G-quadruplexes, and therefore provides support for the feasibility of these proposed transient structures in G-quadruplex formation.
1mdg RNA X-ray (1.5 Å) An Alternating Antiparallel Octaplex in an RNA Crystal Structure; 3Dmol view (2003) "An Eight-Stranded Helical Fragment in RNA Crystal Structure: Implications for Tetraplex Interaction." Structure, 11, 825-831. pubmed Pan, B.C., Xiong, Y., Shi, K., Sundaralingam, M. Multistranded helical structures in nucleic acids play various functions in biological processes. Here we report the crystal structure of a hexamer, rU(BrdG)r(AGGU),at 1.5 A resolution containing a structural complex of an alternating antiparallel eight-stranded helical fragment that is sandwiched in two tetraplexes. The octaplex is formed by groove binding interaction and base tetrad intercalation between two tetraplexes. Two different forms of octaplexes have been proposed, which display different properties in interaction with proteins and nucleic acids. Adenines form a base tetrad in the novel N6-H em leader N3 conformation and further interact with uridines to form an adenine-uridine octad in the reverse Hoogsteen pairing scheme. The conformational flexibility of adenine tetrad indicates that it can optimize its conformation in different interactions.
1my9 RNA NMR Solution structure of a K+ cation stabilized dimeric RNA quadruplex containing two G:G(:A):G:G(:A) hexads, G:G:G:G tetrads and UUUU loops; 3Dmol view (2002) "A Dimeric RNA Quadruplex Architecture Comprised of Two G:G(:A):G:G(:A) Hexads, G:G:G:G Tetrads and UUUU Loops." J.Mol.Biol., 322, 955-970. pubmed Liu, H., Matsugami, A., Katahira, M., Uesugi, S. Using CD and NMR, we determined the structure of an RNA oligomer, r(GGAGGUUUUGGAGG) (R14), comprising two GGAGG segments joined by a UUUU segment. A modified quadruplex structure was observed for r(GGAGGUUUUGGAGG) in solution even in the absence of K(+). An unusually stable dimeric RNA quadruplex architecture formed from two strands of r(GGAGGUUUUGGAGG) at low K(+) concentration is reported here. In each strand of r(GGAGGUUUUGGAGG), two sets of successive turns in the GGAGG segments and turns at both ends of the UUUU loops drive four G-G steps to align in a parallel manner, a core with two stacked G-tetrads being formed. Two adenine bases bind to two edges of one G:G:G:G tetrad through the sheared G:A mismatch augmenting the tetrad into a G:G(:A):G:G(:A) hexad. Thus, one molecule of r(GGAGGUUUUGGAGG) folds into a modified quadruplex comprising a G:G:G:G tetrad, a UUUU double-chain reversal loop and a G:G(:A):G:G(:A) hexad. Two such molecules further associate by stacking through the dimeric hexad-hexad interface with a rotational symmetry. The ribose rings of most nucleotides take S (close to C2'-endo) puckering, which is unusual for an RNA. K(+) can increase the stability of this quadruplex structure; the number of bound K(+) was estimated from the results of the titration experiment. Besides G:G and G:A mismatches, a network of hydrogen bonds including O4'-NH(2) and C-H..O hydrogen bonds, and the extensive base stacking contribute to the high thermodynamic stability of R14. Our results could provide the stereochemical and thermodynamic basis for elucidating the biological role of the GGAGG-containing RNA segments abundantly existing in various RNAs. Relevance to quadruplex-mediated mRNA-FMRP binding and HIV-1 genome RNA dimerization is discussed.
1myq DNA NMR An intramolecular quadruplex of (GGA)(4) triplet repeat DNA with a G:G:G:G tetrad and a G(:A):G(:A):G(:A):G heptad, and its dimeric interaction; 3Dmol view (2001) "An intramolecular quadruplex of (GGA)(4) triplet repeat DNA with a G:G:G:G tetrad and a G(:A):G(:A):G(:A):G heptad, and its dimeric interaction." J.Mol.Biol., 313, 255-269. pubmed Matsugami, A., Ouhashi, K., Kanagawa, M., Liu, H., Kanagawa, S., Uesugi, S., Katahira, M. The structure of d(GGAGGAGGAGGA) containing four tandem repeats of a GGA triplet sequence has been determined under physiological K(+) conditions. d(GGAGGAGGAGGA) folds into an intramolecular quadruplex composed of a G:G:G:G tetrad and a G(:A):G(:A):G(:A):G heptad. Four G-G segments of d(GGAGGAGGAGGA) are aligned parallel with each other due to six successive turns of the main chain at each of the GGA and GAGG segments. Two quadruplexes form a dimer stabilized through a stacking interaction between the heptads of the two quadruplexes. Comparison of the structure of d(GGAGGAGGAGGA) with the reported structure of d(GGAGGAN) (N=G or T) containing two tandem repeats of the GGA triplet revealed that although the two structures resemble each other to some extent, the extension of the repeats of the GGA triplet leads to distinct structural differences: intramolecular quadruplex for 12-mer versus intermolecular quadruplex for 7-mer; heptad versus hexad in the quadruplex; and three sheared G:A base-pairs versus two sheared G:A base-pairs plus one A:A base-pair per quadruplex. It was also suggested that d(GGAGGAGGAGGA) forms a similar quadruplex under low salt concentration conditions. This is in contrast to the case of d(GGAGGAN) (N=G or T), which forms a duplex under low salt concentration conditions. On the basis of these results, the structure of naturally occurring GGA triplet repeat DNA is discussed.
1n7a DNA, RNA X-ray (1.2 Å) RIP-Radiation-damage Induced Phasing; 3Dmol view (2003) "Specific Radiation-Damage Can Be Used To Solve Macromolecular Crystal Structures." Structure, 11, 217-224. pubmed Ravelli, R.B.G., Leiros, H.-K.S., Pan, B., Caffrey, M., McSweeney, S. The use of third generation synchrotron sources has led to renewed concern about the effect of ionizing radiation on crystalline biological samples. In general, the problem is seen as one to be avoided. However, in this paper, it is shown that, far from being a hindrance to successful structure determination, radiation damage provides an opportunity for phasing macromolecular structures. This is successfully demonstrated for both a protein and an oligonucleotide, by way of which complete models were built automatically. The possibility that, through the exploitation of radiation damage, the phase problem could become less of a barrier to macromolecular crystal structure determination is discussed.
1n7b DNA, RNA X-ray (1.4 Å) RIP-Radiation-damage Induced Phasing; 3Dmol view (2003) "Specific Radiation-Damage Can Be Used To Solve Macromolecular Crystal Structures." Structure, 11, 217-224. pubmed Ravelli, R.B.G., Leiros, H.-K.S., Pan, B., Caffrey, M., McSweeney, S. The use of third generation synchrotron sources has led to renewed concern about the effect of ionizing radiation on crystalline biological samples. In general, the problem is seen as one to be avoided. However, in this paper, it is shown that, far from being a hindrance to successful structure determination, radiation damage provides an opportunity for phasing macromolecular structures. This is successfully demonstrated for both a protein and an oligonucleotide, by way of which complete models were built automatically. The possibility that, through the exploitation of radiation damage, the phase problem could become less of a barrier to macromolecular crystal structure determination is discussed.
1np9 DNA NMR Structure of the parallel-stranded DNA quadruplex d(TTAGGGA)4 containing the human telomeric repeat; 3Dmol view (2003) "Structure of the parallel-stranded DNA quadruplex d(TTAGGGT)4 containing the human telomeric repeat: evidence for A-tetrad formation from NMR and molecular dynamics simulations." ORG.BIOMOL.CHEM., 1, 1650-1656. pubmed Gavathiotis, E., Searle, M.S. The structure of the intermolecular DNA quadruplex d(TTAGGGT)4, based on the human telomeric DNA sequence d(TTAGGG), has been determined in solution by NMR and restrained molecular dynamics simultations. The core GGG region forms a highly stable quadruplex with G-tetrads likely stabilised by K+ ions bound between tetrad plains. However, we have focused on the conformation of the adenines which differ considerably in base alignment, stability and dynamics from those in previously reported structures of d(AGGGT)4 and d(TAGGGT)4. We show unambiguously that the adenines of d(TTAGGGT)4 are involved in the formation of a relatively stable A-tetrad with well-defined glycosidic torsion angles (anti), hydrogen bonding network (adenine 6-NH2-adenine N1) defined by interbase NOEs, and base stacking interactions with the neighbouring G-tetrad. All of these structural features are apparent from NOE data involving both exchangeable and non-exchangeable protons. Thus, context-dependent effects appear to play some role in dictating preferred conformation, stability and dynamics. The structure of d(TTAGGGT)4 provides us with a model system for exploiting in the design of novel telomerase inhibitors that bind to and stabilise G-quadruplex structures.
1nyd DNA NMR Solution structure of DNA quadruplex GCGGTGGAT; 3Dmol view (2003) "Association of DNA quadruplexes through G:C:G:C tetrads. Solution structure of d(GCGGTGGAT)." Biochemistry, 42, 14356-14365. pubmed Webba da Silva, M. The structure formed by the DNA sequence d(GCGGTGGAT) in a 100 mM Na(+) solution has been determined using molecular dynamics calculations constrained by distance and dihedral restraints derived from NMR experiments performed at isotopic natural abundance. The sequence folds into a dimer of dimers. Each symmetry-related half contains two parallel stranded G:G:G:G tetrads flanked by an A:A mismatch and by four-stranded G:C:G:C tetrads. Each of the two juxtaposed G:C:G:C tetrads is composed of alternating antiparallel strands from the two halves of the dimer. For each single strand, a thymine intersperses a double chain reversal connecting the juxtaposed G:G:G:G tetrads. This architecture has potential implications in genetic recombination. It suggests a pathway for oligomerization involving association of quadruplex entities through GpC steps.
1nzm DNA NMR NMR structure of the parallel-stranded DNA quadruplex d(TTAGGGT)4 complexed with the telomerase inhibitor RHPS4; 3Dmol view (2003) "Drug Recognition and Stabilisation of the Parallel-stranded DNA Quadruplex d(TTAGGGT)4 Containing the Human Telomeric Repeat." J.Mol.Biol., 334, 25-36. pubmed Gavathiotis, E., Heald, R.A., Stevens, M.F.G., Searle, M.S. The NMR structure of the parallel-stranded DNA quadruplex d(TTAGGGT)(4), containing the human telomeric repeat, has been determined in solution in complex with a fluorinated pentacyclic quino[4,3,2-kl]acridinium cation (RHPS4). RHPS4 has been identified as a potent inhibitor of telomerase at submicromolar levels (IC(50) value of 0.33(+/-0.13)microM), exhibiting a wide differential between telomerase inhibition and acute cellular toxicity. All of the data point to RHPS4 exerting its chemotherapeutic potency through interaction with, and stabilisation of, four-stranded G-quadruplex structures. RHPS4 forms a dynamic interaction with d(TTAGGGT)(4), as evident from 1H and 19F linewidths, with fast exchange between binding sites induced at 318 K. Perturbations to DNA chemical shifts and 24 intermolecular nuclear Overhauser effects (NOEs) identify the 5'-ApG and 5'-GpT steps as the principle intercalation sites; a structural model has been refined using NOE-restrained molecular dynamics. The central G-tetrad core remains intact, with drug molecules stacking at the ends of the G-quadruplex. The partial positive charge on position 13-N of the acridine ring appears to act as a "pseudo" potassium ion and is positioned above the centre of the G-tetrad in the region of high negative charge density. In both ApG and GpT intercalation sites, the drug is seen to converge to the same orientation in which the pi-system of the drug overlaps primarily with two bases of each G-tetrad. The drug is held in place by stacking interactions with the G-tetrads; however, there is some evidence for a more dynamic, weakly stabilised A-tetrad that stacks partially on top of the drug at the 5'-end of the sequence. Together, the interactions of RHPS4 increase the t(m) of the quadruplex by approximately 20 degrees C. There is no evidence for drug intercalation within the G-quadruplex; however, the structural model strongly supports end-stacking interactions with the terminal G-tetrads.
1o0k DNA X-ray (1.17 Å) Structure of the First Parallel DNA Quadruplex-drug Complex; 3Dmol view (2003) "Structure of the First Parallel DNA Quadruplex-drug Complex." J.Am.Chem.Soc., 125, 4066-4067. pubmed Clark, G.R., Pytel, P.D., Squire, C.J., Neidle, S. The first crystal structure of a drug (daunomycin) bound to a parallel-stranded intermolecular telomeric G4 quadruplex (d(TGGGGT)4) has been determined to high resolution. A planar assemblage of three daunomycin molecules stacks onto the 5' end of the G4 column, with the daunosamine substituents occupying three of the four quadruplex grooves. The surface area of the terminal G-quartet in this parallel DNA quadruplex, presently occupied by three daunomycins, is sufficiently large that it could easily accommodate other potential telomerase inhibitors such as substituted porphyrins or telomestatin.
1oz8 DNA NMR Intramolecular higher-order packing of parallel quadruplexes comprising a G:G:G:G tetrad and a G(:A):G(:A):G(:A):G heptad of GGA triplet repeat DNA; 3Dmol view (2003) "Intramolecular Higher Order Packing of Parallel Quadruplexes Comprising a G:G:G:G Tetrad and a G(:A):G(:A):G(:A):G Heptad of GGA Triplet Repeat DNA." J.BIOL.CHEM., 278, 28147-28153. pubmed Matsugami, A., Okuizumi, T., Uesugi, S., Katahira, M. GGA triplet repeats are widely dispersed throughout eukaryotic genomes and are frequently located within biologically important regions such as gene regulatory regions and recombination hot spot sites. We determined the structure of d(GGA)4 (12-mer) under physiological conditions and founded the formation of an intramolecular parallel quadruplex for the first time. Later, a similar architecture to that of the intramolecular parallel quadruplex was found for a telomere DNA in the crystalline state. Here, we have determined the structure of d(GGA)8 (24-mer) under physiological conditions. Two intramolecular parallel quadruplexes comprising a G:G:G:G tetrad and a G(:A):G(:A):G(:A):G heptad are formed in d(GGA)8. These quadruplexes are packed in a tail-to-tail manner. This is the first demonstration of the intramolecular higher order packing of quadruplexes at atomic resolution. K+ ions, but not Na+ ones, are critically required for the formation of this unique structure. The elucidated structure suggests the mechanisms underlying the biological events related to the GGA triplet repeat. Furthermore, in the light of the structure, the mode of the higher order packing of the telomere DNA is discussed.
1pa6 DNA binding protein-DNA X-ray (2.45 Å) Crystal structure of the OXYTRICHA nova telomere end-binding protein complexed with noncognate ssDNA GGGGTTTTGAGG; 3Dmol view (2003) "Nucleotide shuffling and ssDNA recognition in Oxytricha nova telomere end-binding protein complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C. Sequence-specific protein recognition of single-stranded nucleic acids is critical for many fundamental cellular processes, such as DNA replication, DNA repair, transcription, translation, recombination, apoptosis and telomere maintenance. To explore the mechanisms of sequence-specific ssDNA recognition, we determined the crystal structures of 10 different non-cognate ssDNAs complexed with the Oxytricha nova telomere end-binding protein (OnTEBP) and evaluated their corresponding binding affinities (PDB ID codes 1PH1-1PH9 and 1PHJ). The thermodynamic and structural effects of these sequence perturbations could not have been predicted based solely upon the cognate structure. OnTEBP accommodates non-cognate nucleotides by both subtle adjustments and surprisingly large structural rearrangements in the ssDNA. In two complexes containing ssDNA intermediates that occur during telomere extension by telomerase, entire nucleotides are expelled from the complex. Concurrently, the sequence register of the ssDNA shifts to re-establish a more cognate-like pattern. This phenomenon, termed nucleotide shuffling, may be of general importance in protein recognition of single-stranded nucleic acids. This set of structural and thermodynamic data highlights a fundamental difference between protein recognition of ssDNA versus dsDNA.
1ph1 DNA binding protein-DNA X-ray (2.51 Å) CRYSTAL STRUCTURE OF THE OXYTRICHA NOVA TELOMERE END-BINDING PROTEIN COMPLEXED WITH NONCOGNATE SSDNA GGGGTTTTGGGGT; 3Dmol view (2003) "Nucleotide Shuffling and Ssdna Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C. Sequence-specific protein recognition of single-stranded nucleic acids is critical for many fundamental cellular processes, such as DNA replication, DNA repair, transcription, translation, recombination, apoptosis and telomere maintenance. To explore the mechanisms of sequence-specific ssDNA recognition, we determined the crystal structures of 10 different non-cognate ssDNAs complexed with the Oxytricha nova telomere end-binding protein (OnTEBP) and evaluated their corresponding binding affinities (PDB ID codes 1PH1-1PH9 and 1PHJ). The thermodynamic and structural effects of these sequence perturbations could not have been predicted based solely upon the cognate structure. OnTEBP accommodates non-cognate nucleotides by both subtle adjustments and surprisingly large structural rearrangements in the ssDNA. In two complexes containing ssDNA intermediates that occur during telomere extension by telomerase, entire nucleotides are expelled from the complex. Concurrently, the sequence register of the ssDNA shifts to re-establish a more cognate-like pattern. This phenomenon, termed nucleotide shuffling, may be of general importance in protein recognition of single-stranded nucleic acids. This set of structural and thermodynamic data highlights a fundamental difference between protein recognition of ssDNA versus dsDNA.
1ph2 DNA binding protein-DNA X-ray (3.1 Å) CRYSTAL STRUCTURE OF THE OXYTRICHA NOVA TELOMERE END-BINDING PROTEIN COMPLEXED WITH NONCOGNATE SSDNA GGGGTTTTG; 3Dmol view (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C. Sequence-specific protein recognition of single-stranded nucleic acids is critical for many fundamental cellular processes, such as DNA replication, DNA repair, transcription, translation, recombination, apoptosis and telomere maintenance. To explore the mechanisms of sequence-specific ssDNA recognition, we determined the crystal structures of 10 different non-cognate ssDNAs complexed with the Oxytricha nova telomere end-binding protein (OnTEBP) and evaluated their corresponding binding affinities (PDB ID codes 1PH1-1PH9 and 1PHJ). The thermodynamic and structural effects of these sequence perturbations could not have been predicted based solely upon the cognate structure. OnTEBP accommodates non-cognate nucleotides by both subtle adjustments and surprisingly large structural rearrangements in the ssDNA. In two complexes containing ssDNA intermediates that occur during telomere extension by telomerase, entire nucleotides are expelled from the complex. Concurrently, the sequence register of the ssDNA shifts to re-establish a more cognate-like pattern. This phenomenon, termed nucleotide shuffling, may be of general importance in protein recognition of single-stranded nucleic acids. This set of structural and thermodynamic data highlights a fundamental difference between protein recognition of ssDNA versus dsDNA.
1ph3 DNA binding protein-DNA X-ray (2.3 Å) CRYSTAL STRUCTURE OF THE OXYTRICHA NOVA TELOMERE END-BINDING PROTEIN COMPLEXED WITH NONCOGNATE SSDNA GGGGTTTTGGTG; 3Dmol view (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C. Sequence-specific protein recognition of single-stranded nucleic acids is critical for many fundamental cellular processes, such as DNA replication, DNA repair, transcription, translation, recombination, apoptosis and telomere maintenance. To explore the mechanisms of sequence-specific ssDNA recognition, we determined the crystal structures of 10 different non-cognate ssDNAs complexed with the Oxytricha nova telomere end-binding protein (OnTEBP) and evaluated their corresponding binding affinities (PDB ID codes 1PH1-1PH9 and 1PHJ). The thermodynamic and structural effects of these sequence perturbations could not have been predicted based solely upon the cognate structure. OnTEBP accommodates non-cognate nucleotides by both subtle adjustments and surprisingly large structural rearrangements in the ssDNA. In two complexes containing ssDNA intermediates that occur during telomere extension by telomerase, entire nucleotides are expelled from the complex. Concurrently, the sequence register of the ssDNA shifts to re-establish a more cognate-like pattern. This phenomenon, termed nucleotide shuffling, may be of general importance in protein recognition of single-stranded nucleic acids. This set of structural and thermodynamic data highlights a fundamental difference between protein recognition of ssDNA versus dsDNA.
1ph4 DNA binding protein-DNA X-ray (2.3 Å) CRYSTAL STRUCTURE OF THE OXYTRICHA NOVA TELOMERE END-BINDING PROTEIN COMPLEXED WITH NONCOGNATE SSDNA GGGGTTTTGGCG; 3Dmol view (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C. Sequence-specific protein recognition of single-stranded nucleic acids is critical for many fundamental cellular processes, such as DNA replication, DNA repair, transcription, translation, recombination, apoptosis and telomere maintenance. To explore the mechanisms of sequence-specific ssDNA recognition, we determined the crystal structures of 10 different non-cognate ssDNAs complexed with the Oxytricha nova telomere end-binding protein (OnTEBP) and evaluated their corresponding binding affinities (PDB ID codes 1PH1-1PH9 and 1PHJ). The thermodynamic and structural effects of these sequence perturbations could not have been predicted based solely upon the cognate structure. OnTEBP accommodates non-cognate nucleotides by both subtle adjustments and surprisingly large structural rearrangements in the ssDNA. In two complexes containing ssDNA intermediates that occur during telomere extension by telomerase, entire nucleotides are expelled from the complex. Concurrently, the sequence register of the ssDNA shifts to re-establish a more cognate-like pattern. This phenomenon, termed nucleotide shuffling, may be of general importance in protein recognition of single-stranded nucleic acids. This set of structural and thermodynamic data highlights a fundamental difference between protein recognition of ssDNA versus dsDNA.
1ph5 DNA binding protein-DNA X-ray (2.3 Å) CRYSTAL STRUCTURE OF THE OXYTRICHA NOVA TELOMERE END-BINDING PROTEIN COMPLEXED WITH NONCOGNATE SSDNA GGGGTTTTG(3DR)GG; 3Dmol view (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C. Sequence-specific protein recognition of single-stranded nucleic acids is critical for many fundamental cellular processes, such as DNA replication, DNA repair, transcription, translation, recombination, apoptosis and telomere maintenance. To explore the mechanisms of sequence-specific ssDNA recognition, we determined the crystal structures of 10 different non-cognate ssDNAs complexed with the Oxytricha nova telomere end-binding protein (OnTEBP) and evaluated their corresponding binding affinities (PDB ID codes 1PH1-1PH9 and 1PHJ). The thermodynamic and structural effects of these sequence perturbations could not have been predicted based solely upon the cognate structure. OnTEBP accommodates non-cognate nucleotides by both subtle adjustments and surprisingly large structural rearrangements in the ssDNA. In two complexes containing ssDNA intermediates that occur during telomere extension by telomerase, entire nucleotides are expelled from the complex. Concurrently, the sequence register of the ssDNA shifts to re-establish a more cognate-like pattern. This phenomenon, termed nucleotide shuffling, may be of general importance in protein recognition of single-stranded nucleic acids. This set of structural and thermodynamic data highlights a fundamental difference between protein recognition of ssDNA versus dsDNA.
1ph6 DNA binding protein-DNA X-ray (2.1 Å) Crystal Structure of THE OXYTRICHA NOVA TELOMERE END-BINDING PROTEIN COMPLEXED WITH NONCOGNATE SSDNA GGGGTTTTGTGG; 3Dmol view (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C. Sequence-specific protein recognition of single-stranded nucleic acids is critical for many fundamental cellular processes, such as DNA replication, DNA repair, transcription, translation, recombination, apoptosis and telomere maintenance. To explore the mechanisms of sequence-specific ssDNA recognition, we determined the crystal structures of 10 different non-cognate ssDNAs complexed with the Oxytricha nova telomere end-binding protein (OnTEBP) and evaluated their corresponding binding affinities (PDB ID codes 1PH1-1PH9 and 1PHJ). The thermodynamic and structural effects of these sequence perturbations could not have been predicted based solely upon the cognate structure. OnTEBP accommodates non-cognate nucleotides by both subtle adjustments and surprisingly large structural rearrangements in the ssDNA. In two complexes containing ssDNA intermediates that occur during telomere extension by telomerase, entire nucleotides are expelled from the complex. Concurrently, the sequence register of the ssDNA shifts to re-establish a more cognate-like pattern. This phenomenon, termed nucleotide shuffling, may be of general importance in protein recognition of single-stranded nucleic acids. This set of structural and thermodynamic data highlights a fundamental difference between protein recognition of ssDNA versus dsDNA.
1ph7 DNA binding protein-DNA X-ray (2.9 Å) CRYSTAL STRUCTURE OF THE OXYTRICHA NOVA TELOMERE END-BINDING PROTEIN COMPLEXED WITH NONCOGNATE SSDNA GGGGTTTTGIGG; 3Dmol view (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C. Sequence-specific protein recognition of single-stranded nucleic acids is critical for many fundamental cellular processes, such as DNA replication, DNA repair, transcription, translation, recombination, apoptosis and telomere maintenance. To explore the mechanisms of sequence-specific ssDNA recognition, we determined the crystal structures of 10 different non-cognate ssDNAs complexed with the Oxytricha nova telomere end-binding protein (OnTEBP) and evaluated their corresponding binding affinities (PDB ID codes 1PH1-1PH9 and 1PHJ). The thermodynamic and structural effects of these sequence perturbations could not have been predicted based solely upon the cognate structure. OnTEBP accommodates non-cognate nucleotides by both subtle adjustments and surprisingly large structural rearrangements in the ssDNA. In two complexes containing ssDNA intermediates that occur during telomere extension by telomerase, entire nucleotides are expelled from the complex. Concurrently, the sequence register of the ssDNA shifts to re-establish a more cognate-like pattern. This phenomenon, termed nucleotide shuffling, may be of general importance in protein recognition of single-stranded nucleic acids. This set of structural and thermodynamic data highlights a fundamental difference between protein recognition of ssDNA versus dsDNA.
1ph8 DNA binding protein-DNA X-ray (2.36 Å) CRYSTAL STRUCTURE OF THE OXYTRICHA NOVA TELOMERE END-BINDING PROTEIN COMPLEXED WITH NONCOGNATE SSDNA GGGGTTTTGCGG; 3Dmol view (2003) "Nucleotide Shuffling and Ssdna Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C. Sequence-specific protein recognition of single-stranded nucleic acids is critical for many fundamental cellular processes, such as DNA replication, DNA repair, transcription, translation, recombination, apoptosis and telomere maintenance. To explore the mechanisms of sequence-specific ssDNA recognition, we determined the crystal structures of 10 different non-cognate ssDNAs complexed with the Oxytricha nova telomere end-binding protein (OnTEBP) and evaluated their corresponding binding affinities (PDB ID codes 1PH1-1PH9 and 1PHJ). The thermodynamic and structural effects of these sequence perturbations could not have been predicted based solely upon the cognate structure. OnTEBP accommodates non-cognate nucleotides by both subtle adjustments and surprisingly large structural rearrangements in the ssDNA. In two complexes containing ssDNA intermediates that occur during telomere extension by telomerase, entire nucleotides are expelled from the complex. Concurrently, the sequence register of the ssDNA shifts to re-establish a more cognate-like pattern. This phenomenon, termed nucleotide shuffling, may be of general importance in protein recognition of single-stranded nucleic acids. This set of structural and thermodynamic data highlights a fundamental difference between protein recognition of ssDNA versus dsDNA.
1ph9 DNA binding protein-DNA X-ray (2.5 Å) CRYSTAL STRUCTURE OF THE OXYTRICHA NOVA TELOMERE END-BINDING PROTEIN COMPLEXED WITH NONCOGNATE SSDNA GGGGTTTTGAGG; 3Dmol view (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C. Sequence-specific protein recognition of single-stranded nucleic acids is critical for many fundamental cellular processes, such as DNA replication, DNA repair, transcription, translation, recombination, apoptosis and telomere maintenance. To explore the mechanisms of sequence-specific ssDNA recognition, we determined the crystal structures of 10 different non-cognate ssDNAs complexed with the Oxytricha nova telomere end-binding protein (OnTEBP) and evaluated their corresponding binding affinities (PDB ID codes 1PH1-1PH9 and 1PHJ). The thermodynamic and structural effects of these sequence perturbations could not have been predicted based solely upon the cognate structure. OnTEBP accommodates non-cognate nucleotides by both subtle adjustments and surprisingly large structural rearrangements in the ssDNA. In two complexes containing ssDNA intermediates that occur during telomere extension by telomerase, entire nucleotides are expelled from the complex. Concurrently, the sequence register of the ssDNA shifts to re-establish a more cognate-like pattern. This phenomenon, termed nucleotide shuffling, may be of general importance in protein recognition of single-stranded nucleic acids. This set of structural and thermodynamic data highlights a fundamental difference between protein recognition of ssDNA versus dsDNA.
1phj DNA binding protein-DNA X-ray (2.5 Å) CRYSTAL STRUCTURE OF THE OXYTRICHA NOVA TELOMERE END-BINDING PROTEIN COMPLEXED WITH NONCOGNATE SSDNA GG(3DR)GTTTTGGGG; 3Dmol view (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. pubmed Theobald, D.L., Schultz, S.C. Sequence-specific protein recognition of single-stranded nucleic acids is critical for many fundamental cellular processes, such as DNA replication, DNA repair, transcription, translation, recombination, apoptosis and telomere maintenance. To explore the mechanisms of sequence-specific ssDNA recognition, we determined the crystal structures of 10 different non-cognate ssDNAs complexed with the Oxytricha nova telomere end-binding protein (OnTEBP) and evaluated their corresponding binding affinities (PDB ID codes 1PH1-1PH9 and 1PHJ). The thermodynamic and structural effects of these sequence perturbations could not have been predicted based solely upon the cognate structure. OnTEBP accommodates non-cognate nucleotides by both subtle adjustments and surprisingly large structural rearrangements in the ssDNA. In two complexes containing ssDNA intermediates that occur during telomere extension by telomerase, entire nucleotides are expelled from the complex. Concurrently, the sequence register of the ssDNA shifts to re-establish a more cognate-like pattern. This phenomenon, termed nucleotide shuffling, may be of general importance in protein recognition of single-stranded nucleic acids. This set of structural and thermodynamic data highlights a fundamental difference between protein recognition of ssDNA versus dsDNA.
1qdf DNA NMR THE NMR STUDY OF DNA QUADRUPLEX STRUCTURE, APTAMER (15MER) DNA; 3Dmol view (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. pubmed Marathias, V.M., Wang, K.Y., Kumar, S., Pham, T.Q., Swaminathan, S., Bolton, P.H. The interaction of a DNA quadruplex with thrombin has been studied by first determining the sites of manganese binding to the quadruplex in the absence of thrombin. This has been followed by determining if the interactions with thrombin displace the bound manganese. A different DNA quadruplex has also been studied as a control. The refined solution structures of two DNA quadruplexes have been used to predict the electrostatic potentials of these DNAs. The calculated electrostatic potentials have been used to predict the locations of the binding sites of the paramagnetic ion manganese to these DNAs. The enhanced relaxation of DNA protons due to the binding of the paramagnetic metal ion Mn2+ has been used to experimentally determine the locations of the binding sites. The NMR results and the predictions based on the electrostatic potentials both place the binding sites of the manganese in the narrow grooves of these quadruplex DNAs. The predicted locations are spatially close to those experimentally observed, and the predicted and experimental locations also have similar electrostatic potential energy. These results have allowed a validation of the predictions of electrostatic potentials from structure. The 15mer quadruplex has two strong Mn2+ binding sites with one in each narrow groove. Both Mn2+ are released when the 15mer is complexed with thrombin, indicating that both narrow grooves are involved in the 15mer-thrombin interactions. The dimer quadruplex has a different structural motif than the 15mer and the presence of thrombin does not appreciably affect its interactions with Mn2+.
1qdh DNA NMR THE NMR STUDY OF DNA QUADRUPLEX STRUCTURE, APTAMER (15MER) DNA; 3Dmol view (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. pubmed Marathias, V.M., Wang, K.Y., Kumar, S., Pham, T.Q., Swaminathan, S., Bolton, P.H. The interaction of a DNA quadruplex with thrombin has been studied by first determining the sites of manganese binding to the quadruplex in the absence of thrombin. This has been followed by determining if the interactions with thrombin displace the bound manganese. A different DNA quadruplex has also been studied as a control. The refined solution structures of two DNA quadruplexes have been used to predict the electrostatic potentials of these DNAs. The calculated electrostatic potentials have been used to predict the locations of the binding sites of the paramagnetic ion manganese to these DNAs. The enhanced relaxation of DNA protons due to the binding of the paramagnetic metal ion Mn2+ has been used to experimentally determine the locations of the binding sites. The NMR results and the predictions based on the electrostatic potentials both place the binding sites of the manganese in the narrow grooves of these quadruplex DNAs. The predicted locations are spatially close to those experimentally observed, and the predicted and experimental locations also have similar electrostatic potential energy. These results have allowed a validation of the predictions of electrostatic potentials from structure. The 15mer quadruplex has two strong Mn2+ binding sites with one in each narrow groove. Both Mn2+ are released when the 15mer is complexed with thrombin, indicating that both narrow grooves are involved in the 15mer-thrombin interactions. The dimer quadruplex has a different structural motif than the 15mer and the presence of thrombin does not appreciably affect its interactions with Mn2+.
1qdi DNA NMR THE NMR STUDY OF DNA QUADRUPLEX STRUCTURE, (12MER) DNA; 3Dmol view (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. pubmed Marathias, V.M., Wang, K.Y., Kumar, S., Pham, T.Q., Swaminathan, S., Bolton, P.H. The interaction of a DNA quadruplex with thrombin has been studied by first determining the sites of manganese binding to the quadruplex in the absence of thrombin. This has been followed by determining if the interactions with thrombin displace the bound manganese. A different DNA quadruplex has also been studied as a control. The refined solution structures of two DNA quadruplexes have been used to predict the electrostatic potentials of these DNAs. The calculated electrostatic potentials have been used to predict the locations of the binding sites of the paramagnetic ion manganese to these DNAs. The enhanced relaxation of DNA protons due to the binding of the paramagnetic metal ion Mn2+ has been used to experimentally determine the locations of the binding sites. The NMR results and the predictions based on the electrostatic potentials both place the binding sites of the manganese in the narrow grooves of these quadruplex DNAs. The predicted locations are spatially close to those experimentally observed, and the predicted and experimental locations also have similar electrostatic potential energy. These results have allowed a validation of the predictions of electrostatic potentials from structure. The 15mer quadruplex has two strong Mn2+ binding sites with one in each narrow groove. Both Mn2+ are released when the 15mer is complexed with thrombin, indicating that both narrow grooves are involved in the 15mer-thrombin interactions. The dimer quadruplex has a different structural motif than the 15mer and the presence of thrombin does not appreciably affect its interactions with Mn2+.
1qdk DNA NMR THE NMR STUDY OF DNA QUADRUPLEX STRUCTURE, (12MER) DNA; 3Dmol view (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. pubmed Marathias, V.M., Wang, K.Y., Kumar, S., Pham, T.Q., Swaminathan, S., Bolton, P.H. The interaction of a DNA quadruplex with thrombin has been studied by first determining the sites of manganese binding to the quadruplex in the absence of thrombin. This has been followed by determining if the interactions with thrombin displace the bound manganese. A different DNA quadruplex has also been studied as a control. The refined solution structures of two DNA quadruplexes have been used to predict the electrostatic potentials of these DNAs. The calculated electrostatic potentials have been used to predict the locations of the binding sites of the paramagnetic ion manganese to these DNAs. The enhanced relaxation of DNA protons due to the binding of the paramagnetic metal ion Mn2+ has been used to experimentally determine the locations of the binding sites. The NMR results and the predictions based on the electrostatic potentials both place the binding sites of the manganese in the narrow grooves of these quadruplex DNAs. The predicted locations are spatially close to those experimentally observed, and the predicted and experimental locations also have similar electrostatic potential energy. These results have allowed a validation of the predictions of electrostatic potentials from structure. The 15mer quadruplex has two strong Mn2+ binding sites with one in each narrow groove. Both Mn2+ are released when the 15mer is complexed with thrombin, indicating that both narrow grooves are involved in the 15mer-thrombin interactions. The dimer quadruplex has a different structural motif than the 15mer and the presence of thrombin does not appreciably affect its interactions with Mn2+.
1rau RNA NMR SOLUTION STRUCTURE OF AN UNUSUALLY STABLE RNA TETRAPLEX CONTAINING G-AND U-QUARTET STRUCTURES; 3Dmol view (1992) "Solution structure of an unusually stable RNA tetraplex containing G- and U-quartet structures." Biochemistry, 31, 8406-8414. pubmed Cheong, C., Moore, P.B. A model for the solution structure of an RNA tetraplex, (rUGGGGU)4, has been obtained by two-dimensional NMR spectroscopy and molecular dynamics. The molecule is parallel stranded and Hoogsteen base-paired in 50 mM KCl, and it is so stable that three of its six imino protons have exchange half-lives measured in days at 40 degrees C. The tetraplex is stabilized by base stacking and by the hydrogen bonds in four G quartets and at least one U quartet. This is the first indication of the existence of U-quartet structures of which we are aware.
1rde DNA NMR NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+; 3Dmol view (2004) "NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+." J.Biomol.Struct.Dyn., 22, 25-33. pubmed Mao, X., Marky, L.A., Gmeiner, W.H. The structure of thrombin-binding DNA aptamer complexed with a single Sr2+ ion (Sr2+:TBA complex) has been determined using NMR spectroscopy and restrained molecular dynamics simulations. The quadruplex structure for the Sr2+:TBA complex is similar in topology, but distinct in structure, from that previously reported for the K+:TBA complex. The inter-tetrad distance of the Sr2+:TBA complex is 3.8 angstroms, or 0.7 angstroms larger than in the K+:TBA complex. This substantial difference can be attributed to a different binding site for Sr2+ in the Sr2+:TBA complex than for K+ in the K+:TBA complex. The Sr2+:TBA complex assumes a 1:1 stoichiometry, and it is very likely that the Sr2+ ion simultaneously interacts with the eight O6 atoms of the two G-tetrads. The results indicate that quadruplex DNA structures are highly sensitive to the presence of specific metal ions. The binding of specific metal ions may modulate the biological activity of quadruplex DNA structures in vivo.
1s45 DNA X-ray (2.2 Å) Crystal structure analysis of the DNA quadruplex d(TGGGGT) S1; 3Dmol view (2004) "A Thymine tetrad in d(TGGGGT) quadruplexes stabilized with Tl+1/Na+1 ions." Nucleic Acids Res., 32, 1097-1102. pubmed Caceres, C., Wright, G., Gouyette, C., Parkinson, G., Subirana, J.A. We report two new structures of the quadruplex d(TGGGGT)4 obtained by single crystal X-ray diffraction. In one of them a thymine tetrad is found. Thus the yeast telomere sequences d(TG1-3) might be able to form continuous quadruplex structures, involving both guanine and thymine tetrads. Our study also shows substantial differences in the arrangement of thymines when compared with previous studies. We find five different types of organization: (i) groove binding with hydrogen bonds to guanines from a neighbour quadruplex; (ii) partially ordered groove binding, without any hydrogen bond; (iii) stacked thymine triads, formed at the 3'ends of the quadruplexes; (iv) a thymine tetrad between two guanine tetrads. Thymines are stabilized in pairs by single hydrogen bonds. A central sodium ion interacts with two thymines and contributes to the tetrad structure. (v) Completely disordered thymines which do not show any clear location in the crystal. The tetrads are stabilized by either Na+ or Tl+ ions. We show that by using MAD methods, Tl+ can be unambiguously located and distinguished from Na+. We can thus determine the preference for either ion in each ionic site of the structure under the conditions used by us.
1s47 DNA X-ray (2.5 Å) Crystal structure analysis of the DNA quadruplex d(TGGGGT)S2; 3Dmol view (2004) "A Thymine tetrad in d(TGGGGT) quadruplexes stabilized with Tl+1/Na+1 ions." Nucleic Acids Res., 32, 1097-1102. pubmed Caceres, C., Wright, G., Gouyette, C., Parkinson, G., Subirana, J.A. We report two new structures of the quadruplex d(TGGGGT)4 obtained by single crystal X-ray diffraction. In one of them a thymine tetrad is found. Thus the yeast telomere sequences d(TG1-3) might be able to form continuous quadruplex structures, involving both guanine and thymine tetrads. Our study also shows substantial differences in the arrangement of thymines when compared with previous studies. We find five different types of organization: (i) groove binding with hydrogen bonds to guanines from a neighbour quadruplex; (ii) partially ordered groove binding, without any hydrogen bond; (iii) stacked thymine triads, formed at the 3'ends of the quadruplexes; (iv) a thymine tetrad between two guanine tetrads. Thymines are stabilized in pairs by single hydrogen bonds. A central sodium ion interacts with two thymines and contributes to the tetrad structure. (v) Completely disordered thymines which do not show any clear location in the crystal. The tetrads are stabilized by either Na+ or Tl+ ions. We show that by using MAD methods, Tl+ can be unambiguously located and distinguished from Na+. We can thus determine the preference for either ion in each ionic site of the structure under the conditions used by us.
1s9l RNA NMR NMR Solution Structure of a Parallel LNA Quadruplex; 3Dmol view (2004) "NMR solution structure of a parallel LNA quadruplex." Nucleic Acids Res., 32, 3083-3092. pubmed Randazzo, A., Esposito, V., Ohlenschlager, O., Ramachandran, R., Mayola, L. The solution structure of a locked nucleic acid (LNA) quadruplex, formed by the oligomer d(TGGGT), containing only conformationally restricted LNA residues is reported. NMR and CD spectroscopy, as well as molecular dynamics and mechanic calculations, has been used to characterize the complex. The molecule adopts a parallel stranded conformation with a 4-fold rotational symmetry, showing a right-handed helicity and the guanine residues in an almost planar conformation with three well-defined G-tetrads. The thermal stability of Q-LNA has been found to be comparable with that of [r(UGGGU)]4, while a T(m) increment of 20 degrees C with respect to the corresponding DNA quadruplex structure [d(TGGGT)]4 has been observed. The structural features of the LNA quadruplex reported here may open new perspectives for the biological application of LNAs as novel versatile tools to design aptamer or catalyst oligonucleotides.
1u64 DNA NMR The Solution Structure of d(G3T4G4)2; 3Dmol view (2004) "d(G3T4G4) forms unusual dimeric G-quadruplex structure with the same general fold in the presence of K+, Na+ or NH4+ ions." Bioorg.Med.Chem., 12, 5735-5744. pubmed Sket, P., Crnugelj, M., Plavec, J. We have recently communicated that DNA oligonucleotide d(G(3)T(4)G(4)) forms a dimeric G-quadruplex in the presence of K(+) ions [J. Am. Chem. Soc.2003, 125, 7866-7871]. The high-resolution NMR structure of d(G(3)T(4)G(4))(2) G-quadruplex exhibits G-quadruplex core consisting of three stacked G-quartets. The two overhanging G3 and G11 residues are located at the opposite sides of the end G-quartets and are not involved in G-quartet formation. d(G(3)T(4)G(4))(2) G-quadruplex represents the first bimolecular G-quadruplex where end G-quartets are spanned by diagonal (T4-T7) as well as edge-type loops (T15-T18). Three of the G-rich strands are parallel while one is anti-parallel. The G12-G22 strand demonstrates a sharp reversal in strand direction between residues G19 and G20 that is accommodated with the leap over the middle G-quartet. The reversal in strand direction is achieved without any extra intervening residues. Here we furthermore examined the influence of different monovalent cations on the folding of d(G(3)T(4)G(4)). The resolved imino and aromatic proton resonances as well as (sequential) NOE connectivity patterns showed only minor differences in key intra- and interquartet NOE intensities in the presence of K(+), Na(+) and NH(4)(+) ions, which were consistent with subtle structural differences while retaining the same folding topology of d(G(3)T(4)G(4))(2) G-quadruplex.
1v3p DNA X-ray (2.3 Å) Crystal structure of d(GCGAGAGC): the DNA octaplex structure with I-motif of G-quartet; 3Dmol view (2004) "Crystal structures of a DNA octaplex with I-motif of G-quartets and its splitting into two quadruplexes suggest a folding mechanism of eight tandem repeats." Nucleic Acids Res., 32, 2541-2549. pubmed Kondo, J., Adachi, W., Umeda, S., Sunami, T., Takenaka, A. Recent genomic analyses revealed many kinds of tandem repeats of specific sequences. Some of them are related to genetic diseases, but their biological functions and structures are still unknown. Two X-ray structures of a short DNA fragment d(gcGA[G]1Agc) show that four base-intercalated duplexes are assembled to form an octaplex at a low K+ concentration, in which the eight G5 residues form a stacked double G-quartet in the central part. At a higher K+ concentration, however, the octaplex is split into just two halves. These structural features suggest a folding process of eight tandem repeats of d(ccGA[G]4Agg), according to a double Greek-key motif. Such a packaging of the repeats could facilitate slippage of a certain sequence during DNA replication, to induce increase or decrease of the repeats.
1xav DNA NMR Major G-quadruplex structure formed in human c-MYC promoter, a monomeric parallel-stranded quadruplex; 3Dmol view (2005) "Solution structure of the biologically relevant G-Quadruplex element in the human c-MYC promoter. Implications for G-quadruplex stabilization." Biochemistry, 44, 2048-2058. pubmed Ambrus, A., Chen, D., Dai, J., Jones, R.A., Yang, D. The nuclease hypersensitivity element III(1) (NHE III(1)) of the c-MYC promoter strongly controls the transcriptional activity of the c-MYC oncogene. The purine-rich strand of the NHE III(1) element has been shown to be a silencer element for c-MYC transcription upon formation of a G-quadruplex structure. We have determined the predominant G-quadruplex structure of this silencer element in potassium solution by NMR. The G-quadruplex structure adopts an intramolecular parallel-stranded quadruplex conformation with three guanine tetrads and three side loops, including two single-nucleotide side loops and one double-nucleotide side loop, that connect the four guanine strands. The three side loops are very stable and well-defined. The 3'-flanking sequence forms a stable fold-back stacking conformation capping the top end of the G-quadruplex structure. The 5'-flanking A and G bases cap the bottom end of the G-quadruplex, with the adenine stacking very well with the bottom tetrad. This paper reports the first solution structure of a G-quadruplex found to form in the promoter region of an oncogene (c-MYC). This G-quadruplex structure is extremely stable, with a similar melting temperature (>85 degrees C) to that of the wild-type 27-mer purine-rich NHE III(1) sequence of the c-MYC promoter. This predominant quadruplex structure has been shown to be biologically relevant, and the structural information revealed in this research provides an important basis for the design of new drug candidates that specifically target the c-MYC G-quadruplex structure and modulate gene expression.
1xce DNA NMR Helica Structure of DNA by Design: The T(GGGG)T Hexad Alignment; 3Dmol view (2005) "Experimental Demonstration of T:(G:G:G):T Hexad and T:A:A:T Tetrad Alignments within a DNA Quadruplex Stem." Biochemistry, 44, 3754-3764. pubmed Webba da Silva, M. A template-based approach was used to design unprecedented architectural motifs into a known DNA framework. The structure formed by the sequence d(GCGGTTGGAT) in 0.1 M Na(+) solution has been determined using molecular dynamics simulations constrained by distance and dihedral restraints derived from NMR experiments. The molecular topology has been previously observed for the sequence d(GCGGTGGAT) (Webba da Silva, M. (2003) Biochemistry 42, 14356-65). Insertion of a single thymine into the double chain reversal formed by the segment GGTGG results in the unprecedented experimental demonstration of a T:(G:G:G:G):T hexad. The bi-stranded hexad results from the pairing alignment of two G(T-G) triads. Each triad results from recognition of the sheared edge of a guanine by the Watson-Crick edge of a thymine of the segment GGTTGG. The alignment is stabilized by base-stacking of the thymine to the sugar pucker of the preceding thymine. The latter is involved in formation of the T:A:A:T tetrad alignment by forming a hydrogen bond with the free amino proton of a Watson-Crick aligned A:A mispair. We have thus established that residues in double chain reversal loops linking juxtaposed tetrads of a quadruplex stem may facilitate formation of yet unknown hydrogen bond alignments. By employing a systematic approach analysis of sequence motifs appearing in double chain reversals, bridging tetrad layers should allow for the prediction of topologies and architectural motifs appearing in biologically relevant genomic regions.
1y8d DNA NMR Dimeric parallel-stranded tetraplex with 3+1 5' G-tetrad interface, single-residue chain reversal loops and GAG triad in the context of A(GGGG) pentad; 3Dmol view (2005) "An interlocked dimeric parallel-stranded DNA quadruplex: A potent inhibitor of HIV-1 integrase." Proc.Natl.Acad.Sci.USA, 102, 634-639. pubmed Phan, A.T., Kuryavyi, V.V., Ma, J.-B., Faure, A., Andreola, M.-L., Patel, D.J. We report on the NMR-based solution structure of the 93del d(GGGGTGGGAGGAGGGT) aptamer, a potent nanomolar inhibitor of HIV-1 integrase. This guanine-rich DNA sequence adopts an unusually stable dimeric quadruplex architecture in K+ solution. Within each 16-nt monomer subunit, which contains one A.(G.G.G.G) pentad sandwiched between two G.G.G.G tetrads, all G-stretches are parallel, and all guanines are anti with the exception of G1, which is syn. Dimer formation is achieved through mutual pairing of G1 of one monomer, with G2, G6, and G13 of the other monomer, to complete G.G.G.G tetrad formation. There are three single-nucleotide double-chain-reversal loops within each monomer fold, such that the first (T5) and third (A12) loops bridge three G-tetrad layers, whereas the second (A9) loop bridges two G-tetrad layers and participates in A.(G.G.G.G) pentad formation. Results of NMR and of integrase inhibition assays on loop-modified sequences allowed us to propose a strategy toward the potential design of improved HIV-1 integrase inhibitors. Finally, we propose a model, based on molecular docking approaches, for positioning the 93del dimeric DNA quadruplex within a basic channel/canyon formed between subunits of a dimer of dimers of HIV-1 integrase.
201d DNA NMR SOLUTION STRUCTURE OF THE OXYTRICHA TELOMERIC REPEAT D[G4(T4G4)3] G-TETRAPLEX; 3Dmol view (1995) "Solution structure of the Oxytricha telomeric repeat d[G4(T4G4)3] G-tetraplex." J.Mol.Biol., 251, 76-94. pubmed Wang, Y., Patel, D.J. The solution structure of Oxytricha telomere sequence d[G4(T4G4)3] in 0.1 M Na+ containing solution has been determined using a combined NMR-molecular dynamics approach including relaxation matrix refinement. This four G4 repeat sequence folds intramolecularly into a right-handed G-tetraplex containing four stacked G-tetrads which are connected by two lateral T4 loops and a central diagonal T4 loop. The guanine glycosidic bonds adopt a syn-anti alternation along the full length of the d[G4(T4G4)3] sequence while the orientation around adjacent G-tetrads switches between syn.syn.anti.anti and anti.anti.syn.syn alignments. Four distinct grooves are formed by the parallel (two of medium width) and anti-parallel (one wide and one narrow width) alignment of adjacent G-G-G-G segments in the G-tetraplex. The T4 residues in the diagonal loop are well-defined while the T4 residues in both lateral loops are under-defined and sample multiple conformations. The solution structure of the Na(+)-stabilized Oxytricha d[G4(T4G4)3] G-tetraplex and an earlier solution structure reported from our laboratory on the Na(+)-stabilized human d[AG3(T2AG3)3] G-tetraplex exhibit a common folding topology defined by the same syn/anti distribution of guanine residues along individual strands and around individual G-tetrads, as well as a common central diagonal loop which defines the strand directionalities. The well-resolved proton NMR spectra associated with the d[G4(T4G4)3] G-tetraplex opens the opportunity for studies ranging from cation-dependent characterization of G-tetraplex conformation and hydration to ligand and protein recognition of the distinct grooves associated with this folding topology.
230d DNA NMR SOLUTION STRUCTURES OF UNIMOLECULAR QUADRUPLEXES FORMED BY OLIGONUCLEOTIDES CONTAINING OXYTRICHA TELOMERE REPEATS; 3Dmol view (1995) "Solution structures of unimolecular quadruplexes formed by oligonucleotides containing Oxytricha telomere repeats." Structure, 3, 997-1008. pubmed Smith, F.W., Schultze, P., Feigon, J. BACKGROUND: Oligonucleotides containing the guanine-rich telomeric sequence of Oxytricha chromosomes (dT4G4) have previously been shown to form DNA quadruplexes comprising guanine quartets stabilized by cations. Two different structures have been reported for both d(G4T4G4) (Oxy1.5) and d(G4T4G4T4G4T4G4) (Oxy3.5).
RESULTS: Here we present the solution structure of a uracil- and inosine-containing derivative of Oxy3.5, d(G4TUTUG4T4G4UUTTG3I) (Oxy3.5-U4128), determined using two-dimensional 1H and 31P NMR techniques. This oligonucleotide forms a unimolecular quadruplex that is very similar to the dimeric Oxy1.5 solution structure, in that it contains a loop spanning the diagonal of an end quartet. The groove widths, strand polarities, and positions of the syn bases along the G4 tracts and within the quartets are all as reported for Oxy1.5. The first and third pyrimidine tracts form parallel loops spanning a wide groove and a narrow groove respectively.
CONCLUSIONS: Both Oxy3.5 and Oxy3.5-U(4)128 form unimolecular quadruplexes in solution with a diagonal central T4 loop. These results conflict with those reported for d(G4TUTUG4TTUUG4UUTTG4) in solution, in which the central loop spans a wide groove.
244d DNA X-ray (1.2 Å) THE HIGH-RESOLUTION CRYSTAL STRUCTURE OF A PARALLEL-STRANDED GUANINE TETRAPLEX; 3Dmol view (1994) "The high-resolution crystal structure of a parallel-stranded guanine tetraplex." Science, 265, 520-524. pubmed Laughlan, G., Murchie, A.I., Norman, D.G., Moore, M.H., Moody, P.C., Lilley, D.M., Luisi, B. Repeat tracts of guanine bases found in DNA and RNA can form tetraplex structures in the presence of a variety of monovalent cations. Evidence suggests that guanine tetraplexes assume important functions within chromosomal telomeres, immunoglobulin switch regions, and the human immunodeficiency virus genome. The structure of a parallel-stranded tetraplex formed by the hexanucleotide d(TG4T) and stabilized by sodium cations was determined by x-ray crystallography to 1.2 angstroms resolution. Sharply resolved sodium cations were found between and within planes of hydrogen-bonded guanine quartets, and an ordered groove hydration was observed. Distinct intra- and intermolecular stacking arrangements were adopted by the guanine quartets. Thymine bases were exclusively involved in making extensive lattice contacts.
2a5p DNA NMR Monomeric parallel-stranded DNA tetraplex with snap-back 3+1 3' G-tetrad, single-residue chain reversal loops, GAG triad in the context of GAAG diagonal loop, NMR, 8 struct.; 3Dmol view (2005) "Small-molecule interaction with a five-guanine-tract G-quadruplex structure from the human MYC promoter." Nat.Chem.Biol., 1, 167-173. pubmed Phan, A.T., Kuryavyi, V., Gaw, H.Y., Patel, D.J. It has been widely accepted that DNA can adopt other biologically relevant structures beside the Watson-Crick double helix. One recent important example is the guanine-quadruplex (G-quadruplex) structure formed by guanine tracts found in the MYC (or c-myc) promoter region, which regulates the transcription of the MYC oncogene. Stabilization of this G-quadruplex by ligands, such as the cationic porphyrin TMPyP4, decreases the transcriptional level of MYC. Here, we report the first structure of a DNA fragment containing five guanine tracts from this region. An unusual G-quadruplex fold, which was derived from NMR restraints using unambiguous model-independent resonance assignment approaches, involves a core of three stacked guanine tetrads formed by four parallel guanine tracts with all anti guanines and a snapback 3'-end syn guanine. We have determined the structure of the complex formed between this G-quadruplex and TMPyP4. This structural information, combined with details of small-molecule interaction, provides a platform for the design of anticancer drugs targeting multi-guanine-tract sequences that are found in the MYC and other oncogenic promoters, as well as in telomeres.
2a5r DNA NMR Complex of tetra-(4-n-methylpyridyl) porphin with monomeric parallel-stranded DNA tetraplex, snap-back 3+1 3' G-tetrad, single-residue chain reversal loops, GAG triad in the context of GAAG diagonal loop, C-MYC promoter, NMR, 6 struct.; 3Dmol view (2005) "Small-molecule interaction with a five-guanine-tract G-quadruplex structure from the human MYC promoter." Nat.Chem.Biol., 1, 167-173. pubmed Phan, A.T., Kuryavyi, V., Gaw, H.Y., Patel, D.J. It has been widely accepted that DNA can adopt other biologically relevant structures beside the Watson-Crick double helix. One recent important example is the guanine-quadruplex (G-quadruplex) structure formed by guanine tracts found in the MYC (or c-myc) promoter region, which regulates the transcription of the MYC oncogene. Stabilization of this G-quadruplex by ligands, such as the cationic porphyrin TMPyP4, decreases the transcriptional level of MYC. Here, we report the first structure of a DNA fragment containing five guanine tracts from this region. An unusual G-quadruplex fold, which was derived from NMR restraints using unambiguous model-independent resonance assignment approaches, involves a core of three stacked guanine tetrads formed by four parallel guanine tracts with all anti guanines and a snapback 3'-end syn guanine. We have determined the structure of the complex formed between this G-quadruplex and TMPyP4. This structural information, combined with details of small-molecule interaction, provides a platform for the design of anticancer drugs targeting multi-guanine-tract sequences that are found in the MYC and other oncogenic promoters, as well as in telomeres.
2akg DNA NMR Thallium form of the G-Quadruplex from Oxytricha Nova, d(G4T4G4)2; 3Dmol view (2005) "(205)Tl NMR methods for the characterization of monovalent cation binding to nucleic acids." J.Am.Chem.Soc., 127, 16723-16732. pubmed Gill, M.L., Strobel, S.A., Loria, J.P. Monovalent cations play an important role in many biological functions. The guanine rich sequence, d(G4T4G4), requires monovalent cations for formation of the G-quadruplex, d(G4T4G4)2. This requirement can be satisfied by thallium (Tl+), a potassium (K+) surrogate. To verify that the structure of d(G4T4G4)2 in the presence of Tl+ is similar to the K+-form of the G-quadruplex, the solution structure of the Tl+-form of d(G4T4G4)2 was determined. The 10 lowest energy structures have an all atom RMSD of 0.76 +/- 0.16 A. Comparison of this structure to the identical G-quadruplex formed in the presence of K+ validates the isomorphous nature of Tl+ and K+. Using a 1H-205Tl spin-echo difference experiment we show that, in the Tl+-form of d(G4T4G4)2, small scalar couplings (<1 Hz) exist between 205Tl and protons in the G-quadruplex. These data comprise the first 1H-205Tl scalar couplings observed in a biological system and have the potential to provide important constraints for structure determination. These experiments can be applied to any system in which the substituted Tl+ cations are in slow exchange with the bulk ions in solution.
2aqy DNA NMR (3+1) assembly of three human telomeric DNA repeats into an asymmetrical dimeric G-quadruplex; 3Dmol view (2005) "(3 + 1) Assembly of three human telomeric repeats into an asymmetric dimeric G-quadruplex." J.Am.Chem.Soc., 127, 17277-17285. pubmed Zhang, N., Phan, A.T., Patel, D.J. We present an NMR study on the structure of a DNA fragment of the human telomere containing three guanine-tracts, d(GGGTTAGGGTTAGGGT). This sequence forms in Na(+) solution a unique asymmetric dimeric quadruplex, in which the G-tetrad core involves all three G-tracts of one strand and only the last 3'-end G-tract of the other strand. We show that a three-repeat human telomeric sequence can also associate with a single-repeat human telomeric sequence into a structure with the same topology that we name (3 + 1) quadruplex assembly. In this G-quadruplex assembly, there are one syn.syn.syn.anti and two anti.anti.anti.syn G-tetrads, two edgewise loops, three G-tracts oriented in one direction and the fourth oriented in the opposite direction. We discuss the possible implications of the new folding topology for understanding the structure of telomeric DNA, including t-loop formation, and for targeting G-quadruplexes in the telomeres.
2avh DNA X-ray (1.5 Å) G4T3G4 dimeric quadruplex structure; 3Dmol view (2006) "Topology variation and loop structural homology in crystal and simulated structures of a bimolecular DNA quadruplex." J.Am.Chem.Soc., 128, 5480-5487. pubmed Hazel, P., Parkinson, G.N., Neidle, S. The topology of DNA quadruplexes depends on the nature and number of the nucleotides linking G-quartet motifs. To assess the effects of a three-nucleotide TTT linker, the crystal structure of the DNA sequence d(G(4)T(3)G(4)) has been determined at 1.5 A resolution, together with that of the brominated analogue d(G(4)(Br)UTTG(4)) at 2.4 A resolution. Both sequences form bimolecular intermolecular G-quadruplexes with lateral loops. d(G(4)(Br)UTTG(4)) crystallized in the monoclinic space group P2(1) with three quadruplex molecules in the asymmetric unit, two associating together as a head-to-head stacked dimer, and the third as a single head-to-tail dimer. The head-to-head dimers have two lateral loops on the same G-quadruplex face and form an eight-G-quartet stack, with a linear array of seven K(+) ions between the quartets. d(G(4)T(3)G(4)) crystallized in the orthorhombic space group C222 and has a structure very similar to the head-to-tail dimer in the P2(1) unit cell. The sequence studied here is able to form several different folds; however, all four quadruplexes in the two structures have lateral loops, in contrast to the diagonal loops reported for the analogous quadruplex with T(4) loops. A total of seven independent T(3) loops were observed in the two structures. These can be classified into two discrete conformational classes, suggesting that these represent preferred loop conformations that are independent of crystal-packing forces.
2avj DNA X-ray (2.39 Å) G4(Br)UTTG4 dimeric quadruplex; 3Dmol view (2006) "Topology variation and loop structural homology in crystal and simulated structures of a bimolecular DNA quadruplex." J.Am.Chem.Soc., 128, 5480-5487. pubmed Hazel, P., Parkinson, G.N., Neidle, S. The topology of DNA quadruplexes depends on the nature and number of the nucleotides linking G-quartet motifs. To assess the effects of a three-nucleotide TTT linker, the crystal structure of the DNA sequence d(G(4)T(3)G(4)) has been determined at 1.5 A resolution, together with that of the brominated analogue d(G(4)(Br)UTTG(4)) at 2.4 A resolution. Both sequences form bimolecular intermolecular G-quadruplexes with lateral loops. d(G(4)(Br)UTTG(4)) crystallized in the monoclinic space group P2(1) with three quadruplex molecules in the asymmetric unit, two associating together as a head-to-head stacked dimer, and the third as a single head-to-tail dimer. The head-to-head dimers have two lateral loops on the same G-quadruplex face and form an eight-G-quartet stack, with a linear array of seven K(+) ions between the quartets. d(G(4)T(3)G(4)) crystallized in the orthorhombic space group C222 and has a structure very similar to the head-to-tail dimer in the P2(1) unit cell. The sequence studied here is able to form several different folds; however, all four quadruplexes in the two structures have lateral loops, in contrast to the diagonal loops reported for the analogous quadruplex with T(4) loops. A total of seven independent T(3) loops were observed in the two structures. These can be classified into two discrete conformational classes, suggesting that these represent preferred loop conformations that are independent of crystal-packing forces.
2awe RNA X-ray (2.1 Å) Base-Tetrad Swapping Results in Dimerization of RNA Quadruplexes: Implications for Formation of I-Motif RNA Octaplex; 3Dmol view (2006) "Base-tetrad swapping results in dimerization of RNA quadruplexes: implications for formation of the i-motif RNA octaplex." Proc.Natl.Acad.Sci.Usa, 103, 3130-3134. pubmed Pan, B., Shi, K., Sundaralingam, M. Nucleic acids adopt different multistranded helical architectures to perform various biological functions. Here, we report a crystal structure of an RNA quadruplex containing "base-tetrad swapping" and bulged nucleotide at 2.1-Angstroms resolution. The base-tetrad swapping results in a dimer of quadruplexes with an intercalated octaplex fragment at the 5' end junction. The intercalated base tetrads provide the basic repeat unit for constructing a model of intercalated RNA octaplex. The model we obtained shows fundamentally different characteristics from duplex, triplex, and quadruplex. We also observed two different orientations of bulged uridine residues that are related to the interaction with surroundings. This structural evidence reflects the conformational flexibility of bulged nucleotides in RNA quadruplexes and implies the potential roles of bulged nucleotides as recognition and interaction sites in RNA-protein and RNA-RNA interactions.
2chj nucleic acid NMR NMR structure of TGLGLT quadruplex; 3Dmol view (2006) "NMR Solution Structures of Lna (Locked Nucleic Acid) Modified Quadruplexes." Nucleic Acids Res., 34, 2006-. pubmed Nielsen, J.T., Arar, K., Petersen, M. We have determined the NMR solution structures of the quadruplexes formed by d(TGLGLT) and d(TL4T), where L denotes LNA (locked nucleic acid) modified G-residues. Both structures are tetrameric, parallel and right-handed and the native global fold of the corresponding DNA quadruplex is retained upon introduction of the LNA nucleotides. However, local structural alterations are observed owing to the locked LNA sugars. In particular, a distinct change in the sugar-phosphate backbone is observed at the G2pL3 and L2pL3 base steps and sequence dependent changes in the twist between tetrads are also seen. Both the LNA modified quadruplexes have raised thermostability as compared to the DNA quadruplex. The quadruplex-forming capability of d(TGLGLT) is of particular interest as it expands the design flexibility for stable parallel LNA quadruplexes and shows that LNA nucleotides can be mixed with DNA or other modified nucleic acids. As such, LNA-based quadruplexes can be decorated by a variety of chemical modifications. Such LNA quadruplex scaffolds might find applications in the developing field of nanobiotechnology.
2chk nucleic acid NMR NMR structure of TLLLLT quadruplex; 3Dmol view (2006) "NMR Solution Structures of Lna (Locked Nucleic Acid) Modified Quadruplexes." Nucleic Acids Res., 34, 2006-. pubmed Nielsen, J.T., Arar, K., Petersen, M. We have determined the NMR solution structures of the quadruplexes formed by d(TGLGLT) and d(TL4T), where L denotes LNA (locked nucleic acid) modified G-residues. Both structures are tetrameric, parallel and right-handed and the native global fold of the corresponding DNA quadruplex is retained upon introduction of the LNA nucleotides. However, local structural alterations are observed owing to the locked LNA sugars. In particular, a distinct change in the sugar-phosphate backbone is observed at the G2pL3 and L2pL3 base steps and sequence dependent changes in the twist between tetrads are also seen. Both the LNA modified quadruplexes have raised thermostability as compared to the DNA quadruplex. The quadruplex-forming capability of d(TGLGLT) is of particular interest as it expands the design flexibility for stable parallel LNA quadruplexes and shows that LNA nucleotides can be mixed with DNA or other modified nucleic acids. As such, LNA-based quadruplexes can be decorated by a variety of chemical modifications. Such LNA quadruplex scaffolds might find applications in the developing field of nanobiotechnology.
2e4i DNA NMR Human Telomeric DNA mixed-parallel/antiparallel quadruplex under Physiological Ionic Conditions Stabilized by Proper Incorporation of 8-Bromoguanosines; 3Dmol view (2007) "Structure of a human telomeric DNA sequence stabilized by 8-bromoguanosine substitutions, as determined by NMR in a K+ solution." Febs J., 274, 3545-3556. pubmed Matsugami, A., Xu, Y., Noguchi, Y., Sugiyama, H., Katahira, M. The structure of human telomeric DNA is controversial; it depends upon the sequence contexts and the methodologies used to determine it. The solution structure in the presence of K(+) is particularly interesting, but the structure is yet to be elucidated, due to possible conformational heterogeneity. Here, a unique strategy is applied to stabilize one such structure in a K(+) solution by substituting guanosines with 8-bromoguanosines at proper positions. The resulting spectra are cleaner and led to determination of the structure at a high atomic resolution. This demonstrates that the application of 8-bromoguanosine is a powerful tool to overcome the difficulty of nucleic acid structure determination arising from conformational heterogeneity. The obtained structure is a mixed-parallel/antiparallel quadruplex. The structure of telomeric DNA was recently reported in another study, in which stabilization was brought about by mutation and resultant additional interactions [Luu KN, Phan AT, Kuryavyi V, Lacroix L & Patel DJ (2006) Structure of the human telomere in K(+) solution: an intramolecular (3+1) G-quadruplex scaffold. J Am Chem Soc 128, 9963-9970]. The structure of the guanine tracts was similar between the two. However, a difference was seen for loops connecting guanine tracts, which may play a role in the higher order arrangement of telomeres. Our structure can be utilized to design a small molecule which stabilizes the quadruplex. This type of molecule is supposed to inhibit a telomerase and thus is expected to be a candidate anticancer drug.
2f8u DNA NMR G-quadruplex structure formed in human Bcl-2 promoter, hybrid form; 3Dmol view (2006) "NMR solution structure of the major G-quadruplex structure formed in the human BCL2 promoter region." Nucleic Acids Res., 34, 5133-5144. pubmed Dai, J., Chen, D., Jones, R.A., Hurley, L.H., Yang, D. BCL2 protein functions as an inhibitor of cell apoptosis and has been found to be aberrantly expressed in a wide range of human diseases. A highly GC-rich region upstream of the P1 promoter plays an important role in the transcriptional regulation of BCL2. Here we report the NMR solution structure of the major intramolecular G-quadruplex formed on the G-rich strand of this region in K+ solution. This well-defined mixed parallel/antiparallel-stranded G-quadruplex structure contains three G-tetrads of mixed G-arrangements, which are connected with two lateral loops and one side loop, and four grooves of different widths. The three loops interact with the core G-tetrads in a specific way that defines and stabilizes the overall G-quadruplex structure. The loop conformations are in accord with the experimental mutation and footprinting data. The first 3-nt loop adopts a lateral loop conformation and appears to determine the overall folding of the BCL2 G-quadruplex. The third 1-nt double-chain-reversal loop defines another example of a stable parallel-stranded structural motif using the G3NG3 sequence. Significantly, the distinct major BCL2 promoter G-quadruplex structure suggests that it can be specifically involved in gene modulation and can be an attractive target for pathway-specific drug design.
2gku DNA NMR Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, NMR, 12 structures; 3Dmol view (2006) "Structure of the human telomere in k(+) solution: an intramolecular (3 + 1) g-quadruplex scaffold." J.Am.Chem.Soc., 128, 9963-9970. pubmed Luu, K.N., Phan, A.T., Kuryavyi, V.V., Lacroix, L., Patel, D.J. We present the intramolecular G-quadruplex structure of human telomeric DNA in physiologically relevant K(+) solution. This G-quadruplex, whose (3 + 1) topology differs from folds reported previously in Na(+) solution and in a K(+)-containing crystal, involves the following: one anti.syn.syn.syn and two syn.anti.anti.anti G-tetrads; one double-chain reversal and two edgewise loops; three G-tracts oriented in one direction and the fourth in the opposite direction. The topological characteristics of this (3 + 1) G-quadruplex scaffold should provide a unique platform for structure-based anticancer drug design targeted to human telomeric DNA.
2grb RNA X-ray (1.4 Å) Crystal Structure of an RNA Quadruplex Containing Inosine-tetrad; 3Dmol view (2006) "Crystal structure of an RNA quadruplex containing inosine tetrad: implications for the roles of NH2 group in purine tetrads." J.Mol.Biol., 363, 451-459. pubmed Pan, B., Shi, K., Sundaralingam, M. Polyinosinic acid has been known to adopt the four-stranded helical structure but its basic unit, inosine tetrad (I tetrad), has not been determined at the atomic level. Here we report the crystal structure of an RNA quadruplex containing an I tetrad at 1.4 A resolution. The I tetrad has one cyclic hydrogen bond N1...O6 with the bond length of 2.7 A. A water bridge is observed in the minor groove side of the base tetrad. Even though it is sandwiched by guanine tetrads (G tetrads), the I tetrad is buckled towards the 3' side of the tetrad plane, which results from the different interaction strength with K ions on two sides of the tetrad plane. Comparison with both G tetrad and adenine tetrad indicates that lack of NH2 in the C2 position makes the I tetrad prone to buckle for interactions with ligands. Two U*(G-G-G-G) base pentads are observed at the junction of the 5' termini of two quadruplexes. The uridine residue in the base pentad is engaged in two hydrogen bonding interactions (N2(G)-H...O2(U) and O2'(G)-H...O4(U)) and a water-mediated interaction (N3(G) and N3(U)) with the G tetrad. We also discuss the roles of amino group in purine tetrads and the inter-quadruplex interactions in RNA molecules. These quadruplexes may interact with each other by stacking, groove binding and intercalation.
2gw0 DNA X-ray (1.55 Å) A D(TGGGGT)- sodium and calcium complex.; 3Dmol view (2007) "Observation of the coexistence of sodium and calcium ions in a DNA G-quadruplex ion channel." J.Am.Chem.Soc., 129, 10106-10107. pubmed Lee, M.P., Parkinson, G.N., Hazel, P., Neidle, S. The crystal structure of a DNA quadruplex, d(TGGGGT), crystallized in the presence of calcium and sodium ions, shows the presence of both ions in the central channel of the structure. This was verified by anomalous dispersion maps, which unequivocally showed the presence of calcium ions.
2gwe DNA X-ray (2.2 Å) Crystal structure of D(G4T4G4) with six quadruplexes in the asymmetric unit.; 3Dmol view "Crystal structure of D(G4T4G4) with four and six quadruplexes in the asymmetric unit." To be Published Lee, M.P.H., Haider, S., Parkinson, G.N., Neidle, S.
2gwq DNA X-ray (2.0 Å) Crystal structure of D(G4T4G4) with four quadruplexes in the asymmetric unit.; 3Dmol view "Crystal structure of D(G4T4G4) with four and six quadruplexes in the asymmetric unit." To be Published Lee, M.P.H., Haider, S., Parkinson, G.N., Neidle, S.
2hbn DNA X-ray (1.55 Å) Crystallization of the Tl+-form of the Oxytricha nova G-quadruplex; 3Dmol view (2006) "Crystallization and characterization of the thallium form of the Oxytricha nova G-quadruplex." Nucleic Acids Res., 34, 4506-4514. pubmed Gill, M.L., Strobel, S.A., Loria, J.P. The crystal structure of the Tl+ form of the G-quadruplex formed from the Oxytricha nova telomere sequence, d(G4T4G4), has been solved to 1.55 A. This G-quadruplex contains five Tl+ ions, three of which are interspersed between adjacent G-quartet planes and one in each of the two thymine loops. The structure displays a high degree of similarity to the K+ crystal structure [Haider et al. (2002), J. Mol. Biol., 320, 189-200], including the number and location of the monovalent cation binding sites. The highly isomorphic nature of the two structures, which contain such a large number of monovalent binding sites (relative to nucleic acid content), verifies the ability of Tl+ to mimic K+ in nucleic acids. Information from this report confirms and extends the assignment of 205Tl resonances from a previous report [Gill et al. (2005), J. Am. Chem. Soc., 127, 16 723-16 732] where 205Tl NMR was used to study monovalent cation binding to this G-quadruplex. The assignment of these resonances provides evidence for the occurrence of conformational dynamics in the thymine loop region that is in slow exchange on the 205Tl timescale.
2hri DNA X-ray (2.09 Å) A parallel stranded human telomeric quadruplex in complex with the porphyrin TMPyP4; 3Dmol view (2007) "Structural basis for binding of porphyrin to human telomeres." Biochemistry, 46, 2390-2397. pubmed Parkinson, G.N., Ghosh, R., Neidle, S. Maintenance of telomere integrity is a hallmark of human cancer, and the single-stranded 3' ends of telomeric DNA are targets for small-molecule anticancer therapies. We report here the crystal structure of a bimolecular human telomeric quadruplex, of the sequence d(TAGGGTTAGGG), in a complex with the quadruplex-binding ligand 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) to a resolution of 2.09 A. The DNA quadruplex topology is parallel-stranded with external double-chain-reversal propeller loops, consistent with previous structural determinations. The porphyrin molecules bind by stacking onto the TTA nucleotides, either as part of the external loop structure or at the 5' region of the stacked quadruplex. This involves stacked on hydrogen-bonded base pairs, formed from those nucleotides not involved in the formation of G-tetrads, and there are thus no direct ligand interactions with G-tetrads. This is in accord with the relative nonselectivity by TMPyP4 for quadruplex DNAs compared to duplex DNA. Porphyrin binding is achieved by remodeling of loops compared to the ligand-free structures. Implications for the design of quadruplex-binding ligands are discussed, together with a model for the formation of anaphase bridges, which are observed following cellular treatment with TMPyP4.
2hy9 DNA NMR Human telomere DNA quadruplex structure in K+ solution hybrid-1 form; 3Dmol view (2007) "Structure of the intramolecular human telomeric G-quadruplex in potassium solution: a novel adenine triple formation." Nucleic Acids Res., 35, 2440-2450. pubmed Dai, J., Punchihewa, C., Ambrus, A., Chen, D., Jones, R.A., Yang, D. We report the NMR solution structure of the intramolecular G-quadruplex formed in human telomeric DNA in K(+). The hybrid-type telomeric G-quadruplex consists of three G-tetrads linked with mixed parallel-antiparallel G-strands, with the bottom two G-tetrads having the same G-arrangement (anti:anti:syn:anti) and the top G-tetrad having the reversed G-arrangement (syn:syn:anti:syn). The three TTA loop segments adopt different conformations, with the first TTA assuming a double-chain-reversal loop conformation, and the second and third TTA assuming lateral loop conformations. The NMR structure is very well defined, including the three TTA loops and the two flanking sequences at 5'- and 3'-ends. Our study indicates that the three loop regions interact with the core G-tetrads in a specific way that defines and stabilizes the unique human telomeric G-quadruplex structure in K(+). Significantly, a novel adenine triple platform is formed with three naturally occurring adenine residues, A21, A3 and A9, capping the top tetrad of the hybrid-type telomeric G-quadruplex. This adenine triple is likely to play an important role in the formation of a stable human telomeric G-quadruplex structure in K(+). The unique human telomeric G-quadruplex structure formed in K(+) suggests that it can be specifically targeted for anticancer drug design.
2idn DNA NMR NMR structure of a new modified Thrombin Binding Aptamer containing a 5'-5' inversion of polarity site; 3Dmol view (2006) "A new modified thrombin binding aptamer containing a 5'-5' inversion of polarity site." Nucleic Acids Res., 34, 6653-6662. pubmed Martino, L., Virno, A., Randazzo, A., Virgilio, A., Esposito, V., Giancola, C., Bucci, M., Cirino, G., Mayol, L. The solution structure of a new modified thrombin binding aptamer (TBA) containing a 5'-5' inversion of polarity site, namely d(3'GGT5'-5'TGGTGTGGTTGG3'), is reported. NMR and CD spectroscopy, as well as molecular dynamic and mechanic calculations, have been used to characterize the 3D structure. The modified oligonucleotide is characterized by a chair-like structure consisting of two G-tetrads connected by three edge-wise TT, TGT and TT loops. d(3'GGT5'-5'TGGTGTGGTTGG3') is characterized by an unusual folding, being three strands parallel to each other and only one strand oriented in opposite manner. This led to an anti-anti-anti-syn and syn-syn-syn-anti arrangement of the Gs in the two tetrads. The thermal stability of the modified oligonucleotide is 4 degrees C higher than the corresponding unmodified TBA. d(3'GGT5'-5'TGGTGTGGTTGG3') continues to display an anticoagulant activity, even if decreased with respect to the TBA.
2jpz DNA NMR Human telomere DNA quadruplex structure in K+ solution hybrid-2 form; 3Dmol view (2007) "Structure of the Hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: insights into structure polymorphism of the human telomeric sequence." Nucleic Acids Res., 35, 4927-4940. pubmed Dai, J., Carver, M., Punchihewa, C., Jones, R.A., Yang, D. Formation of the G-quadruplex in the human telomeric sequence can inhibit the activity of telomerase, thus the intramolecular telomeric G-quadruplexes have been considered as an attractive anticancer target. Information of intramolecular telomeric G-quadruplex structures formed under physiological conditions is important for structure-based drug design. Here, we report the first structure of the major intramolecular G-quadruplex formed in a native, non-modified human telomeric sequence in K(+) solution. This is a hybrid-type mixed parallel/antiparallel-G-stranded G-quadruplex, one end of which is covered by a novel T:A:T triple capping structure. This structure (Hybrid-2) and the previously reported Hybrid-1 structure differ in their loop arrangements, strand orientations and capping structures. The distinct capping structures appear to be crucial for the favored formation of the specific hybrid-type intramolecular telomeric G-quadruplexes, and may provide specific binding sites for drug targeting. Our study also shows that while the hybrid-type G-quadruplexes appear to be the major conformations in K(+) solution, human telomeric sequences are always in equilibrium between Hybrid-1 and Hybrid-2 structures, which is largely determined by the 3'-flanking sequence. Furthermore, both hybrid-type G-quadruplexes suggest a straightforward means for multimer formation with effective packing in the human telomeric sequence and provide important implications for drug targeting of G-quadruplexes in human telomeres.
2jsk DNA NMR Monomeric Human Telomere DNA Tetraplex with 3+1 Strand Fold Topology, Two Edgewise Loops and Double-Chain Reversal Loop, 16 G Form 1, NMR, 10 Structures; 3Dmol view (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. pubmed Phan, A.T., Kuryavyi, V., Luu, K.N., Patel, D.J. Intramolecular G-quadruplexes formed by human telomere sequences are attractive anticancer targets. Recently, four-repeat human telomere sequences have been shown to form two different intramolecular (3 + 1) G-quadruplexes in K(+) solution (Form 1 and Form 2). Here we report on the solution structures of both Form 1 and Form 2 adopted by natural human telomere sequences. Both structures contain the (3 + 1) G-tetrad core with one double-chain-reversal and two edgewise loops, but differ in the successive order of loop arrangements within the G-quadruplex scaffold. Our results provide the structural details at the two ends of the G-tetrad core in the context of natural sequences and information on different loop conformations. This structural information might be important for our understanding of telomere G-quadruplex structures and for anticancer drug design targeted to such scaffolds.
2jsl DNA NMR Monomeric Human Telomere DNA Tetraplex with 3+1 Strand Fold Topology, Two Edgewise Loops and Double-Chain Reversal Loop, Form 2 Natural, NMR, 10 Structures; 3Dmol view (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. pubmed Phan, A.T., Kuryavyi, V., Luu, K.N., Patel, D.J. Intramolecular G-quadruplexes formed by human telomere sequences are attractive anticancer targets. Recently, four-repeat human telomere sequences have been shown to form two different intramolecular (3 + 1) G-quadruplexes in K(+) solution (Form 1 and Form 2). Here we report on the solution structures of both Form 1 and Form 2 adopted by natural human telomere sequences. Both structures contain the (3 + 1) G-tetrad core with one double-chain-reversal and two edgewise loops, but differ in the successive order of loop arrangements within the G-quadruplex scaffold. Our results provide the structural details at the two ends of the G-tetrad core in the context of natural sequences and information on different loop conformations. This structural information might be important for our understanding of telomere G-quadruplex structures and for anticancer drug design targeted to such scaffolds.
2jsm DNA NMR MONOMERIC HUMAN TELOMERE DNA TETRAPLEX WITH 3+1 STRAND FOLD TOPOLOGY, TWO EDGEWISE LOOPS AND DOUBLE-CHAIN REVERSAL LOOP, NMR, 10 STRUCTURES, Form 1 Natural; 3Dmol view (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. pubmed Phan, A.T., Kuryavyi, V., Luu, K.N., Patel, D.J. Intramolecular G-quadruplexes formed by human telomere sequences are attractive anticancer targets. Recently, four-repeat human telomere sequences have been shown to form two different intramolecular (3 + 1) G-quadruplexes in K(+) solution (Form 1 and Form 2). Here we report on the solution structures of both Form 1 and Form 2 adopted by natural human telomere sequences. Both structures contain the (3 + 1) G-tetrad core with one double-chain-reversal and two edgewise loops, but differ in the successive order of loop arrangements within the G-quadruplex scaffold. Our results provide the structural details at the two ends of the G-tetrad core in the context of natural sequences and information on different loop conformations. This structural information might be important for our understanding of telomere G-quadruplex structures and for anticancer drug design targeted to such scaffolds.
2jsq DNA NMR Monomeric Human Telomere DNA Tetraplex with 3+1 Strand Fold Topology, Two Edgewise Loops and Double-Chain Reversal Loop, Form 2 15BrG, NMR, 10 Structures; 3Dmol view (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. pubmed Phan, A.T., Kuryavyi, V., Luu, K.N., Patel, D.J. Intramolecular G-quadruplexes formed by human telomere sequences are attractive anticancer targets. Recently, four-repeat human telomere sequences have been shown to form two different intramolecular (3 + 1) G-quadruplexes in K(+) solution (Form 1 and Form 2). Here we report on the solution structures of both Form 1 and Form 2 adopted by natural human telomere sequences. Both structures contain the (3 + 1) G-tetrad core with one double-chain-reversal and two edgewise loops, but differ in the successive order of loop arrangements within the G-quadruplex scaffold. Our results provide the structural details at the two ends of the G-tetrad core in the context of natural sequences and information on different loop conformations. This structural information might be important for our understanding of telomere G-quadruplex structures and for anticancer drug design targeted to such scaffolds.
2jt7 DNA NMR NMR solution structure of the 4:1 distamycin A/[d(TGGGGT)]4 complex; 3Dmol view (2007) "Structural and thermodynamic studies of the interaction of distamycin A with the parallel quadruplex structure [d(TGGGGT)]4." J.Am.Chem.Soc., 129, 16048-16056. pubmed Martino, L., Virno, A., Pagano, B., Virgilio, A., Di Micco, S., Galeone, A., Giancola, C., Bifulco, G., Mayol, L., Randazzo, A. The complex between distamycin A and the parallel DNA quadruplex [d(TGGGGT)]4 has been studied by 1H NMR spectroscopy and isothermal titration calorimetry (ITC). To unambiguously assert that distamycin A interacts with the grooves of the quadruplex [d(TGGGGT)]4, we have analyzed the NMR titration profile of a modified quadruplex, namely [d(TGGMeGGT)]4, and we have applied the recently developed differential frequency-saturation transfer difference (DF-STD) method, for assessing the ligand-DNA binding mode. The three-dimensional structure of the 4:1 distamycin A/[d(TGGGGT)]4 complex has been determined by an in-depth NMR study followed by dynamics and mechanics calculations. All results unequivocally indicate that distamycin molecules interact with [d(TGGGGT)]4 in a 4:1 binding mode, with two antiparallel distamycin dimers that bind simultaneously two opposite grooves of the quadruplex. The affinity between distamycin A and [d(TGGGGT)]4 enhances ( approximately 10-fold) when the ratio of distamycin A to the quadruplex is increased. In this paper we report the first three-dimensional structure of a groove-binder molecule complexed to a DNA quadruplex structure.
2jwq DNA NMR G-quadruplex recognition by quinacridines: a SAR, NMR and Biological study; 3Dmol view (2007) "G-Quadruplex Recognition by Quinacridines: a SAR, NMR, and Biological Study." ChemMedChem, 2, 655-666. pubmed Hounsou, C., Guittat, L., Monchaud, D., Jourdan, M., Saettel, N., Mergny, J.L., Teulade-Fichou, M. The synthesis of a novel group of quinacridine-based ligands (MMQs) is described along with an evaluation of their G-quadruplex binding properties. A set of biophysical assays was applied to characterize their interaction with DNA quadruplexes: FRET-melting experiments and equilibrium microdialysis were used to evaluate their quadruplex affinity and their ability to discriminate quadruplexes across a broad panel of DNA structures. All data collected support the proposed model of interaction of these compounds with G-quadruplexes, which is furthermore confirmed by a solution structure determined by 2D NMR experiments. Finally, the activity of the MMQ series against tumor cell growth is reported, and the data support the potential of quadruplex-interactive compounds for use in anticancer approaches.
2kaz DNA NMR Folding topology of a bimolecular DNA quadruplex containing a stable mini-hairpin motif within the connecting loop; 3Dmol view (2009) "Folding topology of a bimolecular DNA quadruplex containing a stable mini-hairpin motif within the diagonal loop." J.Mol.Biol., 385, 1600-1615. pubmed Balkwill, G.D., Garner, T.P., Williams, H.E., Searle, M.S. We describe the NMR structural characterisation of a bimolecular anti-parallel DNA quadruplex d(G(3)ACGTAGTG(3))(2) containing an autonomously stable mini-hairpin motif inserted within the diagonal loop. A folding topology is identified that is different from that observed for the analogous d(G(3)T(4)G(3))(2) dimer with the two structures differing in the relative orientation of the diagonal loops. This appears to reflect specific base stacking interactions at the quadruplex-duplex interface that are not present in the structure with the T(4)-loop sequence. A truncated version of the bimolecular quadruplex d(G(2)ACGTAGTG(2))(2), with only two core G-tetrads, is less stable and forms a heterogeneous mixture of three 2-fold symmetric quadruplexes with different loop arrangements. We demonstrate that the nature of the loop sequence, its ability to form autonomously stable structure, the relative stabilities of the hairpin loop and core quadruplex, and the ability to form favourable stacking interactions between these two motifs are important factors in controlling DNA G-quadruplex topology.
2kbp RNA NMR Solution structure of a G-quadruplex of human telomeric RNA; 3Dmol view (2009) "Structure of propeller-type parallel-stranded RNA G-quadruplexes, formed by human telomeric RNA sequences in K+ solution." J.Am.Chem.Soc., 131, 2570-2578. pubmed Martadinata, H., Phan, A.T. Very recent studies showed that mammalian telomeres were transcribed into telomeric-repeat-containing RNAs and suggested that these RNA molecules were biologically important. Here we report on a structural study of RNA G-quadruplexes formed by human telomeric RNA sequences in K(+) solution. Our data indicated that these sequences formed propeller-type parallel-stranded RNA G-quadruplexes. We have determined the NMR-based solution structure of a dimeric propeller-type RNA G-quadruplex formed by the 12-nt human telomeric RNA sequence r(UAGGGUUAGGGU). We also observed the stacking of two such propeller-type G-quadruplex blocks for the 10-nt human telomeric RNA sequence r(GGGUUAGGGU) and a higher-order G-quadruplex structure for the 9-nt human telomeric RNA sequence r(GGGUUAGGG). Based on these findings we proposed how higher-order structures might be formed by long telomeric RNA.
2kf7 DNA NMR Structure of a two-G-tetrad basket-type intramolecular G-quadruplex formed by human telomeric repeats in K+ solution (with G7-to-BRG substitution); 3Dmol view (2009) "Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers." J.Am.Chem.Soc., 131, 4301-4309. pubmed Lim, K.W., Amrane, S., Bouaziz, S., Xu, W., Mu, Y., Patel, D.J., Luu, K.N., Phan, A.T. Previously, it has been reported that human telomeric DNA sequences could adopt in different experimental conditions four different intramolecular G-quadruplexes each involving three G-tetrad layers, namely, Na(+) solution antiparallel-stranded basket form, K(+) crystal parallel-stranded propeller form, K(+) solution (3 + 1) Form 1, and K(+) solution (3 + 1) Form 2. Here we present a new intramolecular G-quadruplex adopted by a four-repeat human telomeric sequence in K(+) solution (Form 3). This structure is a basket-type G-quadruplex with only two G-tetrad layers: loops are successively edgewise, diagonal, and edgewise; glycosidic conformations of guanines are syn x syn x anti x anti around each tetrad. Each strand of the core has both a parallel and an antiparallel adjacent strands; there are one narrow, one wide, and two medium grooves. Despite the presence of only two G-tetrads in the core, this structure is more stable than the three-G-tetrad intramolecular G-quadruplexes previously observed for human telomeric sequences in K(+) solution. Detailed structural elucidation of Form 3 revealed extensive base pairing and stacking in the loops capping both ends of the G-tetrad core, which might explain the high stability of the structure. This novel structure highlights the conformational heterogeneity of human telomeric DNA. It establishes a new folding principle for G-quadruplexes and suggests new loop sequences and structures for targeting in human telomeric DNA.
2kf8 DNA NMR Structure of a two-G-tetrad basket-type intramolecular G-quadruplex formed by human telomeric repeats in K+ solution; 3Dmol view (2009) "Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers." J.Am.Chem.Soc., 131, 4301-4309. pubmed Lim, K.W., Amrane, S., Bouaziz, S., Xu, W., Mu, Y., Patel, D.J., Luu, K.N., Phan, A.T. Previously, it has been reported that human telomeric DNA sequences could adopt in different experimental conditions four different intramolecular G-quadruplexes each involving three G-tetrad layers, namely, Na(+) solution antiparallel-stranded basket form, K(+) crystal parallel-stranded propeller form, K(+) solution (3 + 1) Form 1, and K(+) solution (3 + 1) Form 2. Here we present a new intramolecular G-quadruplex adopted by a four-repeat human telomeric sequence in K(+) solution (Form 3). This structure is a basket-type G-quadruplex with only two G-tetrad layers: loops are successively edgewise, diagonal, and edgewise; glycosidic conformations of guanines are syn x syn x anti x anti around each tetrad. Each strand of the core has both a parallel and an antiparallel adjacent strands; there are one narrow, one wide, and two medium grooves. Despite the presence of only two G-tetrads in the core, this structure is more stable than the three-G-tetrad intramolecular G-quadruplexes previously observed for human telomeric sequences in K(+) solution. Detailed structural elucidation of Form 3 revealed extensive base pairing and stacking in the loops capping both ends of the G-tetrad core, which might explain the high stability of the structure. This novel structure highlights the conformational heterogeneity of human telomeric DNA. It establishes a new folding principle for G-quadruplexes and suggests new loop sequences and structures for targeting in human telomeric DNA.
2kka DNA NMR Human telomere DNA two-tetrad quadruplex structure in K+ solution; 3Dmol view (2010) "Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution: insights into the interconversion of human telomeric G-quadruplex structures." Nucleic Acids Res., 38, 1009-1021. pubmed Zhang, Z., Dai, J., Veliath, E., Jones, R.A., Yang, D. Human telomeric DNA G-quadruplex has been considered as an attractive target for cancer therapeutic intervention. The telomeric sequence shows intrinsic structure polymorphism. Here we report a novel intramolecular G-quadruplex structure formed by a variant human telomeric sequence in K(+) solution. This sequence forms a basket-type intramolecular G-quadruplex with only two G-tetrads but multiple-layer capping structures formed by loop residues. While it is shown that this structure can only be detected in the specifically truncated telomeric sequences without any 5'-flanking residues, our results suggest that this two-G-tetrad conformation is likely to be an intermediate form of the interconversion of different telomeric G-quadruplex conformations.
2km3 DNA NMR Structure of an intramolecular G-quadruplex containing a G.C.G.C tetrad formed by human telomeric variant CTAGGG repeats; 3Dmol view (2009) "Sequence variant (CTAGGG)n in the human telomere favors a G-quadruplex structure containing a G.C.G.C tetrad." Nucleic Acids Res., 37, 6239-6248. pubmed Lim, K.W., Alberti, P., Guedin, A., Lacroix, L., Riou, J.F., Royle, N.J., Mergny, J.L., Phan, A.T. Short contiguous arrays of variant CTAGGG repeats in the human telomere are unstable in the male germline and somatic cells, suggesting formation of unusual structures by this repeat type. Here, we report on the structure of an intramolecular G-quadruplex formed by DNA sequences containing four human telomeric variant CTAGGG repeats in potassium solution. Our results reveal a new robust antiparallel G-quadruplex fold involving two G-tetrads sandwiched between a G.C base pair and a G.C.G.C tetrad, which could represent a new platform for drug design targeted to human telomeric DNA.
2kow DNA NMR Structure of a two-G-tetrad basket-type intramolecular G-quadruplex formed by Giardia telomeric repeat d(TAGGG)4 in K+ solution (with G18-to-INO substitution); 3Dmol view (2009) "Giardia Telomeric Sequence d(TAGGG)(4) Forms Two Intramolecular G-Quadruplexes in K(+) Solution: Effect of Loop Length and Sequence on the Folding Topology." J.Am.Chem.Soc., 131, 16824-16831. pubmed Hu, L., Lim, K.W., Bouaziz, S., Phan, A.T. Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.
2kpr DNA NMR Monomeric intronic human chl1 gene quadruplex DNA NMR, 17 structures; 3Dmol view (2010) "Solution Structure of a Unique G-Quadruplex Scaffold Adopted by a Guanosine-Rich Human Intronic Sequence." Structure, 18, 73-82. pubmed Kuryavyi, V., Patel, D.J. We report on the solution structure of an unprecedented intramolecular G-quadruplex formed by the guanosine-rich human chl1 intronic d(G(3)-N-G(4)-N(2)-G(4)-N-G(3)-N) 19-mer sequence in K(+)-containing solution. This G-quadruplex, composed of three stacked G-tetrads containing four syn guanines, represents a new folding topology with two unique conformational features. The first guanosine is positioned within the central G-tetrad, in contrast to all previous structures of unimolecular G-quadruplexes, where the first guanosine is part of an outermost G-tetrad. In addition, a V-shaped loop, spanning three G-tetrad planes, contains no bridging nucleotides. The G-quadruplex scaffold is stabilized by a T*G*A triple stacked over the G-tetrad at one end and an unpaired guanosine stacked over the G-tetrad at the other end. Finally, the chl1 intronic DNA G-quadruplex scaffold contains a guanosine base intercalated between an extended G-G step, a feature observed in common with the catalytic site of group I introns. This unique structural scaffold provides a highly specific platform for the future design of ligands specifically targeted to intronic G-quadruplex platforms.
2kqg DNA NMR A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics; 3Dmol view (2009) "A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics." J.Am.Chem.Soc., 131, 13399-13409. pubmed Hsu, S.-T.D., Varnai, P., Bugaut, A., Reszka, A.P., Neidle, S., Balasubramanian, S. Guanine-rich DNA sequences with the ability to form quadruplex structures are enriched in the promoter regions of protein-coding genes, particularly those of proto-oncogenes. G-quadruplexes are structurally polymorphic and their folding topologies can depend on the sample conditions. We report here on a structural study using solution state NMR spectroscopy of a second G-quadruplex-forming motif (c-kit2) that has been recently identified in the promoter region of the c-kit oncogene. In the presence of potassium ions, c-kit2 exists as an ensemble of structures that share the same parallel-stranded propeller-type conformations. Subtle differences in structural dynamics have been identified using hydrogen-deuterium exchange experiments by NMR spectroscopy, suggesting the coexistence of at least two structurally similar but dynamically distinct substates, which undergo slow interconversion on the NMR timescale.
2kqh DNA NMR A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics; 3Dmol view (2009) "A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics." J.Am.Chem.Soc., 131, 13399-13409. pubmed Hsu, S.-T.D., Varnai, P., Bugaut, A., Reszka, A.P., Neidle, S., Balasubramanian, S. Guanine-rich DNA sequences with the ability to form quadruplex structures are enriched in the promoter regions of protein-coding genes, particularly those of proto-oncogenes. G-quadruplexes are structurally polymorphic and their folding topologies can depend on the sample conditions. We report here on a structural study using solution state NMR spectroscopy of a second G-quadruplex-forming motif (c-kit2) that has been recently identified in the promoter region of the c-kit oncogene. In the presence of potassium ions, c-kit2 exists as an ensemble of structures that share the same parallel-stranded propeller-type conformations. Subtle differences in structural dynamics have been identified using hydrogen-deuterium exchange experiments by NMR spectroscopy, suggesting the coexistence of at least two structurally similar but dynamically distinct substates, which undergo slow interconversion on the NMR timescale.
2kvy DNA NMR NMR solution structure of the 4:1 complex between an uncharged distamycin A analogue and [d(TGGGGT)]4; 3Dmol view (2010) "Structural and conformational requisites in DNA quadruplex groove binding: another piece to the puzzle." J.Am.Chem.Soc., 132, 6425-6433. pubmed Cosconati, S., Marinelli, L., Trotta, R., Virno, A., De Tito, S., Romagnoli, R., Pagano, B., Limongelli, V., Giancola, C., Baraldi, P.G., Mayol, L., Novellino, E., Randazzo, A. The study of DNA G-quadruplex stabilizers has enjoyed a great momentum in the late years due to their application as anticancer agents. The recognition of the grooves of these structural motifs is expected to result in a higher degree of selectivity over other DNA structures. Therefore, to achieve an enhanced knowledge on the structural and conformational requisites for quadruplex groove recognition, distamycin A, the only compound for which a pure groove binding has been proven, has been chemically modified. Surprisingly, structural and thermodynamic studies revealed that the absence of Coulombic interactions results in an unprecedented binding position in which both the groove and the 3' end of the DNA are occupied. This further contribution adds another piece to the so far elusive puzzle of the recognition between ligands and DNA quadruplexes and will serve as a platform for a rational design of new groove binders.
2kyo DNA NMR Dimeric human ckit-2 proto-oncogene promoter quadruplex DNA NMR, 10 structures; 3Dmol view (2010) "Solution structures of all parallel-stranded monomeric and dimeric G-quadruplex scaffolds of the human c-kit2 promoter." Nucleic Acids Res., 38, 6757-6773. pubmed Kuryavyi, V., Phan, A.T., Patel, D.J. Previous studies have demonstrated that nuclease hypersensitivity regions of several proto-oncogenic DNA promoters, situated upstream of transcription start sites, contain guanine-rich tracts that form intramolecular G-quadruplexes stabilized by stacked G•G•G•G tetrads in monovalent cation solution. The human c-kit oncogenic promoter, an important target in the treatment of gastrointestinal tumors, contains two such stretches of guanine-rich tracts, designated c-kit1 and c-kit2. Our previous nuclear magnetic resonance (NMR)-based studies reported on the novel G-quadruplex scaffold of the c-kit1 promoter in K(+)-containing solution, where we showed for the first time that even an isolated guanine was involved in G-tetrad formation. These NMR-based studies are now extended to the c-kit2 promoter, which adopts two distinct all-parallel-stranded conformations in slow exchange, one of which forms a monomeric G-quadruplex (form-I) in 20 mM K(+)-containing solution and the other a novel dimeric G-quadruplex (form-II) in 100 mM K(+)-containing solution. The c-kit2 promoter dimeric form-II G-quadruplex adopts an unprecedented all-parallel-stranded topology where individual c-kit2 promoter strands span a pair of three-G-tetrad-layer-containing all-parallel-stranded G-quadruplexes aligned in a 3' to 5'-end orientation, with stacking continuity between G-quadruplexes mediated by a sandwiched A•A non-canonical pair. We propose that strand exchange during recombination events within guanine-rich segments, could potentially be mediated by a synapsis intermediate involving an intergenic parallel-stranded dimeric G-quadruplex.
2kyp DNA NMR Monomeric Human CKIT-2 proto-oncogene promoter quadruplex DNA NMR, 12 structures; 3Dmol view (2010) "Solution structures of all parallel-stranded monomeric and dimeric G-quadruplex scaffolds of the human c-kit2 promoter." Nucleic Acids Res., 38, 6757-6773. pubmed Kuryavyi, V., Phan, A.T., Patel, D.J. Previous studies have demonstrated that nuclease hypersensitivity regions of several proto-oncogenic DNA promoters, situated upstream of transcription start sites, contain guanine-rich tracts that form intramolecular G-quadruplexes stabilized by stacked G•G•G•G tetrads in monovalent cation solution. The human c-kit oncogenic promoter, an important target in the treatment of gastrointestinal tumors, contains two such stretches of guanine-rich tracts, designated c-kit1 and c-kit2. Our previous nuclear magnetic resonance (NMR)-based studies reported on the novel G-quadruplex scaffold of the c-kit1 promoter in K(+)-containing solution, where we showed for the first time that even an isolated guanine was involved in G-tetrad formation. These NMR-based studies are now extended to the c-kit2 promoter, which adopts two distinct all-parallel-stranded conformations in slow exchange, one of which forms a monomeric G-quadruplex (form-I) in 20 mM K(+)-containing solution and the other a novel dimeric G-quadruplex (form-II) in 100 mM K(+)-containing solution. The c-kit2 promoter dimeric form-II G-quadruplex adopts an unprecedented all-parallel-stranded topology where individual c-kit2 promoter strands span a pair of three-G-tetrad-layer-containing all-parallel-stranded G-quadruplexes aligned in a 3' to 5'-end orientation, with stacking continuity between G-quadruplexes mediated by a sandwiched A•A non-canonical pair. We propose that strand exchange during recombination events within guanine-rich segments, could potentially be mediated by a synapsis intermediate involving an intergenic parallel-stranded dimeric G-quadruplex.
2kzd DNA NMR Structure of a (3+1) G-quadruplex formed by hTERT promoter sequence; 3Dmol view (2010) "Coexistence of two distinct G-quadruplex conformations in the hTERT promoter." J.Am.Chem.Soc., 132, 12331-12342. pubmed Lim, K.W., Lacroix, L., Yue, D.J.E., Lim, J.K.C., Lim, J.M.W., Phan, A.T. The catalytic subunit of human telomerase, hTERT, actively elongates the 3' end of the telomere in most cancer cells. The hTERT promoter, which contains many guanine-rich stretches on the same DNA strand, exhibits an exceptional potential for G-quadruplex formation. Here we show that one particular G-rich sequence in this region coexists in two G-quadruplex conformations in potassium solution: a (3 + 1) and a parallel-stranded G-quadruplexes. We present the NMR solution structures of both conformations, each comprising several robust structural elements, among which include the (3 + 1) and all-parallel G-tetrad cores, single-residue double-chain-reversal loops, and a capping A.T base pair. A combination of NMR and CD techniques, complemented with sequence modifications and variations of experimental condition, allowed us to better understand the coexistence of the two G-quadruplex conformations in equilibrium and how different structural elements conspire to favor a particular form.
2kze DNA NMR Structure of an all-parallel-stranded G-quadruplex formed by hTERT promoter sequence; 3Dmol view (2010) "Coexistence of two distinct G-quadruplex conformations in the hTERT promoter." J.Am.Chem.Soc., 132, 12331-12342. pubmed Lim, K.W., Lacroix, L., Yue, D.J.E., Lim, J.K.C., Lim, J.M.W., Phan, A.T. The catalytic subunit of human telomerase, hTERT, actively elongates the 3' end of the telomere in most cancer cells. The hTERT promoter, which contains many guanine-rich stretches on the same DNA strand, exhibits an exceptional potential for G-quadruplex formation. Here we show that one particular G-rich sequence in this region coexists in two G-quadruplex conformations in potassium solution: a (3 + 1) and a parallel-stranded G-quadruplexes. We present the NMR solution structures of both conformations, each comprising several robust structural elements, among which include the (3 + 1) and all-parallel G-tetrad cores, single-residue double-chain-reversal loops, and a capping A.T base pair. A combination of NMR and CD techniques, complemented with sequence modifications and variations of experimental condition, allowed us to better understand the coexistence of the two G-quadruplex conformations in equilibrium and how different structural elements conspire to favor a particular form.
2l7v DNA-inhibitor NMR Quindoline/G-quadruplex complex; 3Dmol view (2011) "Solution Structure of a 2:1 Quindoline-c-MYC G-Quadruplex: Insights into G-Quadruplex-Interactive Small Molecule Drug Design." J.Am.Chem.Soc., 133, 17673-17680. pubmed Dai, J., Carver, M., Hurley, L.H., Yang, D. Unimolecular parallel-stranded G-quadruplex structures are found to be prevalent in gene promoters. The nuclease hypersensitivity element III(1) (NHE III(1)) of the c-MYC promoter can form transcriptionally active and silenced forms, and the formation of DNA G-quadruplex structures has been shown to be critical for c-MYC transcriptional silencing. The solution structure of a 2:1 quindoline-G-quadruplex complex has been solved and shows unexpected features, including the drug-induced reorientation of the flanking sequences to form a new binding pocket. While both 3' and 5' complexes show overall similar features, there are identifiable differences that emphasize the importance of both stacking and electronic interactions. For the first time, we describe the importance of the shape of the ligand as well as the two flanking bases in determining drug binding specificity. These structures provide important insights for the structure-based rational design of drugs that bind to unimolecular parallel G-quadruplexes commonly found in promoter elements.
2l88 DNA NMR Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence; 3Dmol view (2011) "Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence." Nucleic Acids Res., 39, 6753-6763. pubmed Tong, X., Lan, W., Zhang, X., Wu, H., Liu, M., Cao, C. RET protein functions as a receptor-type tyrosine kinase and has been found to be aberrantly expressed in a wide range of human diseases. A highly GC-rich region upstream of the promoter plays an important role in the transcriptional regulation of RET. Here, we report the NMR solution structure of the major intramolecular G-quadruplex formed on the G-rich strand of this region in K(+) solution. The overall G-quadruplex is composed of three stacked G-tetrad and four syn guanines, which shows distinct features for all parallel-stranded folding topology. The core structure contains one G-tetrad with all syn guanines and two other with all anti-guanines. There are three double-chain reversal loops: the first and the third loops are made of 3 nt G-C-G segments, while the second one contains only 1 nt C10. These loops interact with the core G-tetrads in a specific way that defines and stabilizes the overall G-quadruplex structure and their conformations are in accord with the experimental mutations. The distinct RET promoter G-quadruplex structure suggests that it can be specifically involved in gene regulation and can be an attractive target for pathway-specific drug design.
2la5 RNA binding protein-RNA NMR RNA Duplex-Quadruplex Junction Complex with FMRP RGG peptide; 3Dmol view (2011) "Structure-function studies of FMRP RGG peptide recognition of an RNA duplex-quadruplex junction." Nat.Struct.Mol.Biol., 18, 796-804. pubmed Phan, A.T., Kuryavyi, V., Darnell, J.C., Serganov, A., Majumdar, A., Ilin, S., Raslin, T., Polonskaia, A., Chen, C., Clain, D., Darnell, R.B., Patel, D.J. We have determined the solution structure of the complex between an arginine-glycine-rich RGG peptide from the human fragile X mental retardation protein (FMRP) and an in vitro-selected guanine-rich (G-rich) sc1 RNA. The bound RNA forms a newly discovered G-quadruplex separated from the flanking duplex stem by a mixed junctional tetrad. The RGG peptide is positioned along the major groove of the RNA duplex, with the G-quadruplex forcing a sharp turn of R(10)GGGGR(15) at the duplex-quadruplex junction. Arg10 and Arg15 form cross-strand specificity-determining intermolecular hydrogen bonds with the major-groove edges of guanines of adjacent Watson-Crick G•C pairs. Filter-binding assays on RNA and peptide mutations identify and validate contributions of peptide-RNA intermolecular contacts and shape complementarity to molecular recognition. These findings on FMRP RGG domain recognition by a combination of G-quadruplex and surrounding RNA sequences have implications for the recognition of other genomic G-rich RNAs.
2lby DNA NMR G-quadruplex structure formed at the 5'-end of NHEIII_1 element in human c-MYC promoter; 3Dmol view (2011) "c-MYC promoter G-quadruplex formed at the 5'-end of NHE III1 element: insights into biological relevance and parallel-stranded G-quadruplex stability." Nucleic Acids Res., 39, 9023-9033. pubmed Mathad, R.I., Hatzakis, E., Dai, J., Yang, D. We studied the structures and stabilities of G-quadruplexes formed in Myc1234, the region containing the four consecutive 5' runs of guanines of c-MYC promoter NHE III(1,) which have recently been shown to form in a supercoiled plasmid system in aqueous solution. We determined the NMR solution structure of the 1:2:1 parallel-stranded loop isomer, one of the two major loop isomers formed in Myc1234 in K(+) solution. This major loop isomer, although sharing the same folding structure, appears to be markedly less stable than the major loop isomer formed in the single-stranded c-MYC NHE III(1) oligonucleotide, the Myc2345 G-quadruplex. Our NMR structures indicated that the different thermostabilities of the two 1:2:1 parallel c-MYC G-quadruplexes are likely caused by the different base conformations of the single nucleotide loops. The observation of the formation of the Myc1234 G-quadruplex in the supercoiled plasmid thus points to the potential role of supercoiling in the G-quadruplex formation in promoter sequences. We also performed a systematic thermodynamic analysis of modified c-MYC NHE III(1) sequences, which provided quantitative measure of the contributions of various loop sequences to the thermostabilities of parallel-stranded G-quadruplexes. This information is important for understanding the equilibrium of promoter G-quadruplex loop isomers and for their drug targeting.
2ld8 DNA NMR Structure of Human Telomeric DNA in Crowded Solution; 3Dmol view (2011) "Structure of Human Telomeric DNA in Crowded Solution." J.Am.Chem.Soc. pubmed Heddi, B., Phan, A.T. G-quadruplex structures formed by DNA at the human telomeres are attractive anticancer targets. Human telomeric sequences can adopt a diverse range of intramolecular G-quadruplex conformations: a parallel-stranded conformation was observed in the crystalline state, while at least four other forms were seen in K(+) solution, raising the question of which conformation is favored in crowded cellular environment. Here, we report the first NMR structure of a human telomeric G-quadruplex in crowded solution. We show that four different G-quadruplex conformations are converted to a propeller-type parallel-stranded G-quadruplex in K(+)-containing crowded solution due to water depletion. This study also reveals the formation of a new higher-order G-quadruplex structure under molecular crowding conditions. Our molecular dynamics simulations of solvent distribution provide insights at molecular level on the formation of parallel-stranded G-quadruplex in environment depleted of water. These results regarding human telomeric DNA can be extended to oncogenic promoters and other genomic G-rich sequences.
2le6 DNA NMR Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface; 3Dmol view (2011) "Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity." Nucleic Acids Res. pubmed Do, N.Q., Lim, K.W., Teo, M.H., Heddi, B., Phan, A.T. G-rich oligonucleotides T30695 (or T30923), with the sequence of (GGGT)(4), and T40214, with the sequence of (GGGC)(4), have been reported to exhibit anti-HIV and anticancer activity. Here we report on the structure of a dimeric G-quadruplex adopted by a derivative of these sequences in K(+) solution. It comprises two identical propeller-type parallel-stranded G-quadruplex subunits each containing three G-tetrad layers that are stacked via the 5'-5' interface. We demonstrated control over the stacking of the two monomeric subunits by sequence modifications. Our analysis of possible structures at the stacking interface provides a general principle for stacking of G-quadruplexes, which could have implications for the assembly and recognition of higher-order G-quadruplex structures.
2led DNA NMR Unique structural features of interconverting monomeric and dimeric G-quadruplexes adopted by a sequence from intron of N-myc gene; 3Dmol view (2012) "Unique Structural Features of Interconverting Monomeric and Dimeric G-Quadruplexes Adopted by a Sequence from the Intron of the N-myc Gene." J.Am.Chem.Soc., 134, 4132-4141. pubmed Trajkovski, M., Webba da Silva, M., Plavec, J. A multidimensional heteronuclear NMR study has demonstrated that a guanine-rich DNA oligonucleotide originating from the N-myc gene folds into G-quadruplex structures in the presence of K(+), NH(4)(+), and Na(+) ions. A monomeric G-quadruplex formed in K(+) ion containing solution exhibits three G-quartets and flexible propeller-type loops. The 3D structure with three single nucleotide loops represents a missing element in structures of parallel G-quadruplexes. The structural features together with the high temperature stability are suggestive of the specific biological role of G-quadruplex formation within the intron of the N-myc gene. An increase in K(+) ion and oligonucleotide concentrations resulted in transformation of the monomeric G-quadruplex into a dimeric form. The dimeric G-quadruplex exhibits six stacked G-quartets, parallel strand orientations, and propeller-type loops. A link between the third and the fourth G-quartets consists of two adenine residues that are flipped out to facilitate consecutive stacking of six G-quartets.
2lee DNA NMR Unique structural features of interconverting monomeric and dimeric G-quadruplexes adopted by a sequence from intron of N-myc gene; 3Dmol view (2012) "Unique Structural Features of Interconverting Monomeric and Dimeric G-Quadruplexes Adopted by a Sequence from the Intron of the N-myc Gene." J.Am.Chem.Soc., 134, 4132-4141. pubmed Trajkovski, M., Webba da Silva, M., Plavec, J. A multidimensional heteronuclear NMR study has demonstrated that a guanine-rich DNA oligonucleotide originating from the N-myc gene folds into G-quadruplex structures in the presence of K(+), NH(4)(+), and Na(+) ions. A monomeric G-quadruplex formed in K(+) ion containing solution exhibits three G-quartets and flexible propeller-type loops. The 3D structure with three single nucleotide loops represents a missing element in structures of parallel G-quadruplexes. The structural features together with the high temperature stability are suggestive of the specific biological role of G-quadruplex formation within the intron of the N-myc gene. An increase in K(+) ion and oligonucleotide concentrations resulted in transformation of the monomeric G-quadruplex into a dimeric form. The dimeric G-quadruplex exhibits six stacked G-quartets, parallel strand orientations, and propeller-type loops. A link between the third and the fourth G-quartets consists of two adenine residues that are flipped out to facilitate consecutive stacking of six G-quartets.
2lk7 DNA NMR Monomer-dimer equilibrium for 5'-5' stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study; 3Dmol view (2012) "Monomer-Dimer Equilibrium for the 5'-5' Stacking of Propeller-Type Parallel-Stranded G-Quadruplexes: NMR Structural Study." Chemistry pubmed Do, N.Q., Phan, A.T. Guanine-rich sequence motifs, which contain tracts of three consecutive guanines connected by single non-guanine nucleotides, are abundant in the human genome and can form a robust G-quadruplex structure with high stability. Herein, by using NMR spectroscopy, we investigate the equilibrium between monomeric and 5'-5' stacked dimeric propeller-type G-quadruplexes that are formed by DNA sequences containing GGGT motifs. We show that the monomer-dimer equilibrium depends on a number of parameters, including the DNA concentration, DNA flanking sequences, the concentration and type of cations, and the temperature. We report on the high-definition structure of a simple monomeric G-quadruplex containing three single-residue loops, which could serve as a reference for propeller-type G-quadruplex structures in solution.
2lod DNA NMR Solution-state structure of an intramolecular G-quadruplex with propeller, diagonal and edgewise loops; 3Dmol view (2012) "Solution-state structure of an intramolecular G-quadruplex with propeller, diagonal and edgewise loops." Nucleic Acids Res., 40, 6946-6956. pubmed Marusic, M., Sket, P., Bauer, L., Viglasky, V., Plavec, J. We herein report on the formation and high-resolution NMR solution-state structure determination of a G-quadruplex adopted by d[G(3)ATG(3)ACACAG(4)ACG(3)] comprised of four G-tracts with the third one consisting of four guanines that are intervened with non-G streches of different lengths. A single intramolecular antiparallel (3+1) G-quadruplex exhibits three stacked G-quartets connected with propeller, diagonal and edgewise loops of different lengths. The propeller and edgewise loops are well structured, whereas the longer diagonal loop is more flexible. To the best of our knowledge, this is the first high-resolution G-quadruplex structure where all of the three main loop types are present.
2lpw DNA NMR human CEB25 minisatellite G-quadruplex; 3Dmol view (2012) "Formation of Pearl-Necklace Monomorphic G-Quadruplexes in the Human CEB25 Minisatellite." J.Am.Chem.Soc., 134, 5807-5816. pubmed Amrane, S., Adrian, M., Heddi, B., Serero, A., Nicolas, A., Mergny, J.L., Phan, A.T. CEB25 is a human minisatellite locus, composed of slightly polymorphic 52-nucleotide (nt) tandem repeats. Genetically, most if not all individuals of the human population are heterozygous, carrying alleles ranging from 0.5 to 20 kb, maintained by mendelian inheritance but also subject to germline instability. To provide insights on the biological role of CEB25, we interrogated its structural features. We report the NMR structure of the G-quadruplex formed by the conserved 26-nt G-rich fragment of the CEB25 motif. In K(+) solution, this sequence forms a propeller-type parallel-stranded G-quadruplex involving a 9-nt central double-chain-reversal loop. This long loop is anchored to the 5'-end of the sequence by an A·T Watson-Crick base pair and a potential G·A noncanonical base pair. These base pairs contribute to the stability of the overall G-quadruplexstructure, as measured by an increase of about 17 kcal/mol in enthalpy or 6 °C in melting temperature. Further, we demonstrate that such a monomorphic structure is formed within longer sequence contexts folding into a pearl-necklace structure.
2lxq DNA NMR Monomeric PilE G-Quadruplex DNA from Neisseria Gonorrhoeae; 3Dmol view (2012) "RecA-Binding pilE G4 Sequence Essential for Pilin Antigenic Variation Forms Monomeric and 5' End-Stacked Dimeric Parallel G-Quadruplexes." Structure, 20, 2090-2102. pubmed Kuryavyi, V., Cahoon, L.A., Seifert, H.S., Patel, D.J. Neisseria gonorrhoeae is an obligate human pathogen that can escape immune surveillance through antigenic variation of surface structures such as pili. A G-quadruplex-forming (G4) sequence (5'-G(3)TG(3)TTG(3)TG(3)) located upstream of the N. gonorrhoeae pilin expression locus (pilE) is necessary for initiation of pilin antigenic variation, a recombination-based, high-frequency, diversity-generation system. We have determined NMR-based structures of the all parallel-stranded monomeric and 5' end-stacked dimeric pilE G-quadruplexes in monovalent cation-containing solutions. We demonstrate that the three-layered all parallel-stranded monomeric pilE G-quadruplex containing single-residue double-chain reversal loops, which can be modeled without steric clashes into the 3 nt DNA-binding site of RecA, binds and promotes E. coli RecA-mediated strand exchange in vitro. We discuss how interactions between RecA and monomeric pilE G-quadruplex could facilitate the specialized recombination reactions leading to pilin diversification.
2lxv DNA NMR Dimeric pil-e g-quadruplex dna from neisseria gonorrhoeae, NMR 11 structures; 3Dmol view (2012) "RecA-Binding pilE G4 Sequence Essential for Pilin Antigenic Variation Forms Monomeric and 5' End-Stacked Dimeric Parallel G-Quadruplexes." Structure, 20, 2090-2102. pubmed Kuryavyi, V., Cahoon, L.A., Seifert, H.S., Patel, D.J. Neisseria gonorrhoeae is an obligate human pathogen that can escape immune surveillance through antigenic variation of surface structures such as pili. A G-quadruplex-forming (G4) sequence (5'-G(3)TG(3)TTG(3)TG(3)) located upstream of the N. gonorrhoeae pilin expression locus (pilE) is necessary for initiation of pilin antigenic variation, a recombination-based, high-frequency, diversity-generation system. We have determined NMR-based structures of the all parallel-stranded monomeric and 5' end-stacked dimeric pilE G-quadruplexes in monovalent cation-containing solutions. We demonstrate that the three-layered all parallel-stranded monomeric pilE G-quadruplex containing single-residue double-chain reversal loops, which can be modeled without steric clashes into the 3 nt DNA-binding site of RecA, binds and promotes E. coli RecA-mediated strand exchange in vitro. We discuss how interactions between RecA and monomeric pilE G-quadruplex could facilitate the specialized recombination reactions leading to pilin diversification.
2lyg DNA NMR Fuc_TBA; 3Dmol view (2013) "Carbohydrate-DNA interactions at G-quadruplexes: folding and stability changes by attaching sugars at the 5'-end." Chemistry, 19, 1920-1927. pubmed Gomez-Pinto, I., Vengut-Climent, E., Lucas, R., Avino, A., Eritja, R., Gonzalez, C., Morales, J.C. Quadruplex DNA structures are attracting an enormous interest in many areas of chemistry, ranging from chemical biology, supramolecular chemistry to nanoscience. We have prepared carbohydrate-DNA conjugates containing the oligonucleotide sequences of G-quadruplexes (thrombin binding aptamer (TBA) and human telomere (TEL)), measured their thermal stability and studied their structure in solution by using NMR and molecular dynamics. The solution structure of a fucose-TBA conjugate shows stacking interactions between the carbohydrate and the DNA G-tetrad in addition to hydrogen bonding and hydrophobic contacts. We have also shown that attaching carbohydrates at the 5'-end of a quadruplex telomeric sequence can alter its folding topology. These results suggest the possibility of modulating the folding of the G-quadruplex by linking carbohydrates and have clear implications in molecular recognition and the design of new G-quadruplex ligands.
2m18 RNA NMR Structure of stacked G-quadruplex formed by human TERRA sequence in potassium solution; 3Dmol view (2013) "Structure of Human Telomeric RNA (TERRA): Stacking of Two G-Quadruplex Blocks in K(+) Solution." Biochemistry, 52, 2176-2183. pubmed Martadinata, H., Phan, A.T. Telomeric repeat-containing RNAs (TERRA) are transcription products of the telomeres. Human TERRA sequences containing UUAGGG repeats can form parallel-stranded G-quadruplexes. The stacking interaction of such structures was shown to be important for ligand targeting and higher-order arrangement of G-quadruplexes in long TERRA sequences. Here we report on the first high-resolution structure of a stacked G-quadruplex formed by the 10-nucleotide human TERRA sequence r(GGGUUAGGGU) in potassium solution. This structure comprises two dimeric three-layer parallel-stranded G-quadruplex blocks, which stack on each other at their 5'-ends. The adenine in each UUA loop is nearly coplanar with the 5'-end G-tetrad forming an A·(G·G·G·G)·A hexad, thereby increasing the stacking contacts between the two blocks. Interestingly, this stacking and loop conformation is different from all structures previously reported for the free human TERRA but resembles the structure previously determined for a complex between a human TERRA sequence and an acridine ligand. This stacking conformation is a potential target for drugs that recognize or induce the stacking interface.
2m1g DNA NMR Parallel human telomeric quadruplex containing 2'F-ANA substitutions; 3Dmol view (2013) "Dramatic effect of furanose c2' substitution on structure and stability: directing the folding of the human telomeric quadruplex with a single fluorine atom." J.Am.Chem.Soc., 135, 5344-5347. pubmed Martin-Pintado, N., Yahyaee-Anzahaee, M., Deleavey, G.F., Portella, G., Orozco, M., Damha, M.J., Gonzalez, C. Human telomeric DNA quadruplexes can adopt different conformations in solution. We have found that arabinose, 2'F-arabinose, and ribose substitutions stabilize the propeller parallel G-quadruplex form over competing conformers, allowing NMR structural determination of this particularly significant nucleic acid structure. 2'F-arabinose substitution provides the greatest stabilization as a result of electrostatic (F-CH---O4') and pseudo-hydrogen-bond (F---H8) stabilizing interactions. In contrast, 2'F-rG substitution provokes a dramatic destabilization of the quadruplex structure due to unfavorable electrostatic repulsion between the phosphate and the 2'-F.
2m27 DNA NMR Major G-quadruplex structure formed in human VEGF promoter, a monomeric parallel-stranded quadruplex; 3Dmol view (2013) "Solution structure of the major G-quadruplex formed in the human VEGF promoter in K+: insights into loop interactions of the parallel G-quadruplexes." Nucleic Acids Res., 41, 10584-10592. pubmed Agrawal, P., Hatzakis, E., Guo, K., Carver, M., Yang, D. Vascular endothelial growth factor (VEGF) proximal promoter region contains a poly G/C-rich element that is essential for basal and inducible VEGF expression. The guanine-rich strand on this tract has been shown to form the DNA G-quadruplex structure, whose stabilization by small molecules can suppress VEGF expression. We report here the nuclear magnetic resonance structure of the major intramolecular G-quadruplex formed in this region in K(+) solution using the 22mer VEGF promoter sequence with G-to-T mutations of two loop residues. Our results have unambiguously demonstrated that the major G-quadruplex formed in the VEGF promoter in K(+) solution is a parallel-stranded structure with a 1:4:1 loop-size arrangement. A unique capping structure was shown to form in this 1:4:1 G-quadruplex. Parallel-stranded G-quadruplexes are commonly found in the human promoter sequences. The nuclear magnetic resonance structure of the major VEGF G-quadruplex shows that the 4-nt middle loop plays a central role for the specific capping structures and in stabilizing the most favored folding pattern. It is thus suggested that each parallel G-quadruplex likely adopts unique capping and loop structures by the specific middle loops and flanking segments, which together determine the overall structure and specific recognition sites of small molecules or proteins.LAY SUMMARY: The human VEGF is a key regulator of angiogenesis and plays an important role in tumor survival, growth and metastasis. VEGF overexpression is frequently found in a wide range of human tumors; the VEGF pathway has become an attractive target for cancer therapeutics. DNA G-quadruplexes have been shown to form in the proximal promoter region of VEGF and are amenable to small molecule drug targeting for VEGF suppression. The detailed molecular structure of the major VEGF promoter G-quadruplex reported here will provide an important basis for structure-based rational development of small molecule drugs targeting the VEGF G-quadruplex for gene suppression.
2m4p DNA NMR Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge; 3Dmol view (2013) "Bulges in G-Quadruplexes: Broadening the Definition of G-Quadruplex-Forming Sequences." J.Am.Chem.Soc., 135, 5017-5028. pubmed Mukundan, V.T., Phan, A.T. We report on the first solution structure of an intramolecular G-quadruplex containing a single bulge and present evidence for extensive occurrence of bulges in different G-quadruplex contexts. The NMR solution structure of the d(TTGTGGTGGGTGGGTGGGT) sequence reveals a propeller-type parallel-stranded G-quadruplex containing three G-tetrad layers, three double-chain-reversal loops, and a bulge. All guanines participate in the formation of the G-tetrad core, despite the interruption between the first guanine and the next two guanines by a thymine, which forms a single-residue bulge and is projected out of the G-tetrad core. To provide a more general understanding about the formation of bulges within G-quadruplexes, we systematically investigated the effects of the residue type, the size, the position, and the number of bulges on the structure and stability of G-quadruplexes. The formation of bulges has also been observed in two different G-quadruplex scaffolds with different strand orientations and folding topologies. Our results show that bulges can be formed in many different situations within G-quadruplexes. While many sequences tested in this study can form stable G-quadruplex structures, all of them defy the description of sequences G3+NL1G3+NL2G3+NL3G3+, currently used in most bioinformatics searches for identifying potential G-quadruplex-forming sequences in the genomes. Broadening of this description to include the possibilities of bulge formation should allow the identification of more G-quadruplex-forming sequences which went unnoticed in the earlier searches. This study could also open the possibilities of exploiting bulges as recognition elements for interactions between G-quadruplexes and other molecules.
2m53 DNA NMR G-rich VEGF aptamer with LNA modifications; 3Dmol view (2013) "G-rich VEGF aptamer with locked and unlocked nucleic acid modifications exhibits a unique G-quadruplex fold." Nucleic Acids Res. pubmed Marusic, M., Veedu, R.N., Wengel, J., Plavec, J. The formation of a single G-quadruplex structure adopted by a promising 25 nt G-rich vascular endothelial growth factor aptamer in a K(+) rich environment was facilitated by locked nucleic acid modifications. An unprecedented all parallel-stranded monomeric G-quadruplex with three G-quartet planes exhibits several unique structural features. Five consecutive guanine residues are all involved in G-quartet formation and occupy positions in adjacent DNA strands, which are bridged with a no-residue propeller-type loop. A two-residue D-shaped loop facilitates inclusion of an isolated guanine residue into the vacant spot within the G-quartet. The remaining two G-rich tracts of three residues each adopt parallel orientation and are linked with edgewise and propeller loops. Both 5' with 3 nt and 3' with 4 nt overhangs display well-defined conformations, with latter adopting a basket handle topology. Locked residues contribute to thermal stabilization of the adopted structure and formation of structurally pre-organized intermediates that facilitate folding into a single G-quadruplex. Understanding the impact of chemical modifications on folding, thermal stability and structural polymorphism of G-quadruplexes provides means for the improvement of vascular endothelial growth factor aptamers and advances our insights into driving nucleic acid structure by locking or unlocking the conformation of sugar moieties of nucleotides in general.
2m6v DNA NMR Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions; 3Dmol view (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007-eaat3007. pubmed Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M. The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
2m6w DNA NMR Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions; 3Dmol view (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007-eaat3007. pubmed Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M. The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
2m8z DNA NMR Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid; 3Dmol view (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. pubmed Lim, K.W., Phan, A.T. Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex–duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G‐quadruplex scaffold to generate a G‐junction.
2m90 DNA NMR Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid; 3Dmol view (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. pubmed Lim, K.W., Phan, A.T. Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex–duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G‐quadruplex scaffold to generate a G‐junction.
2m91 DNA NMR Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] quadruplex-duplex hybrid; 3Dmol view (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. pubmed Lim, K.W., Phan, A.T. Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex–duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G‐quadruplex scaffold to generate a G‐junction.
2m92 DNA NMR Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid; 3Dmol view (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. pubmed Lim, K.W., Phan, A.T. Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex–duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G‐quadruplex scaffold to generate a G‐junction.
2m93 DNA NMR Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid; 3Dmol view (2013) "Structural Basis of DNA Quadruplex-Duplex Junction Formation." Angew.Chem.Int.Ed.Engl. pubmed Lim, K.W., Phan, A.T. Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex–duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G‐quadruplex scaffold to generate a G‐junction.
2may DNA NMR Structure of a G-quadruplex containing a single LNA modification; 3Dmol view "Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes." To be Published Li, Z., Lech, C., Adrian, M., Heddi, B., Phan, A.T.
2mb2 DNA NMR parallel-stranded G-quadruplex in DNA poly-G stretches; 3Dmol view (2014) "Formation of g-quadruplexes in poly-g sequences: structure of a propeller-type parallel-stranded g-quadruplex formed by a g15 stretch." Biochemistry, 53, 7718-7723. pubmed Sengar, A., Heddi, B., Phan, A.T. Poly-G sequences are found in different genomes including human and have the potential to form higher-order structures with various applications. Previously, long poly-G sequences were thought to lead to multiple possible ways of G-quadruplex folding, rendering their structural characterization challenging. Here we investigate the structure of G-quadruplexes formed by poly-G sequences d(TTG(n)T), where n = 12 to 19. Our data show the presence of multiple and/or higher-order G-quadruplex structures in most sequences. Strikingly, NMR spectra of the TTG₁₅T sequence containing a stretch of 15 continuous guanines are exceptionally well-resolved and indicate the formation of a well-defined G-quadruplex structure. The NMR solution structure of this sequence revealed a propeller-type parallel-stranded G-quadruplex containing three G-tetrad layers and three single-guanine propeller loops. The same structure can potentially form anywhere along a long G(n) stretch, making it unique for molecular recognition by other cellular molecules.
2mb3 DNA-DNA inhibitor NMR Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative; 3Dmol view (2013) "Solution structure of an intramolecular (3 + 1) human telomeric g-quadruplex bound to a telomestatin derivative." J.Am.Chem.Soc., 135, 13495-13501. pubmed Chung, W.J., Heddi, B., Tera, M., Iida, K., Nagasawa, K., Phan, A.T. Guanine-rich human telomeric DNA can adopt secondary structures known as G-quadruplexes, which can be targeted by small molecules to achieve anticancer effects. So far, the structural information on complexes between human telomeric DNA and ligands is limited to the parallel G-quadruplex conformation, despite the high structural polymorphism of human telomeric G-quadruplexes. No structure has been yet resolved for the complex with telomestatin, one of the most promising G-quadruplex-targeting anticancer drug candidates. Here we present the first high-resolution structure of the complex between an intramolecular (3 + 1) human telomeric G-quadruplex and a telomestatin derivative, the macrocyclic hexaoxazole L2H2-6M(2)OTD. This compound is observed to interact with the G-quadruplex through π-stacking and electrostatic interactions. This structural information provides a platform for the design of topology-specific G-quadruplex-targeting compounds and is valuable for the development of new potent anticancer drugs.
2mb4 DNA NMR Solution structure of a stacked dimeric G-quadruplex formed by a segment of the human CEB1 minisatellite; 3Dmol view (2014) "Structure and Conformational Dynamics of a Stacked Dimeric G-Quadruplex Formed by the Human CEB1 Minisatellite." J.Am.Chem.Soc., 136, 6297-6305. pubmed Adrian, M., Ang, D.J., Lech, C.J., Heddi, B., Nicolas, A., Phan, A.T. CEB1 is a highly polymorphic human minisatellite. In yeast, the size variation of CEB1 tandem arrays has been associated with the capacity of the motif to form G-quadruplexes. Here we report on the NMR solution structure of a G-quadruplex formed by the CEB1 DNA G-rich fragment d(AGGGGGGAGGGAGGGTGG), harboring several G-tracts including one with six continuous guanines. This sequence forms a dimeric G-quadruplex involving the stacking of two subunits, each being a unique snapback parallel-stranded scaffold with three G-tetrad layers, three double-chain-reversal loops, and a V-shaped loop. The two subunits are stacked at their 5'-end tetrads, and multiple stacking rotamers may be present due to a high symmetry at the stacking interface. There is a conformational exchange in the millisecond time scale involving a swapping motion between two bases of the six-guanine tract. Our results not only add to the understanding of how the G-quadruplex formation in human minisatellite leads to genetic instability but also address the fundamental questions regarding stacking of G-quadruplexes and how a long continuous G-tract participates in the structure and conformational dynamics of G-quadruplexes.
2mbj DNA NMR Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution); 3Dmol view (2013) "Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity." Nucleic Acids Res., 41, 10556-10562. pubmed Lim, K.W., Ng, V.C., Martin-Pintado, N., Heddi, B., Phan, A.T. Single-stranded DNA overhangs at the ends of human telomeric repeats are capable of adopting four-stranded G-quadruplex structures, which could serve as potential anticancer targets. Out of the five reported intramolecular human telomeric G-quadruplex structures, four were formed in the presence of K(+) ions and only one in the presence of Na(+) ions, leading often to a perception that this structural polymorphism occurs exclusively in the presence of K(+) but not Na(+). Here we present the structure of a new antiparallel (2+2) G-quadruplex formed by a derivative of a 27-nt human telomeric sequence in Na(+) solution, which comprises a novel core arrangement distinct from the known topologies. This structure complements the previously elucidated basket-type human telomeric G-quadruplex to serve as reference structures in Na(+)-containing environment. These structures, together with the coexistence of other conformations in Na(+) solution as observed by nuclear magnetic resonance spectroscopy, establish the polymorphic nature of human telomeric repeats beyond the influence of K(+) ions.
2mcc DNA NMR Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence; 3Dmol view (2013) "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence." J.Med.Chem., 56, 8674-8683. pubmed Wilson, T., Costa, P.J., Felix, V., Williamson, M.P., Thomas, J.A. We report DNA binding studies of the dinuclear ruthenium ligand [{Ru(phen)2}2tpphz](4+) in enantiomerically pure forms. As expected from previous studies of related complexes, both isomers bind with similar affinity to B-DNA and have enhanced luminescence. However, when tested against the G-quadruplex from human telomeres (which we show to form an antiparallel basket structure with a diagonal loop across one end), the ΛΛ isomer binds approximately 40 times more tightly than the ΔΔ, with a stronger luminescence. NMR studies show that the complex binds at both ends of the quadruplex. Modeling studies, based on experimentally derived restraints obtained for the closely related [{Ru(bipy)2}2tpphz](4+), show that the ΛΛ isomer fits neatly under the diagonal loop, whereas the ΔΔ isomer is unable to bind here and binds at the lateral loop end. Molecular dynamics simulations show that the ΔΔ isomer is prevented from binding under the diagonal loop by the rigidity of the loop. We thus present a novel enantioselective binding substrate for antiparallel basket G-quadruplexes, with features that make it a useful tool for quadruplex studies.
2mco DNA NMR Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence; 3Dmol view (2013) "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence." J.Med.Chem., 56, 8674-8683. pubmed Wilson, T., Costa, P.J., Felix, V., Williamson, M.P., Thomas, J.A. We report DNA binding studies of the dinuclear ruthenium ligand [{Ru(phen)2}2tpphz](4+) in enantiomerically pure forms. As expected from previous studies of related complexes, both isomers bind with similar affinity to B-DNA and have enhanced luminescence. However, when tested against the G-quadruplex from human telomeres (which we show to form an antiparallel basket structure with a diagonal loop across one end), the ΛΛ isomer binds approximately 40 times more tightly than the ΔΔ, with a stronger luminescence. NMR studies show that the complex binds at both ends of the quadruplex. Modeling studies, based on experimentally derived restraints obtained for the closely related [{Ru(bipy)2}2tpphz](4+), show that the ΛΛ isomer fits neatly under the diagonal loop, whereas the ΔΔ isomer is unable to bind here and binds at the lateral loop end. Molecular dynamics simulations show that the ΔΔ isomer is prevented from binding under the diagonal loop by the rigidity of the loop. We thus present a novel enantioselective binding substrate for antiparallel basket G-quadruplexes, with features that make it a useful tool for quadruplex studies.
2mft DNA NMR Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions; 3Dmol view "Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions." To be Published Karsisiotis, A.I., Webba da Silva, M.
2mfu DNA NMR Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions; 3Dmol view "Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions." To be Published Karsisiotis, A., Dillon, P., Webba da Silva, M.
2mgn DNA NMR Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3; 3Dmol view (2014) "Solution Structure of a G-quadruplex Bound to the Bisquinolinium Compound Phen-DC3." Angew.Chem.Int.Ed.Engl., 53, 999-1002. pubmed Chung, W.J., Heddi, B., Hamon, F., Teulade-Fichou, M.P., Phan, A.T. Phen-DC3 is a highly promising compound that specifically targets G-quadruplexes, with potent biological effects observed in vivo. We used NMR spectroscopy to solve the structure of the complex formed between Phen-DC3 and an intramolecular G-quadruplex derived from the c-myc promoter. Structural information revealed that Phen-DC3 interacts with the quadruplex through extensive π-stacking with guanine bases of the top G-tetrad. On the basis of our structure, modifications are proposed for the development of this compound for selective targeting of a specific G-quadruplex conformation.
2ms6 DNA NMR Human Telomeric G-quadruplex DNA sequence (TTAGGGT)4 complexed with Flavonoid Quercetin; 3Dmol view (2015) "Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence." Sci Rep, 5, 17574-17574. pubmed Tawani, A., Kumar, A. Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent.
2ms9 DNA NMR Solution structure of a G-quadruplex; 3Dmol view (2015) "Structure of a left-handed DNA G-quadruplex." Proc.Natl.Acad.Sci.USA Chung, W.J., Heddi, B., Schmitt, E., Lim, K.W., Mechulam, Y., Phan, A.T.
2mwz DNA NMR Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G G X O tetrad; 3Dmol view (2015) "Xanthine and 8-oxoguanine in G-quadruplexes: formation of a GGXO tetrad." Nucleic Acids Res., 43, 10506-10514. pubmed Cheong, V.V., Heddi, B., Lech, C.J., Phan, A.T. G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions.
2n21 hydrolase-DNA NMR Solution structure of complex between DNA G-quadruplex and G-quadruplex recognition domain of RHAU; 3Dmol view (2015) "Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex." Proc.Natl.Acad.Sci.USA pubmed Heddi, B., Cheong, V.V., Martadinata, H., Phan, A.T. Four-stranded nucleic acid structures called G-quadruplexes have been associated with important cellular processes, which should require G-quadruplex-protein interaction. However, the structural basis for specific G-quadruplex recognition by proteins has not been understood. The DEAH (Asp-Glu-Ala-His) box RNA helicase associated with AU-rich element (RHAU) (also named DHX36 or G4R1) specifically binds to and resolves parallel-stranded G-quadruplexes. Here we identified an 18-amino acid G-quadruplex-binding domain of RHAU and determined the structure of this peptide bound to a parallel DNA G-quadruplex. Our structure explains how RHAU specifically recognizes parallel G-quadruplexes. The peptide covers a terminal guanine base tetrad (G-tetrad), and clamps the G-quadruplex using three-anchor-point electrostatic interactions between three positively charged amino acids and negatively charged phosphate groups. This binding mode is strikingly similar to that of most ligands selected for specific G-quadruplex targeting. Binding to an exposed G-tetrad represents a simple and efficient way to specifically target G-quadruplex structures.
2n2d DNA NMR Structure of DNA G-quadruplex adopted by ALS and FTD related GGGGCC repeat with G21 to Br-G21 substitution; 3Dmol view (2015) "Solution structure of a DNA quadruplex containing ALS and FTD related GGGGCC repeat stabilized by 8-bromodeoxyguanosine substitution." Nucleic Acids Res., 43, 8590-8600. pubmed Brcic, J., Plavec, J. A prolonged expansion of GGGGCC repeat within non-coding region of C9orf72 gene has been identified as the most common cause of familial amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), which are devastating neurodegenerative disorders. Formation of unusual secondary structures within expanded GGGGCC repeat, including DNA and RNA G-quadruplexes and R-loops was proposed to drive ALS and FTD pathogenesis. Initial NMR investigation on DNA oligonucleotides with four repeat units as the shortest model with the ability to form an unimolecular G-quadruplex indicated their folding into multiple G-quadruplex structures in the presence of K(+) ions. Single dG to 8Br-dG substitution at position 21 in oligonucleotide d[(G4C2)3G4] and careful optimization of folding conditions enabled formation of mostly a single G-quadruplex species, which enabled determination of a high-resolution structure with NMR. G-quadruplex structure adopted by d[(G4C2)3GG(Br)GG] is composed of four G-quartets, which are connected by three edgewise C-C loops. All four strands adopt antiparallel orientation to one another and have alternating syn-anti progression of glycosidic conformation of guanine residues. One of the cytosines in every loop is stacked upon the G-quartet contributing to a very compact and stable structure.
2n3m DNA NMR G-quadruplex structure of an anti-proliferative DNA sequence; 3Dmol view "G-quadruplex structure of an anti-proliferative DNA sequence." To be Published Do, N.Q., Chung, W.J., Truong, T.H.A., Heddi, B., Phan, A.T.
2n4y DNA NMR Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome; 3Dmol view (2016) "Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome." Nucleic Acids Res., 44, 6442-6451. pubmed De Nicola, B., Lech, C.J., Heddi, B., Regmi, S., Frasson, I., Perrone, R., Richter, S.N., Phan, A.T. The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics.
2n60 DNA NMR G-quadruplexes with (4n-1) guanines in the G-tetrad core: formation of a G-triad water complex and implication for small-molecule binding; 3Dmol view (2016) "G-quadruplexes with (4n - 1) guanines in the G-tetrad core: formation of a G-triadwater complex and implication for small-molecule binding." Nucleic Acids Res., 44, 910-916. pubmed Heddi, B., Martin-Pintado, N., Serimbetov, Z., Kari, T.M., Phan, A.T. G-quadruplexes are non-canonical structures of nucleic acids, in which guanine bases form planar G-tetrads (G·G·G·G) that stack on each other in the core of the structure. G-quadruplexes generally contain multiple times of four (4n) guanines in the core. Here, we study the structure of G-quadruplexes with only (4n - 1) guanines in the core. The solution structure of a DNA sequence containing 11 guanines showed the formation of a parallel G-quadruplex involving two G-tetrads and one G-triad with a vacant site. Molecular dynamics simulation established the formation of a stable G-triad·water complex, where water molecules mimic the position of the missing guanine in the vacant site. The concept of forming G-quadruplexes with missing guanines in the core broadens the current definition of G-quadruplex-forming sequences. The potential ability of such structures to bind different metabolites, including guanine, guanosine and GTP, in the vacant site, could have biological implications in regulatory functions. Formation of this unique binding pocket in the G-triad could be used as a specific target in drug design.
2n6c DNA NMR Solution structure for quercetin complexed with c-myc G-quadruplex DNA; 3Dmol view "Solution structure for quercetin complexed with c-myc G-quadruplex DNA." To be Published Kumar, A., Tawani, A.
2n9q DNA NMR Photoswitchable G-quadruplex; 3Dmol view (2016) "Photoresponsive Formation of an Intermolecular Minimal G-Quadruplex Motif." Angew.Chem.Int.Ed.Engl., 55, 2738-2742. pubmed Thevarpadam, J., Bessi, I., Binas, O., Goncalves, D.P., Slavov, C., Jonker, H.R., Richter, C., Wachtveitl, J., Schwalbe, H., Heckel, A. The ability of three different bifunctional azobenzene linkers to enable the photoreversible formation of a defined intermolecular two-tetrad G-quadruplex upon UV/Vis irradiation was investigated. Circular dichroism and NMR spectroscopic data showed the formation of G-quadruplexes with K(+)  ions at room temperature in all three cases with the corresponding azobenzene linker in an E conformation. However, only the para-para-substituted azobenzene derivative enables photoswitching between a nonpolymorphic, stacked, tetramolecular G-quadruplex and an unstructured state after E-Z isomerization.
2o3m DNA NMR Monomeric G-DNA tetraplex from human C-kit promoter; 3Dmol view (2007) "Structure of an unprecedented G-quadruplex scaffold in the human c-kit promoter." J.Am.Chem.Soc., 129, 4386-4392. pubmed Phan, A.T., Kuryavyi, V.V., Burge, S., Neidle, S., Patel, D.J. The c-kit oncogene is an important target in the treatment of gastrointestinal tumors. A potential approach to inhibition of the expression of this gene involves selective stabilization of G-quadruplex structures that may be induced to form in the c-kit promoter region. Here we report on the structure of an unprecedented intramolecular G-quadruplex formed by a G-rich sequence in the c-kit promoter in K+ solution. The structure represents a new folding topology with several unique features. Most strikingly, an isolated guanine is involved in G-tetrad core formation, despite the presence of four three-guanine tracts. There are four loops: two single-residue double-chain-reversal loops, a two-residue loop, and a five-residue stem-loop, which contain base-pairing alignments. This unique structural scaffold provides a highly specific platform for the future design of ligands specifically targeted to the promoter DNA of c-kit.
2o4f DNA X-ray (1.5 Å) Structure of a parallel-stranded guanine tetraplex crystallised with monovalent ions; 3Dmol view (2007) "Structure of a d(TGGGGT) quadruplex crystallized in the presence of Li+ ions." Acta Crystallogr.,Sect.D, 63, 682-688. pubmed Creze, C., Rinaldi, B., Haser, R., Bouvet, P., Gouet, P. A parallel 5'-d(TGGGGT)-3' quadruplex was formed in Na(+) solution and crystallized using lithium sulfate as the main precipitating agent. The X-ray structure was determined to 1.5 A resolution in space group P2(1) by molecular replacement. The asymmetric unit consists of a characteristic motif of two quadruplexes stacked at their 5' ends. All nucleotides are clearly defined in the density and could be positioned. A single bound Li(+) ion is observed at the surface of the column formed by the two joined molecules. Thus, this small alkali metal ion appears to be unsuitable as a replacement for the Na(+) ion in the central channel of G-quartets, unlike K(+) or Tl(+) ions. A well conserved constellation of water molecules is observed in the grooves of the dimeric structure.
2rqj RNA NMR Quadruplex structure of an RNA aptamer against bovine prion protein; 3Dmol view (2009) "Unique quadruplex structure and interaction of an RNA aptamer against bovine prion protein." Nucleic Acids Res., 37, 6249-6258. pubmed Mashima, T., Matsugami, A., Nishikawa, F., Nishikawa, S., Katahira, M. RNA aptamers against bovine prion protein (bPrP) were obtained, most of the obtained aptamers being found to contain the r(GGAGGAGGAGGA) (R12) sequence. Then, it was revealed that R12 binds to both bPrP and its beta-isoform with high affinity. Here, we present the structure of R12. This is the first report on the structure of an RNA aptamer against prion protein. R12 forms an intramolecular parallel quadruplex. The quadruplex contains G:G:G:G tetrad and G(:A):G:G(:A):G hexad planes. Two quadruplexes form a dimer through intermolecular hexad-hexad stacking. Two lysine clusters of bPrP have been identified as binding sites for R12. The electrostatic interaction between the uniquely arranged phosphate groups of R12 and the lysine clusters is suggested to be responsible for the affinity of R12 to bPrP. The stacking interaction between the G:G:G:G tetrad planes and tryptophan residues may also contribute to the affinity. One R12 dimer molecule is supposed to simultaneously bind the two lysine clusters of one bPrP molecule, resulting in even higher affinity. The atomic coordinates of R12 would be useful for the development of R12 as a therapeutic agent against prion diseases and Alzheimer's disease.
2rsk membrane protein-RNA NMR RNA aptamer against prion protein in complex with the partial binding peptide; 3Dmol view (2013) "Anti-prion activity of an RNA aptamer and its structural basis." Nucleic Acids Res., 41, 1355-1362. pubmed Mashima, T., Nishikawa, F., Kamatari, Y.O., Fujiwara, H., Saimura, M., Nagata, T., Kodaki, T., Nishikawa, S., Kuwata, K., Katahira, M. Prion proteins (PrPs) cause prion diseases, such as bovine spongiform encephalopathy. The conversion of a normal cellular form (PrP(C)) of PrP into an abnormal form (PrP(Sc)) is thought to be associated with the pathogenesis. An RNA aptamer that tightly binds to and stabilizes PrP(C) is expected to block this conversion and to thereby prevent prion diseases. Here, we show that an RNA aptamer comprising only 12 residues, r(GGAGGAGGAGGA) (R12), reduces the PrP(Sc) level in mouse neuronal cells persistently infected with the transmissible spongiform encephalopathy agent. Nuclear magnetic resonance analysis revealed that R12, folded into a unique quadruplex structure, forms a dimer and that each monomer simultaneously binds to two portions of the N-terminal half of PrP(C), resulting in tight binding. Electrostatic and stacking interactions contribute to the affinity of each portion. Our results demonstrate the therapeutic potential of an RNA aptamer as to prion diseases.
2ru7 membrane protein-RNA NMR Refined structure of RNA aptamer in complex with the partial binding peptide of prion protein; 3Dmol view (2014) "Binding of an RNA aptamer and a partial peptide of a prion protein: crucial importance of water entropy in molecular recognition." Nucleic Acids Res. pubmed Hayashi, T., Oshima, H., Mashima, T., Nagata, T., Katahira, M., Kinoshita, M. It is a central issue to elucidate the new type of molecular recognition accompanied by a global structural change of a molecule upon binding to its targets. Here we investigate the driving force for the binding of R12 (a ribonucleic acid aptamer) and P16 (a partial peptide of a prion protein) during which P16 exhibits the global structural change. We calculate changes in thermodynamic quantities upon the R12-P16 binding using a statistical-mechanical approach combined with molecular models for water which is currently best suited to studies on hydration of biomolecules. The binding is driven by a water-entropy gain originating primarily from an increase in the total volume available to the translational displacement of water molecules in the system. The energy decrease due to the gain of R12-P16 attractive (van der Waals and electrostatic) interactions is almost canceled out by the energy increase related to the loss of R12-water and P16-water attractive interactions. We can explain the general experimental result that stacking of flat moieties, hydrogen bonding and molecular-shape and electrostatic complementarities are frequently observed in the complexes. It is argued that the water-entropy gain is largely influenced by the geometric characteristics (overall shapes, sizes and detailed polyatomic structures) of the biomolecules.
2wcn DNA NMR Solution structure of an LNA-modified quadruplex; 3Dmol view (2009) "Solution Structure of a Locked Nucleic Acid Modified Quadruplex: Introducing the V4 Folding Topology." Angew.Chem.Int.Ed.Engl., 48, 3099-. pubmed Nielsen, J.T., Arar, K., Petersen, M. Sharp curves: The structure of a locked nucleic acid modified telomeric sequence from Oxytricha nova displays a remarkable folding topology, distinct from the native O. nova quadruplex. Each guanine stretch folds back in a V-shaped turn that puts the first and fourth guanines in the same tetrad, looping over a tetrad with a sharp turn in the DNA backbone, showing how subtle interplay between sequence and conformation defines the folding topology.
352d DNA X-ray (0.95 Å) THE CRYSTAL STRUCTURE OF A PARALLEL-STRANDED PARALLEL-STRANDED GUANINE TETRAPLEX AT 0.95 ANGSTROM RESOLUTION; 3Dmol view (1997) "The crystal structure of a parallel-stranded guanine tetraplex at 0.95 A resolution." J.Mol.Biol., 273, 171-182. pubmed Phillips, K., Dauter, Z., Murchie, A.I., Lilley, D.M., Luisi, B. In both DNA and RNA, stretches of guanine bases can form stable four-stranded helices in the presence of sodium or potassium ions. Sequences with a propensity to form guanine tetraplexes have been found in chromosomal telomers, immunoglobulin switch regions, and recombination sites. We report the crystal structure at 0.95 A resolution of a parallel-stranded tetraplex formed by the hexanucleotide d(TG4T) in the presence of sodium ions. The four strands form a right-handed helix that is stabilized by hydrogen-bonding tetrads of co-planar guanine bases. Well-resolved sodium ions are found between and, at defined points, within tetrad planes and are coordinated with the guanine O6 groups. Nine calcium ions have been identified, each with a well-defined hepta-coordinate hydration shell. Hydrogen-bonding water patterns are observed within the tetraplex's helical grooves and clustered about the phosphate groups. Water molecules in the groove may form a hydrogen bond with the O4', and may affect the stacking behavior of guanine. Two distinct stacking arrangements are noted for the guanine tetrads. The thymine bases do not contribute to the four-stranded conformation, but instead stack to stabilize the crystal lattice. We present evidence that the sugar conformation is strained and propose that this originates from forces that optimize guanine base stacking. Discrete conformational disorder is observed at several places in the phosphodiester backbone, which results from a simple crankshaft rotation that requires no net change in the sugar conformation.
3cco DNA X-ray (2.2 Å) Structural adaptation and conservation in quadruplex-drug recognition; 3Dmol view (2008) "Topology conservation and loop flexibility in quadruplex-drug recognition: crystal structures of inter- and intramolecular telomeric DNA quadruplex-drug complexes." J.Mol.Biol., 381, 1145-1156. pubmed Parkinson, G.N., Cuenca, F., Neidle, S. Knowledge of the biologically relevant topology is critical for the design of drugs targeting quadruplex nucleic acids. We report here crystal structures of a G-quadruplex-selective ligand complexed with two human telomeric DNA quadruplexes. The intramolecular quadruplex sequence d[TAGGG(TTAGGG)(3)] and the bimolecular quadruplex sequence d(TAGGGTTAGGGT) were co-crystallized with a tetra-substituted naphthalene diimide quadruplex-binding ligand. The structures were solved and refined to 2.10- and 2.20-A resolution, respectively, revealing that the quadruplex topology in both structures is unchanged by the addition of the ligands, retaining a parallel-stranded arrangement with external double-chain-reversal propeller loops. The parallel topology results in accessible external 5' and 3' planar G-tetrad surfaces for ligand stacking. This also enables significant ligand-induced conformational changes in several TTA propeller loops to take place such that the loops themselves are able to accommodate bound drug molecules without affecting the parallel quadruplex topology, by stacking on the external TTA connecting loop nucleotides. Ligands are bound into the external TTA loop nucleotides and stack onto G-tetrad surfaces. These crystal structures provide a framework for further ligand development of the naphthalene diimide series to enhance selectivity and affinity.
3cdm DNA X-ray (2.1 Å) Structural adaptation and conservation in quadruplex-drug recognition; 3Dmol view (2008) "Topology conservation and loop flexibility in quadruplex-drug recognition: crystal structures of inter- and intramolecular telomeric DNA quadruplex-drug complexes." J.Mol.Biol., 381, 1145-1156. pubmed Parkinson, G.N., Cuenca, F., Neidle, S. Knowledge of the biologically relevant topology is critical for the design of drugs targeting quadruplex nucleic acids. We report here crystal structures of a G-quadruplex-selective ligand complexed with two human telomeric DNA quadruplexes. The intramolecular quadruplex sequence d[TAGGG(TTAGGG)(3)] and the bimolecular quadruplex sequence d(TAGGGTTAGGGT) were co-crystallized with a tetra-substituted naphthalene diimide quadruplex-binding ligand. The structures were solved and refined to 2.10- and 2.20-A resolution, respectively, revealing that the quadruplex topology in both structures is unchanged by the addition of the ligands, retaining a parallel-stranded arrangement with external double-chain-reversal propeller loops. The parallel topology results in accessible external 5' and 3' planar G-tetrad surfaces for ligand stacking. This also enables significant ligand-induced conformational changes in several TTA propeller loops to take place such that the loops themselves are able to accommodate bound drug molecules without affecting the parallel quadruplex topology, by stacking on the external TTA connecting loop nucleotides. Ligands are bound into the external TTA loop nucleotides and stack onto G-tetrad surfaces. These crystal structures provide a framework for further ligand development of the naphthalene diimide series to enhance selectivity and affinity.
3ce5 DNA X-ray (2.5 Å) A bimolecular parallel-stranded human telomeric quadruplex in complex with a 3,6,9-trisubstituted acridine molecule BRACO19; 3Dmol view (2008) "Structural basis of DNA quadruplex recognition by an acridine drug." J.Am.Chem.Soc., 130, 6722-6724. pubmed Campbell, N.H., Parkinson, G.N., Reszka, A.P., Neidle, S. The crystal structure of a complex between the bimolecular human telomeric quadruplex d(TAGGGTTAGGGT)2 and the experimental anticancer drug BRACO-19, has been determined, to 2.5 A resolution. The binding site for the BRACO-19 molecule is at the interface of two parallel-folded quadruplexes, sandwiched between a G-tetrad surface and a TATA tetrad, and held in the site by networks of water molecules. The structure rationalizes the existing structure-activity data and provides a starting-point for the structure-based design of quadruplex-binding ligands
3em2 DNA X-ray (2.3 Å) A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine BSU-6038; 3Dmol view (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. pubmed Campbell, N.H., Patel, M., Tofa, A.B., Ghosh, R., Parkinson, G.N., Neidle, S. A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.
3eqw DNA X-ray (2.2 Å) A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine BSU-6042 in small unit cell; 3Dmol view (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. pubmed Campbell, N.H., Patel, M., Tofa, A.B., Ghosh, R., Parkinson, G.N., Neidle, S. A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.
3eru DNA X-ray (2.0 Å) A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine BSU-6045; 3Dmol view (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. pubmed Campbell, N.H., Patel, M., Tofa, A.B., Ghosh, R., Parkinson, G.N., Neidle, S. A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.
3es0 DNA X-ray (2.2 Å) A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine BSU-6048; 3Dmol view (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. pubmed Campbell, N.H., Patel, M., Tofa, A.B., Ghosh, R., Parkinson, G.N., Neidle, S. A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.
3et8 DNA X-ray (2.45 Å) A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine BSU-6054; 3Dmol view (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. pubmed Campbell, N.H., Patel, M., Tofa, A.B., Ghosh, R., Parkinson, G.N., Neidle, S. A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.
3eui DNA X-ray (2.2 Å) A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine BSU-6042 in a large unit cell; 3Dmol view (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. pubmed Campbell, N.H., Patel, M., Tofa, A.B., Ghosh, R., Parkinson, G.N., Neidle, S. A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.
3eum DNA X-ray (1.78 Å) A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine BSU-6066; 3Dmol view (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. pubmed Campbell, N.H., Patel, M., Tofa, A.B., Ghosh, R., Parkinson, G.N., Neidle, S. A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.
3ibk RNA X-ray (2.2 Å) Crystal structure of a telomeric RNA quadruplex; 3Dmol view (2010) "A crystallographic and modelling study of a human telomeric RNA (TERRA) quadruplex." Nucleic Acids Res., 38, 5569-5580. pubmed Collie, G.W., Haider, S.M., Neidle, S., Parkinson, G.N. DNA telomeric repeats in mammalian cells are transcribed to guanine-rich RNA sequences, which adopt parallel-stranded G-quadruplexes with a propeller-like fold. The successful crystallization and structure analysis of a bimolecular human telomeric RNA G-quadruplex, folded into the same crystalline environment as an equivalent DNA oligonucleotide sequence, is reported here. The structural basis of the increased stability of RNA telomeric quadruplexes over DNA ones and their preference for parallel topologies is described here. Our findings suggest that the 2'-OH hydroxyl groups in the RNA quadruplex play a significant role in redefining hydration structure in the grooves and the hydrogen bonding networks. The preference for specific nucleotides to populate the C3'-endo sugar pucker domain is accommodated by alterations in the phosphate backbone, which leads to greater stability through enhanced hydrogen bonding networks. Molecular dynamics simulations on the DNA and RNA quadruplexes are consistent with these findings. The computations, based on the native crystal structure, provide an explanation for RNA G-quadruplex ligand binding selectivity for a group of naphthalene diimide ligands as compared to the DNA G-quadruplex.
3mij RNA X-ray (2.6 Å) Crystal structure of a telomeric RNA G-quadruplex complexed with an acridine-based ligand.; 3Dmol view (2011) "Structural basis of telomeric RNA quadruplex-acridine ligand recognition." J.Am.Chem.Soc., 133, 2721-2728. pubmed Collie, G.W., Sparapani, S., Parkinson, G.N., Neidle, S. Human telomeric DNA is now known to be transcribed into noncoding RNA sequences, termed TERRA. These sequences, which are believed to play roles in the regulation of telomere function, can form higher-order quadruplex structures and may themselves be the target of therapeutic intervention. The crystal structure of a TERRA quadruplex-acridine small-molecule complex at a resolution of 2.60 Å, is reported here and contrasts remarkably with the structure of the analogous DNA quadruplex complex. The bimolecular RNA complex has a parallel-stranded topology with propeller-like UUA loops. These loops are held in particular conformations by multiple hydrogen bonds involving the O2' hydroxyl groups of the ribonucleotide sugars and play an active role in binding the acridine molecules to the RNA quadruplex. By contrast, the analogous DNA quadruplex complex has simpler 1:1 acridine binding, with no loop involvement. There are significant loop conformational changes in the RNA quadruplex compared to the native TERRA quadruplex (Collie, G. W.; Haider, S. M.; Neidle, S.; Parkinson, G. N. Nucleic Acids Res. 2010, 38, 5569 - 5580), which have implications for the future design of small molecules targeting TERRA quadruplexes, and RNA quadruplexes more generally.
3nyp DNA X-ray (1.18 Å) A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine ligand containing bis-3-fluoropyrrolidine end side chains; 3Dmol view (2011) "Fluorine in medicinal chemistry: beta-fluorination of peripheral pyrrolidines attached to acridine ligands affects their interactions with G-quadruplex DNA." Org.Biomol.Chem., 9, 1328-1331. pubmed Campbell, N.H., Smith, D.L., Reszka, A.P., Neidle, S., O'Hagan, D. Comparative X-ray structure studies reveal that C-F bond incorporation into the peripheral pyrrolidine moieties of the G-quadruplex DNA binding ligand BSU6039 leads to a distinct pyrrolidine ring conformation, relative to the non-fluorinated analogue, and with a different binding mode involving reversal of the pyrrolidinium N(+)-H orientation.
3nz7 DNA X-ray (1.1 Å) A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine ligand containing bis-3-fluoropyrrolidine end side chains; 3Dmol view (2011) "Fluorine in medicinal chemistry: beta-fluorination of peripheral pyrrolidines attached to acridine ligands affects their interactions with G-quadruplex DNA." Org.Biomol.Chem., 9, 1328-1331. pubmed Campbell, N.H., Smith, D.L., Reszka, A.P., Neidle, S., O'Hagan, D. Comparative X-ray structure studies reveal that C-F bond incorporation into the peripheral pyrrolidine moieties of the G-quadruplex DNA binding ligand BSU6039 leads to a distinct pyrrolidine ring conformation, relative to the non-fluorinated analogue, and with a different binding mode involving reversal of the pyrrolidinium N(+)-H orientation.
3qcr DNA X-ray (3.2 Å) Incomplete structural model of a human telomeric DNA quadruplex-acridine complex.; 3Dmol view (2011) "Structural basis of telomeric RNA quadruplex-acridine ligand recognition." J.Am.Chem.Soc., 133, 2721-2728. pubmed Collie, G.W., Sparapani, S., Parkinson, G.N., Neidle, S. Human telomeric DNA is now known to be transcribed into noncoding RNA sequences, termed TERRA. These sequences, which are believed to play roles in the regulation of telomere function, can form higher-order quadruplex structures and may themselves be the target of therapeutic intervention. The crystal structure of a TERRA quadruplex-acridine small-molecule complex at a resolution of 2.60 Å, is reported here and contrasts remarkably with the structure of the analogous DNA quadruplex complex. The bimolecular RNA complex has a parallel-stranded topology with propeller-like UUA loops. These loops are held in particular conformations by multiple hydrogen bonds involving the O2' hydroxyl groups of the ribonucleotide sugars and play an active role in binding the acridine molecules to the RNA quadruplex. By contrast, the analogous DNA quadruplex complex has simpler 1:1 acridine binding, with no loop involvement. There are significant loop conformational changes in the RNA quadruplex compared to the native TERRA quadruplex (Collie, G. W.; Haider, S. M.; Neidle, S.; Parkinson, G. N. Nucleic Acids Res. 2010, 38, 5569 - 5580), which have implications for the future design of small molecules targeting TERRA quadruplexes, and RNA quadruplexes more generally.
3qlp hydrolase-hydrolase inhibitor-DNA X-ray (2.14 Å) X-ray structure of the complex between human alpha thrombin and a modified thrombin binding aptamer (mTBA); 3Dmol view (2011) "Thrombin-aptamer recognition: a revealed ambiguity." Nucleic Acids Res., 39, 7858-7867. pubmed Russo Krauss, I., Merlino, A., Giancola, C., Randazzo, A., Mazzarella, L., Sica, F. Aptamers are structured oligonucleotides that recognize molecular targets and can function as direct protein inhibitors. The best-known example is the thrombin-binding aptamer, TBA, a single-stranded 15-mer DNA that inhibits the activity of thrombin, the key enzyme of coagulation cascade. TBA folds as a G-quadruplex structure, as proved by its NMR structure. The X-ray structure of the complex between TBA and human α-thrombin was solved at 2.9-Å resolution, but did not provide details of the aptamer conformation and the interactions with the protein molecule. TBA is rapidly processed by nucleases. To improve the properties of TBA, a number of modified analogs have been produced. In particular, a modified TBA containing a 5'-5' polarity inversion site, mTBA, has higher stability and higher affinity toward thrombin with respect to TBA, although it has a lower inhibitory activity. We present the crystal structure of the thrombin-mTBA complex at 2.15-Å resolution; the resulting model eventually provides a clear picture of thrombin-aptamers interaction, and also highlights the structural bases of the different properties of TBA and mTBA. Our findings open the way for a rational design of modified aptamers with improved potency as anticoagulant drugs.
3qsc DNA X-ray (2.4 Å) The first crystal structure of a human telomeric G-quadruplex DNA bound to a metal-containing ligand (a copper complex); 3Dmol view (2012) "Molecular basis of structure-activity relationships between salphen metal complexes and human telomeric DNA quadruplexes." J.Med.Chem., 55, 209-222. pubmed Campbell, N.H., Karim, N.H., Parkinson, G.N., Gunaratnam, M., Petrucci, V., Todd, A.K., Vilar, R., Neidle, S. The first X-ray crystal structures of nickel(II) and copper(II) salphen metal complexes bound to a quadruplex DNA are presented. Two structures have been determined and show that these salphen-metal complexes bind to human telomeric quadruplexes by end-stacking, with the metal in each case almost in line with the potassium ion channel. Quadruplex and duplex DNA binding is presented for these two and other related salphen complexes, all with side-chains terminating in pyrrolidino end-groups and differing patterns of substitution on the salphen core. The crystal structures are able to provide rationalizations for the structure-activity data, and in particular for the superior quadruplex-binding of the nickel complexes compared to that of the copper-containing ones. The complexes show significant antiproliferative activity for the compounds in a panel of cancer cell lines. They also show telomerase inhibitory activity in the telomerase TRAP-LIG assay.
3qsf DNA X-ray (2.4 Å) The first crystal structure of a human telomeric G-quadruplex DNA bound to a metal-containing ligand (a nickel complex); 3Dmol view (2012) "Molecular basis of structure-activity relationships between salphen metal complexes and human telomeric DNA quadruplexes." J.Med.Chem., 55, 209-222. pubmed Campbell, N.H., Karim, N.H., Parkinson, G.N., Gunaratnam, M., Petrucci, V., Todd, A.K., Vilar, R., Neidle, S. The first X-ray crystal structures of nickel(II) and copper(II) salphen metal complexes bound to a quadruplex DNA are presented. Two structures have been determined and show that these salphen-metal complexes bind to human telomeric quadruplexes by end-stacking, with the metal in each case almost in line with the potassium ion channel. Quadruplex and duplex DNA binding is presented for these two and other related salphen complexes, all with side-chains terminating in pyrrolidino end-groups and differing patterns of substitution on the salphen core. The crystal structures are able to provide rationalizations for the structure-activity data, and in particular for the superior quadruplex-binding of the nickel complexes compared to that of the copper-containing ones. The complexes show significant antiproliferative activity for the compounds in a panel of cancer cell lines. They also show telomerase inhibitory activity in the telomerase TRAP-LIG assay.
3qxr DNA X-ray (1.62 Å) Crystal structure of the brominated CKIT-1 proto-oncogene promoter quadruplex DNA; 3Dmol view (2012) "Crystal structure of a c-kit promoter quadruplex reveals the structural role of metal ions and water molecules in maintaining loop conformation." Nucleic Acids Res., 40, 4691-4700. pubmed Wei, D., Parkinson, G.N., Reszka, A.P., Neidle, S. We report here the 1.62 Å crystal structure of an intramolecular quadruplex DNA formed from a sequence in the promoter region of the c-kit gene. This is the first reported crystal structure of a promoter quadruplex and the first observation of localized magnesium ions in a quadruplex structure. The structure reveals that potassium and magnesium ions have an unexpected yet significant structural role in stabilizing particular quadruplex loops and grooves that is distinct from but in addition to the role of potassium ions in the ion channel at the centre of all quadruplex structures. The analysis also shows how ions cluster together with structured water molecules to stabilize the quadruplex arrangement. This particular quadruplex has been previously studied by NMR methods, and the present X-ray structure is in accord with the earlier topology assignment. However, as well as the observations of potassium and magnesium ions, the crystal structure has revealed a highly significant difference in the dimensions of the large cleft in the structure, which is a plausible target for small molecules. This difference can be understood by the stabilizing role of structured water networks.
3r6r DNA-antibiotic X-ray (2.4 Å) Structure of the complex of an intramolecular human telomeric DNA with Berberine formed in K+ solution; 3Dmol view (2013) "The crystal structure of human telomeric DNA complexed with berberine: an interesting case of stacked ligand to G-tetrad ratio higher than 1:1." Nucleic Acids Res., 41, 632-638. pubmed Bazzicalupi, C., Ferraroni, M., Bilia, A.R., Scheggi, F., Gratteri, P. The first crystal structure of human telomeric DNA in complex with the natural alkaloid berberine, produced by different plant families and used in folk medicine for millennia, was solved by X-ray diffraction method. The G-quadruplex unit features all-parallel strands. The overall folding assumed by DNA is the same found in previously reported crystal structures. Similarly to previously reported structures the ligand molecules were found to be stacked onto the external 5' and 3'-end G-tetrads. However, the present crystal structure highlighted for the first time, the presence of two berberine molecules in the two binding sites, directly interacting with each tetrad. As a consequence, our structural data point out a 2:1 ligand to G-tetrad molar ratio, which has never been reported before in a telomeric intramolecular quadruplex structure.
3sc8 DNA X-ray (2.3 Å) Crystal structure of an intramolecular human telomeric DNA G-quadruplex bound by the naphthalene diimide BMSG-SH-3; 3Dmol view (2012) "Structural basis for telomeric g-quadruplex targeting by naphthalene diimide ligands." J.Am.Chem.Soc., 134, 2723-2731. pubmed Collie, G.W., Promontorio, R., Hampel, S.M., Micco, M., Neidle, S., Parkinson, G.N. The folding of the single-stranded 3' end of the human telomere into G-quadruplex arrangements inhibits the overhang from hybridizing with the RNA template of telomerase and halts telomere maintenance in cancer cells. The ability to thermally stabilize human telomeric DNA as a four-stranded G-quadruplex structure by developing selective small molecule compounds is a therapeutic path to regulating telomerase activity and thereby selectively inhibit cancer cell growth. The development of compounds with the necessary selectivity and affinity to target parallel-stranded G-quadruplex structures has proved particularly challenging to date, relying heavily upon limited structural data. We report here on a structure-based approach to the design of quadruplex-binding ligands to enhance affinity and selectivity for human telomeric DNA. Crystal structures have been determined of complexes between a 22-mer intramolecular human telomeric quadruplex and two potent tetra-substituted naphthalene diimide compounds, functionalized with positively charged N-methyl-piperazine side-chains. These compounds promote parallel-stranded quadruplex topology, binding exclusively to the 3' surface of each quadruplex. There are significant differences between the complexes in terms of ligand mobility and in the interactions with quadruplex grooves. One of the two ligands is markedly less mobile in the crystal complex and is more quadruplex-stabilizing, forming multiple electrostatic/hydrogen bond contacts with quadruplex phosphate groups. The data presented here provides a structural rationale for the biophysical (effects on quadruplex thermal stabilization) and biological data (inhibition of proliferation in cancer cell lines and evidence of in vivo antitumor activity) on compounds in this series and, thus, for the concept of telomere targeting with DNA quadruplex-binding small molecules.
3t5e DNA X-ray (2.1 Å) Crystal structure of an intramolecular human telomeric DNA G-quadruplex bound by the naphthalene diimide BMSG-SH-4; 3Dmol view (2012) "Structural basis for telomeric g-quadruplex targeting by naphthalene diimide ligands." J.Am.Chem.Soc., 134, 2723-2731. pubmed Collie, G.W., Promontorio, R., Hampel, S.M., Micco, M., Neidle, S., Parkinson, G.N. The folding of the single-stranded 3' end of the human telomere into G-quadruplex arrangements inhibits the overhang from hybridizing with the RNA template of telomerase and halts telomere maintenance in cancer cells. The ability to thermally stabilize human telomeric DNA as a four-stranded G-quadruplex structure by developing selective small molecule compounds is a therapeutic path to regulating telomerase activity and thereby selectively inhibit cancer cell growth. The development of compounds with the necessary selectivity and affinity to target parallel-stranded G-quadruplex structures has proved particularly challenging to date, relying heavily upon limited structural data. We report here on a structure-based approach to the design of quadruplex-binding ligands to enhance affinity and selectivity for human telomeric DNA. Crystal structures have been determined of complexes between a 22-mer intramolecular human telomeric quadruplex and two potent tetra-substituted naphthalene diimide compounds, functionalized with positively charged N-methyl-piperazine side-chains. These compounds promote parallel-stranded quadruplex topology, binding exclusively to the 3' surface of each quadruplex. There are significant differences between the complexes in terms of ligand mobility and in the interactions with quadruplex grooves. One of the two ligands is markedly less mobile in the crystal complex and is more quadruplex-stabilizing, forming multiple electrostatic/hydrogen bond contacts with quadruplex phosphate groups. The data presented here provides a structural rationale for the biophysical (effects on quadruplex thermal stabilization) and biological data (inhibition of proliferation in cancer cell lines and evidence of in vivo antitumor activity) on compounds in this series and, thus, for the concept of telomere targeting with DNA quadruplex-binding small molecules.
3tvb DNA-antibiotic X-ray (1.08 Å) A Highly Symmetric DNA G-4 Quadruplex/drug Complex; 3Dmol view (2012) "The high-resolution crystal structure of a parallel intermolecular DNA G-4 quadruplex/drug complex employing syn glycosyl linkages." Nucleic Acids Res., 40, 5731-5738. pubmed Clark, G.R., Pytel, P.D., Squire, C.J. We have determined the X-ray structure of the complex between the DNA quadruplex d(5'-GGGG-3')(4) and daunomycin, as a potential model for studying drug-telomere interactions. The structure was solved at 1.08 Å by direct methods in space group I4. The asymmetric unit comprises a linear arrangement of one d(GGGG) strand, four daunomycin molecules, a second d(GGGG) strand facing in the opposite direction to the first, and Na and Mg cations. The crystallographic 4-fold axis generates the biological unit, which is a 12-layered structure comprising two sets of four guanine layers, with four layers each of four daunomycins stacked between the 5' faces of the two quadruplexes. The daunomycin layers fall into two groups which are novel in their mode of self assembly. The only contacts between daunomycin molecules within any one of these layers are van der Waals interactions, however there is substantial π-π stacking between successive daunomycin layers and also with adjacent guanine layers. The structure differs significantly from all other parallel d(TGGGGT)(4) quadruplexes in that the 5' guanine adopts the unusual syn glycosyl linkage, refuting the widespread belief that such conformations should all be anti. In contrast to the related d(TGGGGT)/daunomycin complex, there are no ligand-quadruplex groove insertion interactions.
3uyh DNA X-ray (1.95 Å) Crystal structure of an intramolecular human telomeric DNA G-quadruplex bound by the naphthalene diimide compound, MM41; 3Dmol view (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. pubmed Micco, M., Collie, G.W., Dale, A.G., Ohnmacht, S.A., Pazitna, I., Gunaratnam, M., Reszka, A.P., Neidle, S. Tetra-substituted naphthalene diimide (ND) derivatives with positively charged termini are potent stabilizers of human telomeric and gene promoter DNA quadruplexes and inhibit the growth of human cancer cells in vitro and in vivo. The present study reports the enhancement of the pharmacological properties of earlier ND compounds using structure-based design. Crystal structures of three complexes with human telomeric intramolecular quadruplexes demonstrate that two of the four strongly basic N-methyl-piperazine groups can be replaced by less basic morpholine groups with no loss of intermolecular interactions in the grooves of the quadruplex. The new compounds retain high affinity to human telomeric quadruplex DNA but are 10-fold more potent against the MIA PaCa-2 pancreatic cancer cell line, with IC50 values of ~10 nM. The lead compound induces cellular senescence but does not inhibit telomerase activity at the nanomolar dosage levels required for inhibition of cellular proliferation. Gene array qPCR analysis of MIA PaCa-2 cells treated with the lead compound revealed significant dose-dependent modulation of a distinct subset of genes, including strong induction of DNA damage responsive genes CDKN1A, DDIT3, GADD45A/G, and PPM1D, and repression of genes involved in telomere maintenance, including hPOT1 and PARP1.
4da3 DNA X-ray (2.4 Å) Crystal structure of an intramolecular human telomeric DNA G-quadruplex 21-mer bound by the naphthalene diimide compound MM41.; 3Dmol view (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. pubmed Micco, M., Collie, G.W., Dale, A.G., Ohnmacht, S.A., Pazitna, I., Gunaratnam, M., Reszka, A.P., Neidle, S. Tetra-substituted naphthalene diimide (ND) derivatives with positively charged termini are potent stabilizers of human telomeric and gene promoter DNA quadruplexes and inhibit the growth of human cancer cells in vitro and in vivo. The present study reports the enhancement of the pharmacological properties of earlier ND compounds using structure-based design. Crystal structures of three complexes with human telomeric intramolecular quadruplexes demonstrate that two of the four strongly basic N-methyl-piperazine groups can be replaced by less basic morpholine groups with no loss of intermolecular interactions in the grooves of the quadruplex. The new compounds retain high affinity to human telomeric quadruplex DNA but are 10-fold more potent against the MIA PaCa-2 pancreatic cancer cell line, with IC50 values of ~10 nM. The lead compound induces cellular senescence but does not inhibit telomerase activity at the nanomolar dosage levels required for inhibition of cellular proliferation. Gene array qPCR analysis of MIA PaCa-2 cells treated with the lead compound revealed significant dose-dependent modulation of a distinct subset of genes, including strong induction of DNA damage responsive genes CDKN1A, DDIT3, GADD45A/G, and PPM1D, and repression of genes involved in telomere maintenance, including hPOT1 and PARP1.
4daq DNA X-ray (2.75 Å) Crystal structure of an intramolecular human telomeric DNA G-quadruplex 21-mer bound by the naphthalene diimide compound BMSG-SH-3; 3Dmol view (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. pubmed Micco, M., Collie, G.W., Dale, A.G., Ohnmacht, S.A., Pazitna, I., Gunaratnam, M., Reszka, A.P., Neidle, S. Tetra-substituted naphthalene diimide (ND) derivatives with positively charged termini are potent stabilizers of human telomeric and gene promoter DNA quadruplexes and inhibit the growth of human cancer cells in vitro and in vivo. The present study reports the enhancement of the pharmacological properties of earlier ND compounds using structure-based design. Crystal structures of three complexes with human telomeric intramolecular quadruplexes demonstrate that two of the four strongly basic N-methyl-piperazine groups can be replaced by less basic morpholine groups with no loss of intermolecular interactions in the grooves of the quadruplex. The new compounds retain high affinity to human telomeric quadruplex DNA but are 10-fold more potent against the MIA PaCa-2 pancreatic cancer cell line, with IC50 values of ~10 nM. The lead compound induces cellular senescence but does not inhibit telomerase activity at the nanomolar dosage levels required for inhibition of cellular proliferation. Gene array qPCR analysis of MIA PaCa-2 cells treated with the lead compound revealed significant dose-dependent modulation of a distinct subset of genes, including strong induction of DNA damage responsive genes CDKN1A, DDIT3, GADD45A/G, and PPM1D, and repression of genes involved in telomere maintenance, including hPOT1 and PARP1.
4dih hydrolase-hydrolase inhibitor-DNA X-ray (1.8 Å) X-ray structure of the complex between human alpha thrombin and thrombin binding aptamer in the presence of sodium ions; 3Dmol view (2012) "High-resolution structures of two complexes between thrombin and thrombin-binding aptamer shed light on the role of cations in the aptamer inhibitory activity." Nucleic Acids Res., 40, 8119-8128. pubmed Russo Krauss, I., Merlino, A., Randazzo, A., Novellino, E., Mazzarella, L., Sica, F. The G-quadruplex architecture is a peculiar structure adopted by guanine-rich oligonucleotidic sequences, and, in particular, by several aptamers, including the thrombin-binding aptamer (TBA) that has the highest inhibitory activity against human α-thrombin. A crucial role in determining structure, stability and biological properties of G-quadruplexes is played by ions. In the case of TBA, K(+) ions cause an enhancement of the aptamer clotting inhibitory activity. A detailed picture of the interactions of TBA with the protein and with the ions is still lacking, despite the importance of this aptamer in biomedical field for detection and inhibition of α-thrombin. Here, we fill this gap by presenting a high-resolution crystallographic structural characterization of the thrombin-TBA complex formed in the presence of Na(+) or K(+) and a circular dichroism study of the structural stability of the aptamer both free and complexed with α-thrombin, in the presence of the two ionic species. The results indicate that the different effects exerted by Na(+) and K(+) on the inhibitory activity of TBA are related to a subtle perturbation of a few key interactions at the protein-aptamer interface. The present data, in combination with those previously obtained on the complex between α-thrombin and a modified aptamer, may allow the design of new TBA variants with a pharmacological performance enhancement.
4dii hydrolase-hydrolase inhibitor-DNA X-ray (2.05 Å) X-ray structure of the complex between human alpha thrombin and thrombin binding aptamer in the presence of potassium ions; 3Dmol view (2012) "High-resolution structures of two complexes between thrombin and thrombin-binding aptamer shed light on the role of cations in the aptamer inhibitory activity." Nucleic Acids Res., 40, 8119-8128. pubmed Russo Krauss, I., Merlino, A., Randazzo, A., Novellino, E., Mazzarella, L., Sica, F. The G-quadruplex architecture is a peculiar structure adopted by guanine-rich oligonucleotidic sequences, and, in particular, by several aptamers, including the thrombin-binding aptamer (TBA) that has the highest inhibitory activity against human α-thrombin. A crucial role in determining structure, stability and biological properties of G-quadruplexes is played by ions. In the case of TBA, K(+) ions cause an enhancement of the aptamer clotting inhibitory activity. A detailed picture of the interactions of TBA with the protein and with the ions is still lacking, despite the importance of this aptamer in biomedical field for detection and inhibition of α-thrombin. Here, we fill this gap by presenting a high-resolution crystallographic structural characterization of the thrombin-TBA complex formed in the presence of Na(+) or K(+) and a circular dichroism study of the structural stability of the aptamer both free and complexed with α-thrombin, in the presence of the two ionic species. The results indicate that the different effects exerted by Na(+) and K(+) on the inhibitory activity of TBA are related to a subtle perturbation of a few key interactions at the protein-aptamer interface. The present data, in combination with those previously obtained on the complex between α-thrombin and a modified aptamer, may allow the design of new TBA variants with a pharmacological performance enhancement.
4fxm DNA X-ray (1.65 Å) Crystal structure of the complex of a human telomeric repeat G-quadruplex and N-methyl mesoporphyrin IX (P21212); 3Dmol view (2012) "Optimized End-Stacking Provides Specificity of N-Methyl Mesoporphyrin IX for Human Telomeric G-Quadruplex DNA." J.Am.Chem.Soc., 134, 20446-20456. pubmed Nicoludis, J.M., Miller, S.T., Jeffrey, P.D., Barrett, S.P., Rablen, P.R., Lawton, T.J., Yatsunyk, L.A. N-methyl mesoporphyrin IX (NMM) is exceptionally selective for G-quadruplexes (GQ) relative to duplex DNA and, as such, has found a wide range of applications in biology and chemistry. In addition, NMM is selective for parallel versus antiparallel GQ folds, as was recently demonstrated in our laboratory. Here, we present the X-ray crystal structure of a complex between NMM and human telomeric DNA dAGGG(TTAGGG)(3), Tel22, determined in two space groups, P2(1)2(1)2 and P6, at 1.65 and 2.15 Å resolution, respectively. The former is the highest resolution structure of the human telomeric GQ DNA reported to date. The biological unit contains a Tel22 dimer of 5'-5' stacked parallel-stranded quadruplexes capped on both ends with NMM, supporting the spectroscopically determined 1:1 stoichiometry. NMM is capable of adjusting its macrocycle geometry to closely match that of the terminal G-tetrad required for efficient π-π stacking. The out-of-plane N-methyl group of NMM fits perfectly into the center of the parallel GQ core where it aligns with potassium ions. In contrast, the interaction of the N-methyl group with duplex DNA or antiparallel GQ would lead to steric clashes that prevent NMM from binding to these structures, thus explaining its unique selectivity. On the basis of the biochemical data, binding of NMM to Tel22 does not rely on relatively nonspecific electrostatic interactions, which characterize most canonical GQ ligands, but rather it is hydrophobic in nature. The structural features observed in the NMM-Tel22 complex described here will serve as guidelines for developing new quadruplex ligands that have excellent affinity and precisely defined selectivity.
4g0f DNA X-ray (2.15 Å) Crystal structure of the complex of a human telomeric repeat G-quadruplex and N-methyl mesoporphyrin IX (P6); 3Dmol view (2012) "Optimized End-Stacking Provides Specificity of N-Methyl Mesoporphyrin IX for Human Telomeric G-Quadruplex DNA." J.Am.Chem.Soc., 134, 20446-20456. pubmed Nicoludis, J.M., Miller, S.T., Jeffrey, P.D., Barrett, S.P., Rablen, P.R., Lawton, T.J., Yatsunyk, L.A. N-methyl mesoporphyrin IX (NMM) is exceptionally selective for G-quadruplexes (GQ) relative to duplex DNA and, as such, has found a wide range of applications in biology and chemistry. In addition, NMM is selective for parallel versus antiparallel GQ folds, as was recently demonstrated in our laboratory. Here, we present the X-ray crystal structure of a complex between NMM and human telomeric DNA dAGGG(TTAGGG)(3), Tel22, determined in two space groups, P2(1)2(1)2 and P6, at 1.65 and 2.15 Å resolution, respectively. The former is the highest resolution structure of the human telomeric GQ DNA reported to date. The biological unit contains a Tel22 dimer of 5'-5' stacked parallel-stranded quadruplexes capped on both ends with NMM, supporting the spectroscopically determined 1:1 stoichiometry. NMM is capable of adjusting its macrocycle geometry to closely match that of the terminal G-tetrad required for efficient π-π stacking. The out-of-plane N-methyl group of NMM fits perfectly into the center of the parallel GQ core where it aligns with potassium ions. In contrast, the interaction of the N-methyl group with duplex DNA or antiparallel GQ would lead to steric clashes that prevent NMM from binding to these structures, thus explaining its unique selectivity. On the basis of the biochemical data, binding of NMM to Tel22 does not rely on relatively nonspecific electrostatic interactions, which characterize most canonical GQ ligands, but rather it is hydrophobic in nature. The structural features observed in the NMM-Tel22 complex described here will serve as guidelines for developing new quadruplex ligands that have excellent affinity and precisely defined selectivity.
4h29 DNA X-ray (1.99 Å) B-raf dimer DNA quadruplex; 3Dmol view (2013) "Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex." J.Am.Chem.Soc., 135, 19319-19329. pubmed Wei, D., Todd, A.K., Zloh, M., Gunaratnam, M., Parkinson, G.N., Neidle, S. The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G·C·G·C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3' and 5' ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.
4i7y hydrolase-hydrolase inhibitor-DNA X-ray (2.4 Å) Crystal Structure of Human Alpha Thrombin in Complex with a 27-mer Aptamer Bound to Exosite II; 3Dmol view (2013) "Duplex-quadruplex motifs in a peculiar structural organization cooperatively contribute to thrombin binding of a DNA aptamer." Acta Crystallogr.,Sect.D, 69, 2403-2411. pubmed Russo Krauss, I., Pica, A., Merlino, A., Mazzarella, L., Sica, F. Potent second-generation thrombin aptamers adopt a duplex-quadruplex bimodular folding and recognize thrombin exosite II with very high affinity and specificity. A sound model of these oligonucleotides, either free or in complex with thrombin, is not yet available. Here, a structural study of one of these aptamers, HD22-27mer, is presented. The crystal structure of this aptamer in complex with thrombin displays a novel architecture in which the helical stem is enchained to a pseudo-G-quadruplex. The results also underline the role of the residues that join the duplex and quadruplex motifs and control their recruitment in thrombin binding.
4kzd immune system-RNA X-ray (2.19 Å) Crystal structure of an RNA aptamer in complex with fluorophore and Fab; 3Dmol view (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. pubmed Huang, H., Suslov, N.B., Li, N.S., Shelke, S.A., Evans, M.E., Koldobskaya, Y., Rice, P.A., Piccirilli, J.A. Spinach is an in vitro-selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.
4kze immune system-RNA X-ray (2.4 Å) Crystal structure of an RNA aptamer in complex with Fab; 3Dmol view (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. pubmed Huang, H., Suslov, N.B., Li, N.S., Shelke, S.A., Evans, M.E., Koldobskaya, Y., Rice, P.A., Piccirilli, J.A. Spinach is an in vitro-selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.
4l0a DNA, RNA X-ray (1.7 Å) X-ray structure of an all LNA quadruplex; 3Dmol view (2014) "A regular thymine tetrad and a peculiar supramolecular assembly in the first crystal structure of an all-LNA G-quadruplex." Acta Crystallogr.,Sect.D, 70, 362-370. pubmed Russo Krauss, I., Parkinson, G.N., Merlino, A., Mattia, C.A., Randazzo, A., Novellino, E., Mazzarella, L., Sica, F. Locked nucleic acids (LNAs) are formed by bicyclic ribonucleotides where the O2' and C4' atoms are linked through a methylene bridge and the sugar is blocked in a 3'-endo conformation. They represent a promising tool for therapeutic and diagnostic applications and are characterized by higher thermal stability and nuclease resistance with respect to their natural counterparts. However, structural descriptions of LNA-containing quadruplexes are rather limited, since few NMR models have been reported in the literature. Here, the first crystallographically derived model of an all-LNA-substituted quadruplex-forming sequence 5'-TGGGT-3' is presented refined at 1.7 Å resolution. This high-resolution crystallographic analysis reveals a regular parallel G-quadruplex arrangement terminating in a well defined thymine tetrad at the 3'-end. The detailed picture of the hydration pattern reveals LNA-specific features in the solvent distribution. Interestingly, two closely packed quadruplexes are present in the asymmetric unit. They face one another with their 3'-ends giving rise to a compact higher-order structure. This new assembly suggests a possible way in which sequential quadruplexes can be disposed in the crowded cell environment. Furthermore, as the formation of ordered structures by molecular self-assembly is an effective strategy to obtain nanostructures, this study could open the way to the design of a new class of LNA-based building blocks for nanotechnology.
4lz1 hydrolase-hydrolase inhibitor-DNA X-ray (1.65 Å) X-ray structure of the complex between human thrombin and the TBA deletion mutant lacking thymine 12 nucleobase; 3Dmol view (2013) "Dissecting the contribution of thrombin exosite I in the recognition of thrombin binding aptamer." Febs J., 280, 6581-6588. pubmed Pica, A., Russo Krauss, I., Merlino, A., Nagatoishi, S., Sugimoto, N., Sica, F. Thrombin plays a pivotal role in the coagulation cascade; therefore, it represents a primary target in the treatment of several blood diseases. The 15-mer DNA oligonucleotide 5'-GGTTGGTGTGGTTGG-3', known as thrombin binding aptamer (TBA), is a highly potent inhibitor of the enzyme. TBA folds as an antiparallel chair-like G-quadruplex structure, with two G-tetrads surrounded by two TT loops on one side and a TGT loop on the opposite side. Previous crystallographic studies have shown that TBA binds thrombin exosite I by its TT loops, T3T4 and T12T13. In order to get a better understanding of the thrombin-TBA interaction, we have undertaken a crystallographic characterization of the complexes between thrombin and two TBA mutants, TBAΔT3 and TBAΔT12, which lack the nucleobase of T3 and T12, respectively. The structural details of the two complexes show that exosite I is actually split into two regions, which contribute differently to TBA recognition. These results provide the basis for a more rational design of new aptamers with improved therapeutic action.
4lz4 hydrolase-hydrolase inhibitor-DNA X-ray (2.56 Å) X-ray structure of the complex between human thrombin and the TBA deletion mutant lacking thymine 3 nucleobase; 3Dmol view (2013) "Dissecting the contribution of thrombin exosite I in the recognition of thrombin binding aptamer." Febs J., 280, 6581-6588. pubmed Pica, A., Russo Krauss, I., Merlino, A., Nagatoishi, S., Sugimoto, N., Sica, F. Thrombin plays a pivotal role in the coagulation cascade; therefore, it represents a primary target in the treatment of several blood diseases. The 15-mer DNA oligonucleotide 5'-GGTTGGTGTGGTTGG-3', known as thrombin binding aptamer (TBA), is a highly potent inhibitor of the enzyme. TBA folds as an antiparallel chair-like G-quadruplex structure, with two G-tetrads surrounded by two TT loops on one side and a TGT loop on the opposite side. Previous crystallographic studies have shown that TBA binds thrombin exosite I by its TT loops, T3T4 and T12T13. In order to get a better understanding of the thrombin-TBA interaction, we have undertaken a crystallographic characterization of the complexes between thrombin and two TBA mutants, TBAΔT3 and TBAΔT12, which lack the nucleobase of T3 and T12, respectively. The structural details of the two complexes show that exosite I is actually split into two regions, which contribute differently to TBA recognition. These results provide the basis for a more rational design of new aptamers with improved therapeutic action.
4ni7 cytokine-DNA X-ray (2.4 Å) Crystal structure of human interleukin 6 in complex with a modified nucleotide aptamer (SOMAMER SL1025); 3Dmol view (2014) "Crystal structure of interleukin-6 in complex with a modified nucleic Acid ligand." J.Biol.Chem., 289, 8720-8734. pubmed Gelinas, A.D., Davies, D.R., Edwards, T.E., Rohloff, J.C., Carter, J.D., Zhang, C., Gupta, S., Ishikawa, Y., Hirota, M., Nakaishi, Y., Jarvis, T.C., Janjic, N. IL-6 is a secreted cytokine that functions through binding two cell surface receptors, IL-6Rα and gp130. Because of its involvement in the progression of several chronic inflammatory diseases, IL-6 is a target of pharmacologic interest. We have recently identified a novel class of ligands called SOMAmers (S low Off-rate Modified Aptamers) that bind IL-6 and inhibit its biologic activity. SOMAmers exploit the chemical diversity of protein-like side chains assembled on flexible nucleic acid scaffolds, resulting in an expanded repertoire of intra- and intermolecular interactions not achievable with conventional aptamers. Here, we report the co-crystal structure of a high affinity SOMAmer (Kd = 0.20 nm) modified at the 5-position of deoxyuridine in a complex with IL-6. The SOMAmer, comprised of a G-quartet domain and a stem-loop domain, engages IL-6 in a clamp-like manner over an extended surface exhibiting close shape complementarity with the protein. The interface is characterized by substantial hydrophobic interactions overlapping the binding surfaces of the IL-6Rα and gp130 receptors. The G-quartet domain retains considerable binding activity as a disconnected autonomous fragment (Kd = 270 nm). A single substitution from our diversely modified nucleotide library leads to a 37-fold enhancement in binding affinity of the G-quartet fragment (Kd = 7.4 nm). The ability to probe ligand surfaces in this manner is a powerful tool in the development of new therapeutic reagents with improved pharmacologic properties. The SOMAmer·IL-6 structure also expands our understanding of the diverse structural motifs achievable with modified nucleic acid libraries and elucidates the nature with which these unique ligands interact with their protein targets.
4ni9 cytokine-DNA X-ray (2.55 Å) Crystal structure of human interleukin 6 in complex with a modified nucleotide aptamer (SOMAMER SL1025), FORM 2; 3Dmol view (2014) "Crystal structure of interleukin-6 in complex with a modified nucleic Acid ligand." J.Biol.Chem., 289, 8720-8734. pubmed Gelinas, A.D., Davies, D.R., Edwards, T.E., Rohloff, J.C., Carter, J.D., Zhang, C., Gupta, S., Ishikawa, Y., Hirota, M., Nakaishi, Y., Jarvis, T.C., Janjic, N. IL-6 is a secreted cytokine that functions through binding two cell surface receptors, IL-6Rα and gp130. Because of its involvement in the progression of several chronic inflammatory diseases, IL-6 is a target of pharmacologic interest. We have recently identified a novel class of ligands called SOMAmers (S low Off-rate Modified Aptamers) that bind IL-6 and inhibit its biologic activity. SOMAmers exploit the chemical diversity of protein-like side chains assembled on flexible nucleic acid scaffolds, resulting in an expanded repertoire of intra- and intermolecular interactions not achievable with conventional aptamers. Here, we report the co-crystal structure of a high affinity SOMAmer (Kd = 0.20 nm) modified at the 5-position of deoxyuridine in a complex with IL-6. The SOMAmer, comprised of a G-quartet domain and a stem-loop domain, engages IL-6 in a clamp-like manner over an extended surface exhibiting close shape complementarity with the protein. The interface is characterized by substantial hydrophobic interactions overlapping the binding surfaces of the IL-6Rα and gp130 receptors. The G-quartet domain retains considerable binding activity as a disconnected autonomous fragment (Kd = 270 nm). A single substitution from our diversely modified nucleotide library leads to a 37-fold enhancement in binding affinity of the G-quartet fragment (Kd = 7.4 nm). The ability to probe ligand surfaces in this manner is a powerful tool in the development of new therapeutic reagents with improved pharmacologic properties. The SOMAmer·IL-6 structure also expands our understanding of the diverse structural motifs achievable with modified nucleic acid libraries and elucidates the nature with which these unique ligands interact with their protein targets.
4p1d DNA X-ray (1.55 Å) Structure of the complex of a bimolecular human telomeric DNA with Coptisine; 3Dmol view "Crystal Structure of the complex of a bimolecular human telomeric DNA with Coptisine." to be published Ferraroni, M., Bazzicalupi, C., Gratteri, P., Bilia, A.R., Sissi, C.
4q9q RNA X-ray (2.45 Å) Crystal structure of an RNA aptamer bound to bromo-ligand analog in complex with Fab; 3Dmol view (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. pubmed Huang, H., Suslov, N.B., Li, N.S., Shelke, S.A., Evans, M.E., Koldobskaya, Y., Rice, P.A., Piccirilli, J.A. Spinach is an in vitro-selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.
4q9r RNA-immune system X-ray (3.12 Å) Crystal structure of an RNA aptamer bound to trifluoroethyl-ligand analog in complex with Fab; 3Dmol view (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. pubmed Huang, H., Suslov, N.B., Li, N.S., Shelke, S.A., Evans, M.E., Koldobskaya, Y., Rice, P.A., Piccirilli, J.A. Spinach is an in vitro-selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.
4r44 DNA X-ray (2.69 Å) Racemic crystal structure of a tetramolecular DNA G-quadruplex; 3Dmol view (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. pubmed Mandal, P.K., Collie, G.W., Kauffmann, B., Huc, I. Racemates increase the chances of crystallization by allowing molecular contacts to be formed in a greater number of ways. With the advent of protein synthesis, the production of protein racemates and racemic-protein crystallography are now possible. Curiously, racemic DNA crystallography had not been investigated despite the commercial availability of L- and D-deoxyribo-oligonucleotides. Here, we report a study into racemic DNA crystallography showing the strong propensity of racemic DNA mixtures to form racemic crystals. We describe racemic crystal structures of various DNA sequences and folded conformations, including duplexes, quadruplexes, and a four-way junction, showing that the advantages of racemic crystallography should extend to DNA.
4r45 DNA X-ray (1.9 Å) Racemic crystal structure of a bimolecular DNA G-quadruplex (P-1); 3Dmol view (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. pubmed Mandal, P.K., Collie, G.W., Kauffmann, B., Huc, I. Racemates increase the chances of crystallization by allowing molecular contacts to be formed in a greater number of ways. With the advent of protein synthesis, the production of protein racemates and racemic-protein crystallography are now possible. Curiously, racemic DNA crystallography had not been investigated despite the commercial availability of L- and D-deoxyribo-oligonucleotides. Here, we report a study into racemic DNA crystallography showing the strong propensity of racemic DNA mixtures to form racemic crystals. We describe racemic crystal structures of various DNA sequences and folded conformations, including duplexes, quadruplexes, and a four-way junction, showing that the advantages of racemic crystallography should extend to DNA.
4r47 DNA X-ray (1.85 Å) Racemic crystal structure of a bimolecular DNA G-quadruplex (P21/n); 3Dmol view (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. pubmed Mandal, P.K., Collie, G.W., Kauffmann, B., Huc, I. Racemates increase the chances of crystallization by allowing molecular contacts to be formed in a greater number of ways. With the advent of protein synthesis, the production of protein racemates and racemic-protein crystallography are now possible. Curiously, racemic DNA crystallography had not been investigated despite the commercial availability of L- and D-deoxyribo-oligonucleotides. Here, we report a study into racemic DNA crystallography showing the strong propensity of racemic DNA mixtures to form racemic crystals. We describe racemic crystal structures of various DNA sequences and folded conformations, including duplexes, quadruplexes, and a four-way junction, showing that the advantages of racemic crystallography should extend to DNA.
4rj1 RNA X-ray (0.92 Å) Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions; 3Dmol view (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. pubmed Fyfe, A.C., Dunten, P.W., Martick, M.M., Scott, W.G. Guanine-rich sequences can, under appropriate conditions, adopt a distinctive, four-stranded, helical fold known as a G-quadruplex. Interest in quadruplex folds has grown in recent years as evidence of their biological relevance has accumulated from both sequence analysis and function-specific assays. The folds are unusually stable and their formation appears to require close management to maintain cell health; regulatory failure correlates with genomic instability and a number of cancer phenotypes. Biologically relevant quadruplex folds are anticipated to form transiently in mRNA and in single-stranded, unwound DNA. To elucidate factors, including bound solvent, that contribute to the stability of RNA quadruplexes, we examine, by X-ray crystallography and small-angle X-ray scattering, the structure of a previously reported tetramolecular quadruplex, UGGGGU stabilized by Sr(2+) ions. Crystal forms of the octameric assembly formed by this sequence exhibit unusually strong diffraction and anomalous signal enabling the construction of reliable models to a resolution of 0.88Å. The solvent structure confirms hydration patterns reported for other nucleic acid helical conformations and provides support for the greater stability of RNA quadruplexes relative to DNA. Novel features detected in the octameric RNA assembly include a new crystal form, evidence of multiple conformations and structural variations in the 3' U tetrad, including one that leads to the formation of a hydrated internal cavity.
4rkv RNA X-ray (0.88 Å) Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions; 3Dmol view (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. pubmed Fyfe, A.C., Dunten, P.W., Martick, M.M., Scott, W.G. Guanine-rich sequences can, under appropriate conditions, adopt a distinctive, four-stranded, helical fold known as a G-quadruplex. Interest in quadruplex folds has grown in recent years as evidence of their biological relevance has accumulated from both sequence analysis and function-specific assays. The folds are unusually stable and their formation appears to require close management to maintain cell health; regulatory failure correlates with genomic instability and a number of cancer phenotypes. Biologically relevant quadruplex folds are anticipated to form transiently in mRNA and in single-stranded, unwound DNA. To elucidate factors, including bound solvent, that contribute to the stability of RNA quadruplexes, we examine, by X-ray crystallography and small-angle X-ray scattering, the structure of a previously reported tetramolecular quadruplex, UGGGGU stabilized by Sr(2+) ions. Crystal forms of the octameric assembly formed by this sequence exhibit unusually strong diffraction and anomalous signal enabling the construction of reliable models to a resolution of 0.88Å. The solvent structure confirms hydration patterns reported for other nucleic acid helical conformations and provides support for the greater stability of RNA quadruplexes relative to DNA. Novel features detected in the octameric RNA assembly include a new crystal form, evidence of multiple conformations and structural variations in the 3' U tetrad, including one that leads to the formation of a hydrated internal cavity.
4rne RNA X-ray (1.01 Å) Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions; 3Dmol view (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. pubmed Fyfe, A.C., Dunten, P.W., Martick, M.M., Scott, W.G. Guanine-rich sequences can, under appropriate conditions, adopt a distinctive, four-stranded, helical fold known as a G-quadruplex. Interest in quadruplex folds has grown in recent years as evidence of their biological relevance has accumulated from both sequence analysis and function-specific assays. The folds are unusually stable and their formation appears to require close management to maintain cell health; regulatory failure correlates with genomic instability and a number of cancer phenotypes. Biologically relevant quadruplex folds are anticipated to form transiently in mRNA and in single-stranded, unwound DNA. To elucidate factors, including bound solvent, that contribute to the stability of RNA quadruplexes, we examine, by X-ray crystallography and small-angle X-ray scattering, the structure of a previously reported tetramolecular quadruplex, UGGGGU stabilized by Sr(2+) ions. Crystal forms of the octameric assembly formed by this sequence exhibit unusually strong diffraction and anomalous signal enabling the construction of reliable models to a resolution of 0.88Å. The solvent structure confirms hydration patterns reported for other nucleic acid helical conformations and provides support for the greater stability of RNA quadruplexes relative to DNA. Novel features detected in the octameric RNA assembly include a new crystal form, evidence of multiple conformations and structural variations in the 3' U tetrad, including one that leads to the formation of a hydrated internal cavity.
4ts0 RNA X-ray (2.8 Å) Crystal structure of the Spinach RNA aptamer in complex with DFHBI, barium ions; 3Dmol view (2014) "Structural basis for activity of highly efficient RNA mimics of green fluorescent protein." Nat.Struct.Mol.Biol., 21, 658-663. pubmed Warner, K.D., Chen, M.C., Song, W., Strack, R.L., Thorn, A., Jaffrey, S.R., Ferre-D'Amare, A.R. GFP and its derivatives revolutionized the study of proteins. Spinach is a recently reported in vitro-evolved RNA mimic of GFP, which as genetically encoded fusions makes possible live-cell, real-time imaging of biological RNAs without resorting to large RNA-binding protein-GFP fusions. To elucidate the molecular basis of Spinach fluorescence, we solved the cocrystal structure of Spinach bound to its cognate exogenous chromophore, showing that Spinach activates the small molecule by immobilizing it between a base triple, a G-quadruplex and an unpaired G. Mutational and NMR analyses indicate that the G-quadruplex is essential for Spinach fluorescence, is also present in other fluorogenic RNAs and may represent a general strategy for RNAs to induce fluorescence of chromophores. The structure guided the design of a miniaturized 'Baby Spinach', and it provides a foundation for structure-driven design and tuning of fluorescent RNAs.
4ts2 RNA X-ray (2.88 Å) Crystal structure of the Spinach RNA aptamer in complex with DFHBI, magnesium ions; 3Dmol view (2014) "Structural basis for activity of highly efficient RNA mimics of green fluorescent protein." Nat.Struct.Mol.Biol., 21, 658-663. pubmed Warner, K.D., Chen, M.C., Song, W., Strack, R.L., Thorn, A., Jaffrey, S.R., Ferre-D'Amare, A.R. GFP and its derivatives revolutionized the study of proteins. Spinach is a recently reported in vitro-evolved RNA mimic of GFP, which as genetically encoded fusions makes possible live-cell, real-time imaging of biological RNAs without resorting to large RNA-binding protein-GFP fusions. To elucidate the molecular basis of Spinach fluorescence, we solved the cocrystal structure of Spinach bound to its cognate exogenous chromophore, showing that Spinach activates the small molecule by immobilizing it between a base triple, a G-quadruplex and an unpaired G. Mutational and NMR analyses indicate that the G-quadruplex is essential for Spinach fluorescence, is also present in other fluorogenic RNAs and may represent a general strategy for RNAs to induce fluorescence of chromophores. The structure guided the design of a miniaturized 'Baby Spinach', and it provides a foundation for structure-driven design and tuning of fluorescent RNAs.
4u5m DNA X-ray (1.5 Å) Structure of a left-handed DNA G-quadruplex; 3Dmol view (2015) "Structure of a left-handed DNA G-quadruplex." Proc.Natl.Acad.Sci.USA, 112, 2729-2733. pubmed Chung, W.J., Heddi, B., Schmitt, E., Lim, K.W., Mechulam, Y., Phan, A.T. Aside from the well-known double helix, DNA can also adopt an alternative four-stranded structure known as G-quadruplex. Implications of such a structure in cellular processes, as well as its therapeutic and diagnostic applications, have been reported. The G-quadruplex structure is highly polymorphic, but so far, only right-handed helical forms have been observed. Here we present the NMR solution and X-ray crystal structures of a left-handed DNA G-quadruplex. The structure displays unprecedented features that can be exploited as unique recognition elements.
4u92 DNA X-ray (1.5 Å) Crystal structure of a DNA/Ba2+ G-quadruplex containing a water-mediated C-tetrad; 3Dmol view (2014) "Crystal structure of a DNA/Ba2+ G-quadruplex containing a water-mediated C-tetrad." Nucleic Acids Res., 42, 13422-13429. pubmed Zhang, D., Huang, T., Lukeman, P.S., Paukstelis, P.J. We have determined the 1.50 Å crystal structure of the DNA decamer, d(CCA(CNV)KGCGTGG) ((CNV)K, 3-cyanovinylcarbazole), which forms a G-quadruplex structure in the presence of Ba(2+). The structure contains several unique features including a bulged nucleotide and the first crystal structure observation of a C-tetrad. The structure reveals that water molecules mediate contacts between the divalent cations and the C-tetrad, allowing Ba(2+) ions to occupy adjacent steps in the central ion channel. One ordered Mg(2+) facilitates 3'-3' stacking of two quadruplexes in the asymmetric unit, while the bulged nucleotide mediates crystal contacts. Despite the high diffraction limit, the first four nucleotides including the (CNV)K nucleoside are disordered though they are still involved in crystal packing. This work suggests that the bulky hydrophobic groups may locally influence the formation of non-Watson-Crick structures from otherwise complementary sequences. These observations lead to the intriguing possibility that certain types of DNA damage may act as modulators of G-quadruplex formation.
4wb2 DNA-RNA hybrid X-ray (1.8 Å) Crystal structure of the mirror-image L-RNA/L-DNA aptamer NOX-D20 in complex with mouse C5a complement anaphylatoxin; 3Dmol view (2015) "Structural basis for the targeting of complement anaphylatoxin C5a using a mixed L-RNA/L-DNA aptamer." Nat Commun, 6, 6481-6481. pubmed Yatime, L., Maasch, C., Hoehlig, K., Klussmann, S., Andersen, G.R., Vater, A. L-Oligonucleotide aptamers (Spiegelmers) consist of non-natural L-configured nucleotides and are of particular therapeutic interest due to their high resistance to plasma nucleases. The anaphylatoxin C5a, a potent inflammatory mediator generated during complement activation that has been implicated with organ damage, can be efficiently targeted by Spiegelmers. Here, we present the first crystallographic structures of an active Spiegelmer, NOX-D20, bound to its physiological targets, mouse C5a and C5a-desArg. The structures reveal a complex 3D architecture for the L-aptamer that wraps around C5a, including an intramolecular G-quadruplex stabilized by a central Ca(2+) ion. Functional validation of the observed L-aptamer:C5a binding mode through mutational studies also rationalizes the specificity of NOX-D20 for mouse and human C5a against macaque and rat C5a. Finally, our structural model provides the molecular basis for the Spiegelmer affinity improvement through positional L-ribonucleotide to L-deoxyribonucleotide exchanges and for its inhibition of the C5a:C5aR interaction.
4wb3 DNA-RNA hybrid X-ray (2.0 Å) Crystal structure of the mirror-image L-RNA/L-DNA aptamer NOX-D20 in complex with mouse C5a-desArg complement anaphylatoxin; 3Dmol view (2015) "Structural basis for the targeting of complement anaphylatoxin C5a using a mixed L-RNA/L-DNA aptamer." Nat Commun, 6, 6481-6481. pubmed Yatime, L., Maasch, C., Hoehlig, K., Klussmann, S., Andersen, G.R., Vater, A. L-Oligonucleotide aptamers (Spiegelmers) consist of non-natural L-configured nucleotides and are of particular therapeutic interest due to their high resistance to plasma nucleases. The anaphylatoxin C5a, a potent inflammatory mediator generated during complement activation that has been implicated with organ damage, can be efficiently targeted by Spiegelmers. Here, we present the first crystallographic structures of an active Spiegelmer, NOX-D20, bound to its physiological targets, mouse C5a and C5a-desArg. The structures reveal a complex 3D architecture for the L-aptamer that wraps around C5a, including an intramolecular G-quadruplex stabilized by a central Ca(2+) ion. Functional validation of the observed L-aptamer:C5a binding mode through mutational studies also rationalizes the specificity of NOX-D20 for mouse and human C5a against macaque and rat C5a. Finally, our structural model provides the molecular basis for the Spiegelmer affinity improvement through positional L-ribonucleotide to L-deoxyribonucleotide exchanges and for its inhibition of the C5a:C5aR interaction.
4wo2 DNA X-ray (1.82 Å) CRYSTAL STRUCTURE OF HUMAN NATIVE CKIT PROTO-ONCOGENE PROMOTER QUADRUPLEX DNA; 3Dmol view "CRYSTAL STRUCTURE OF HUMAN NATIVE CKIT-1 PROTO-ONCOGENE PROMOTER QUADRUPLEX DNA." TO BE PUBLISHED Wei, D., Parkinson, G.N., Neidle, S.
4wo3 DNA X-ray (2.73 Å) THE SECOND C-KIT DNA QUADRUPLEX CRYSTAL STRUCTURE; 3Dmol view "THE SECOND C-KIT1 DNA QUADRUPLEX CRYSTAL STRUCTURE." TO BE PUBLISHED Wei, D., Neidle, S.
4xk0 RNA X-ray (1.08 Å) Crystal structure of a tetramolecular RNA G-quadruplex in potassium; 3Dmol view (2015) "Insights into the mechanism of a G-quadruplex-unwinding DEAH-box helicase." Nucleic Acids Res., 43, 2223-2231. pubmed Chen, M.C., Murat, P., Abecassis, K., Ferre-D'Amare, A.R., Balasubramanian, S. The unwinding of nucleic acid secondary structures within cells is crucial to maintain genomic integrity and prevent abortive transcription and translation initiation. DHX36, also known as RHAU or G4R1, is a DEAH-box ATP-dependent helicase highly specific for DNA and RNA G-quadruplexes (G4s). A fundamental mechanistic understanding of the interaction between helicases and their G4 substrates is important to elucidate G4 biology and pave the way toward G4-targeted therapies. Here we analyze how the thermodynamic stability of G4 substrates affects binding and unwinding by DHX36. We modulated the stability of the G4 substrates by varying the sequence and the number of G-tetrads and by using small, G4-stabilizing molecules. We found an inverse correlation between the thermodynamic stability of the G4 substrates and rates of unwinding by DHX36. In stark contrast, the ATPase activity of the helicase was largely independent of substrate stability pointing toward a decoupling mechanism akin to what has been observed for many double-stranded DEAD-box RNA helicases. Our study provides the first evidence that DHX36 uses a local, non-processive mechanism to unwind G4 substrates, reminiscent of that of eukaryotic initiation factor 4A (eIF4A) on double-stranded substrates.
5bjo RNA X-ray (2.35 Å) Crystal structure of the Corn RNA aptamer in complex with DFHO, site-specific 5-iodo-U; 3Dmol view (2017) "A homodimer interface without base pairs in an RNA mimic of red fluorescent protein." Nat. Chem. Biol., 13, 1195-1201. pubmed Warner, K.D., Sjekloca, L., Song, W., Filonov, G.S., Jaffrey, S.R., Ferre-D'Amare, A.R. Corn, a 28-nucleotide RNA, increases yellow fluorescence of its cognate ligand 3,5-difluoro-4-hydroxybenzylidene-imidazolinone-2-oxime (DFHO) by >400-fold. Corn was selected in vitro to overcome limitations of other fluorogenic RNAs, particularly rapid photobleaching. We now report the Corn-DFHO co-crystal structure, discovering that the functional species is a quasisymmetric homodimer. Unusually, the dimer interface, in which six unpaired adenosines break overall two-fold symmetry, lacks any intermolecular base pairs. The homodimer encapsulates one DFHO at its interprotomer interface, sandwiching it with a G-quadruplex from each protomer. Corn and the green-fluorescent Spinach RNA are structurally unrelated. Their convergent use of G-quadruplexes underscores the usefulness of this motif for RNA-induced small-molecule fluorescence. The asymmetric dimer interface of Corn could provide a basis for the development of mutants that only fluoresce as heterodimers. Such variants would be analogous to Split GFP, and may be useful for analyzing RNA co-expression or association, or for designing self-assembling RNA nanostructures.
5bjp RNA X-ray (2.51 Å) Crystal structure of the Corn RNA aptamer in complex with DFHO, iridium hexammine soak; 3Dmol view (2017) "A homodimer interface without base pairs in an RNA mimic of red fluorescent protein." Nat. Chem. Biol., 13, 1195-1201. pubmed Warner, K.D., Sjekloca, L., Song, W., Filonov, G.S., Jaffrey, S.R., Ferre-D'Amare, A.R. Corn, a 28-nucleotide RNA, increases yellow fluorescence of its cognate ligand 3,5-difluoro-4-hydroxybenzylidene-imidazolinone-2-oxime (DFHO) by >400-fold. Corn was selected in vitro to overcome limitations of other fluorogenic RNAs, particularly rapid photobleaching. We now report the Corn-DFHO co-crystal structure, discovering that the functional species is a quasisymmetric homodimer. Unusually, the dimer interface, in which six unpaired adenosines break overall two-fold symmetry, lacks any intermolecular base pairs. The homodimer encapsulates one DFHO at its interprotomer interface, sandwiching it with a G-quadruplex from each protomer. Corn and the green-fluorescent Spinach RNA are structurally unrelated. Their convergent use of G-quadruplexes underscores the usefulness of this motif for RNA-induced small-molecule fluorescence. The asymmetric dimer interface of Corn could provide a basis for the development of mutants that only fluoresce as heterodimers. Such variants would be analogous to Split GFP, and may be useful for analyzing RNA co-expression or association, or for designing self-assembling RNA nanostructures.
5ccw drug-DNA X-ray (1.89 Å) Structure of the complex of a human telomeric DNA with Au(caffein-2-ylidene)2; 3Dmol view (2016) "Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation." Angew.Chem.Int.Ed.Engl., 55, 4256-4259. pubmed Bazzicalupi, C., Ferraroni, M., Papi, F., Massai, L., Bertrand, B., Messori, L., Gratteri, P., Casini, A. The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described.
5cdb DNA X-ray (1.7 Å) Structure of the complex of a bimolecular human telomeric DNA with a 13-diphenylalkyl Berberine derivative; 3Dmol view (2016) "Solution and Solid-State Analysis of Binding of 13-Substituted Berberine Analogues to Human Telomeric G-quadruplexes." Chem Asian J, 11, 1107-1115. pubmed Ferraroni, M., Bazzicalupi, C., Papi, F., Fiorillo, G., Guaman-Ortiz, L.M., Nocentini, A., Scovassi, A.I., Lombardi, P., Gratteri, P. The interaction between 13-phenylalkyl and 13-diphenylalkyl berberine derivatives (NAX) and human telomeric DNA G4 structures has been investigated by both spectroscopic and crystallographic methods. NAX042 and NAX053 are the best compounds improving the performance of the natural precursor berberine. This finding is in agreement with the X-ray diffraction result for the NAX053-Tel12 adduct, showing the ligand which interacts via π-stacking, sandwiched at the interface of two symmetry-related quadruplex units, with its benzhydryl group contributing to the overall stability of the adduct by means of additional π-stacking interactions with the DNA residues. The berberine derivatives were also investigated for their cytotoxic activity towards a panel of human cancer cell lines. Compounds NAX042 and NAX053 affect the viability of cancer cell lines in a dose-dependent manner.
5cmx hydrolase X-ray (2.98 Å) X-ray structure of the complex between human alpha thrombin and a duplex/quadruplex 31-mer DNA aptamer; 3Dmol view (2016) "Different duplex/quadruplex junctions determine the properties of anti-thrombin aptamers with mixed folding." Nucleic Acids Res., 44, 983-991. pubmed Russo Krauss, I., Spiridonova, V., Pica, A., Napolitano, V., Sica, F. Mixed duplex/quadruplex oligonucleotides have attracted great interest as therapeutic targets as well as effective biomedical aptamers. In the case of thrombin-binding aptamer (TBA), the addition of a duplex motif to the G-quadruplex module improves the aptamer resistance to biodegradation and the affinity for thrombin. In particular, the mixed oligonucleotide RE31 is significantly more effective than TBA in anticoagulation experiments and shows a slower disappearance rate in human plasma and blood. In the crystal structure of the complex with thrombin, RE31 adopts an elongated structure in which the duplex and quadruplex regions are perfectly stacked on top of each other, firmly connected by a well-structured junction. The lock-and-key shape complementarity between the TT loops of the G-quadruplex and the protein exosite I gives rise to the basic interaction that stabilizes the complex. However, our data suggest that the duplex motif may have an active role in determining the greater anti-thrombin activity in biological fluids with respect to TBA. This work gives new information on mixed oligonucleotides and highlights the importance of structural data on duplex/quadruplex junctions, which appear to be varied, unpredictable, and fundamental in determining the aptamer functional properties.
5de5 RNA binding protein-RNA X-ray (3.0 Å) Crystal structure of the complex between human FMRP RGG motif and G-quadruplex RNA.; 3Dmol view (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. pubmed Vasilyev, N., Polonskaia, A., Darnell, J.C., Darnell, R.B., Patel, D.J., Serganov, A. Fragile X Mental Retardation Protein (FMRP) is a regulatory RNA binding protein that plays a central role in the development of several human disorders including Fragile X Syndrome (FXS) and autism. FMRP uses an arginine-glycine-rich (RGG) motif for specific interactions with guanine (G)-quadruplexes, mRNA elements implicated in the disease-associated regulation of specific mRNAs. Here we report the 2.8-Å crystal structure of the complex between the human FMRP RGG peptide bound to the in vitro selected G-rich RNA. In this model system, the RNA adopts an intramolecular K(+)-stabilized G-quadruplex structure composed of three G-quartets and a mixed tetrad connected to an RNA duplex. The RGG peptide specifically binds to the duplex-quadruplex junction, the mixed tetrad, and the duplex region of the RNA through shape complementarity, cation-π interactions, and multiple hydrogen bonds. Many of these interactions critically depend on a type I β-turn, a secondary structure element whose formation was not previously recognized in the RGG motif of FMRP. RNA mutagenesis and footprinting experiments indicate that interactions of the peptide with the duplex-quadruplex junction and the duplex of RNA are equally important for affinity and specificity of the RGG-RNA complex formation. These results suggest that specific binding of cellular RNAs by FMRP may involve hydrogen bonding with RNA duplexes and that RNA duplex recognition can be a characteristic RNA binding feature for RGG motifs in other proteins.
5de8 RNA binding protein-RNA X-ray (3.1 Å) Crystal structure of the complex between human FMRP RGG motif and G-quadruplex RNA, iridium hexammine bound form.; 3Dmol view (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. pubmed Vasilyev, N., Polonskaia, A., Darnell, J.C., Darnell, R.B., Patel, D.J., Serganov, A. Fragile X Mental Retardation Protein (FMRP) is a regulatory RNA binding protein that plays a central role in the development of several human disorders including Fragile X Syndrome (FXS) and autism. FMRP uses an arginine-glycine-rich (RGG) motif for specific interactions with guanine (G)-quadruplexes, mRNA elements implicated in the disease-associated regulation of specific mRNAs. Here we report the 2.8-Å crystal structure of the complex between the human FMRP RGG peptide bound to the in vitro selected G-rich RNA. In this model system, the RNA adopts an intramolecular K(+)-stabilized G-quadruplex structure composed of three G-quartets and a mixed tetrad connected to an RNA duplex. The RGG peptide specifically binds to the duplex-quadruplex junction, the mixed tetrad, and the duplex region of the RNA through shape complementarity, cation-π interactions, and multiple hydrogen bonds. Many of these interactions critically depend on a type I β-turn, a secondary structure element whose formation was not previously recognized in the RGG motif of FMRP. RNA mutagenesis and footprinting experiments indicate that interactions of the peptide with the duplex-quadruplex junction and the duplex of RNA are equally important for affinity and specificity of the RGG-RNA complex formation. These results suggest that specific binding of cellular RNAs by FMRP may involve hydrogen bonding with RNA duplexes and that RNA duplex recognition can be a characteristic RNA binding feature for RGG motifs in other proteins.
5dea RNA binding protein-RNA X-ray (2.8 Å) Crystal structure of the complex between human FMRP RGG motif and G-quadruplex RNA, cesium bound form.; 3Dmol view (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. pubmed Vasilyev, N., Polonskaia, A., Darnell, J.C., Darnell, R.B., Patel, D.J., Serganov, A. Fragile X Mental Retardation Protein (FMRP) is a regulatory RNA binding protein that plays a central role in the development of several human disorders including Fragile X Syndrome (FXS) and autism. FMRP uses an arginine-glycine-rich (RGG) motif for specific interactions with guanine (G)-quadruplexes, mRNA elements implicated in the disease-associated regulation of specific mRNAs. Here we report the 2.8-Å crystal structure of the complex between the human FMRP RGG peptide bound to the in vitro selected G-rich RNA. In this model system, the RNA adopts an intramolecular K(+)-stabilized G-quadruplex structure composed of three G-quartets and a mixed tetrad connected to an RNA duplex. The RGG peptide specifically binds to the duplex-quadruplex junction, the mixed tetrad, and the duplex region of the RNA through shape complementarity, cation-π interactions, and multiple hydrogen bonds. Many of these interactions critically depend on a type I β-turn, a secondary structure element whose formation was not previously recognized in the RGG motif of FMRP. RNA mutagenesis and footprinting experiments indicate that interactions of the peptide with the duplex-quadruplex junction and the duplex of RNA are equally important for affinity and specificity of the RGG-RNA complex formation. These results suggest that specific binding of cellular RNAs by FMRP may involve hydrogen bonding with RNA duplexes and that RNA duplex recognition can be a characteristic RNA binding feature for RGG motifs in other proteins.
5dww DNA X-ray (2.79 Å) Structural Insights into the Quadruplex-Duplex 3' Interface formed from a Telomeric Repeat - TTLOOP; 3Dmol view (2016) "Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target." J.Am.Chem.Soc., 138, 1226-1233. pubmed Russo Krauss, I., Ramaswamy, S., Neidle, S., Haider, S., Parkinson, G.N. We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.
5dwx DNA X-ray (2.71 Å) Structural Insights into the Quadruplex-Duplex 3' Interface formed from a Telomeric Repeat - TLOOP; 3Dmol view (2016) "Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target." J.Am.Chem.Soc., 138, 1226-1233. pubmed Russo Krauss, I., Ramaswamy, S., Neidle, S., Haider, S., Parkinson, G.N. We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.
5ew1 protein-DNA X-ray (2.95 Å) Human thrombin sandwiched between two DNA aptamers: HD22 and HD1-deltaT3; 3Dmol view (2017) "Through-bond effects in the ternary complexes of thrombin sandwiched by two DNA aptamers." Nucleic Acids Res., 45, 461-469. pubmed Pica, A., Russo Krauss, I., Parente, V., Tateishi-Karimata, H., Nagatoishi, S., Tsumoto, K., Sugimoto, N., Sica, F. Aptamers directed against human thrombin can selectively bind to two different exosites on the protein surface. The simultaneous use of two DNA aptamers, HD1 and HD22, directed to exosite I and exosite II respectively, is a very powerful approach to exploit their combined affinity. Indeed, strategies to link HD1 and HD22 together have been proposed in order to create a single bivalent molecule with an enhanced ability to control thrombin activity. In this work, the crystal structures of two ternary complexes, in which thrombin is sandwiched between two DNA aptamers, are presented and discussed. The structures shed light on the cross talk between the two exosites. The through-bond effects are particularly evident at exosite II, with net consequences on the HD22 structure. Moreover, thermodynamic data on the binding of the two aptamers are also reported and analyzed.
5ew2 protein-DNA X-ray (3.59 Å) Human thrombin sandwiched between two DNA aptamers: HD22 and HD1-deltaT12; 3Dmol view (2017) "Through-bond effects in the ternary complexes of thrombin sandwiched by two DNA aptamers." Nucleic Acids Res., 45, 461-469. pubmed Pica, A., Russo Krauss, I., Parente, V., Tateishi-Karimata, H., Nagatoishi, S., Tsumoto, K., Sugimoto, N., Sica, F. Aptamers directed against human thrombin can selectively bind to two different exosites on the protein surface. The simultaneous use of two DNA aptamers, HD1 and HD22, directed to exosite I and exosite II respectively, is a very powerful approach to exploit their combined affinity. Indeed, strategies to link HD1 and HD22 together have been proposed in order to create a single bivalent molecule with an enhanced ability to control thrombin activity. In this work, the crystal structures of two ternary complexes, in which thrombin is sandwiched between two DNA aptamers, are presented and discussed. The structures shed light on the cross talk between the two exosites. The through-bond effects are particularly evident at exosite II, with net consequences on the HD22 structure. Moreover, thermodynamic data on the binding of the two aptamers are also reported and analyzed.
5hix DNA X-ray (2.48 Å) Cocrystal structure of an anti-parallel DNA G-quadruplex and a tetra-Quinoline Foldamer; 3Dmol view (2016) "Multivalent Interactions between an Aromatic Helical Foldamer and a DNA G-Quadruplex in the Solid State." Chembiochem, 17, 1911-1914. pubmed Mandal, P.K., Baptiste, B., Langlois d'Estaintot, B., Kauffmann, B., Huc, I. Quinoline-based oligoamide foldamers have been identified as a potent class of ligands for G-quadruplex DNA. Their helical structure is thought to target G-quadruplex loops or grooves and not G-tetrads. We report a co-crystal structure of the antiparallel hairpin dimeric DNA G-quadruplex (G4 T4 G4 )2 with tetramer 1-a helically folded oligo-quinolinecarboxamide bearing cationic side chains-that is consistent with this hypothesis. Multivalent foldamer-DNA interactions that modify the packing of (G4 T4 G4 )2 in the solid state are observed.
5i2v DNA NMR NMR structure of a new G-quadruplex forming sequence within the KRAS proto-oncogene promoter region; 3Dmol view (2017) "High-resolution three-dimensional NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation." J. Biol. Chem., 292, 8082-8091. pubmed Kerkour, A., Marquevielle, J., Ivashchenko, S., Yatsunyk, L.A., Mergny, J.L., Salgado, G.F. Non-canonical base pairing within guanine-rich DNA and RNA sequences can produce G-quartets, whose stacking leads to the formation of a G-quadruplex (G4). G4s can coexist with canonical duplex DNA in the human genome and have been suggested to suppress gene transcription, and much attention has therefore focused on studying G4s in promotor regions of disease-related genes. For example, the human KRAS proto-oncogene contains a nuclease-hypersensitive element located upstream of the major transcription start site. The KRAS nuclease-hypersensitive element (NHE) region contains a G-rich element (22RT; 5'-AGGGCGGTGTGGGAATAGGGAA-3') and encompasses a Myc-associated zinc finger-binding site that regulates KRAS transcription. The NEH region therefore has been proposed as a target for new drugs that control KRAS transcription, which requires detailed knowledge of the NHE structure. In this study, we report a high-resolution NMR structure of the G-rich element within the KRAS NHE. We found that the G-rich element forms a parallel structure with three G-quartets connected by a four-nucleotide loop and two short one-nucleotide double-chain reversal loops. In addition, a thymine bulge is found between G8 and G9. The loops of different lengths and the presence of a bulge between the G-quartets are structural elements that potentially can be targeted by small chemical ligands that would further stabilize the structure and interfere or block transcriptional regulators such as Myc-associated zinc finger from accessing their binding sites on the KRAS promoter. In conclusion, our work suggests a possible new route for the development of anticancer agents that could suppress KRAS expression.
5j05 DNA NMR DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium; 3Dmol view (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007-eaat3007. pubmed Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M. The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
5j4p DNA NMR DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium; 3Dmol view (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007-eaat3007. pubmed Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M. The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
5j4w DNA NMR DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium; 3Dmol view (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007-eaat3007. pubmed Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M. The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
5j6u DNA NMR DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium; 3Dmol view (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007-eaat3007. pubmed Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M. The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
5lig DNA NMR G-Quadruplex formed at the 5'-end of NHEIII_1 Element in human c-MYC promoter bound to triangulenium based fluorescence probe DAOTA-M2; 3Dmol view (2016) "NMR Structure of a Triangulenium-Based Long-Lived Fluorescence Probe Bound to a G-Quadruplex." Angew.Chem.Int.Ed.Engl., 55, 12508-12511. pubmed Kotar, A., Wang, B., Shivalingam, A., Gonzalez-Garcia, J., Vilar, R., Plavec, J. An NMR structural study of the interaction between a small-molecule optical probe (DAOTA-M2) and a G-quadruplex from the promoter region of the c-myc oncogene revealed that they interact at 1:2 binding stoichiometry. NMR-restrained structural calculations show that binding of DAOTA-M2 occurs mainly through π-π stacking between the polyaromatic core of the ligand and guanine residues of the outer G-quartets. Interestingly, the binding affinities of DAOTA-M2 differ by a factor of two for the outer G-quartets of the unimolecular parallel G-quadruplex under study. Unrestrained MD calculations indicate that DAOTA-M2 displays significant dynamic behavior when stacked on a G-quartet plane. These studies provide molecular guidelines for the design of triangulenium derivatives that can be used as optical probes for G-quadruplexes.
5lqg DNA NMR A two-quartet G-quadruplex formed by human telomere in KCl solution at neutral pH; 3Dmol view "Ammonium ion as a probe to asses the kinetics of structural changes upon de/protonation of G-quadruplexes." To Be Published Wang, B., Galer, P., Sket, P., Plavec, J.
5lqh DNA NMR A two-quartet G-quadruplex formed by human telomere in KCl solution at pH 5.0; 3Dmol view "Ammonium ion as a probe to asses the kinetics of structural changes upon de/protonation of G-quadruplexes." To Be Published Wang, B., Galer, P., Sket, P., Plavec, J.
5ls8 DNA X-ray (1.78 Å) Light-activated ruthenium complex bound to a DNA quadruplex; 3Dmol view "Chiral recognition of a DNA quadruplex by a light-activated ruthenium complex." To Be Published McQuaid, K.T., Abell, H., Brazier, J., Cardin, C.J., Hall, J.P.
5m2l DNA NMR Structure of DNA tetrameric AGCGA-quadruplex adopted by 15-mer d(GCGAGGGAGCGAGGG), VK34, oligonucleotide found in regulatory region of the PLEKHG3 human gene; 3Dmol view (2017) "Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions." Nat Commun, 8, 15355-15355. pubmed Kocman, V., Plavec, J. Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.
5mbr DNA NMR Quadruplex with flipped tetrad formed by a human telomeric sequence; 3Dmol view (2017) "Tracing Effects of Fluorine Substitutions on G-Quadruplex Conformational Changes." ACS Chem. Biol., 12, 1308-1315. pubmed Dickerhoff, J., Haase, L., Langel, W., Weisz, K. A human telomere sequence that folds into an intramolecular (3 + 1)-hybrid G-quadruplex was modified by the incorporation of 2'-fluoro-2'-deoxyriboguanosines (FG) into syn positions of its outer tetrad. A circular dichroism and NMR spectral analysis reveals a nearly quantitative switch of the G-tetrad polarity with concerted syn↔anti transitions of all four G residues. These observations follow findings on a FG-substituted (3 + 1)-hybrid quadruplex with a different fold, suggesting a more general propensity of hybrid-type quadruplexes to undergo a tetrad polarity reversal. Two out of the three FG analogs in both modified quadruplexes adopt an S-type sugar pucker, challenging a sole contribution of N-type sugars in enforcing an anti glycosidic torsion angle associated with the tetrad flip. NMR restrained three-dimensional structures of the two substituted quadruplexes reveal a largely conserved overall fold but significant rearrangements of the overhang and loop nucleotides capping the flipped tetrad. Sugar pucker preferences of the FG analogs may be rationalized by different orientations of the fluorine atom and its resistance to be positioned within the narrow groove with its highly negative electrostatic potential and spine of water molecules.
5mcr DNA NMR Quadruplex with flipped tetrad formed by an artificial sequence; 3Dmol view (2017) "Tracing Effects of Fluorine Substitutions on G-Quadruplex Conformational Changes." ACS Chem. Biol., 12, 1308-1315. pubmed Dickerhoff, J., Haase, L., Langel, W., Weisz, K. A human telomere sequence that folds into an intramolecular (3 + 1)-hybrid G-quadruplex was modified by the incorporation of 2'-fluoro-2'-deoxyriboguanosines (FG) into syn positions of its outer tetrad. A circular dichroism and NMR spectral analysis reveals a nearly quantitative switch of the G-tetrad polarity with concerted syn↔anti transitions of all four G residues. These observations follow findings on a FG-substituted (3 + 1)-hybrid quadruplex with a different fold, suggesting a more general propensity of hybrid-type quadruplexes to undergo a tetrad polarity reversal. Two out of the three FG analogs in both modified quadruplexes adopt an S-type sugar pucker, challenging a sole contribution of N-type sugars in enforcing an anti glycosidic torsion angle associated with the tetrad flip. NMR restrained three-dimensional structures of the two substituted quadruplexes reveal a largely conserved overall fold but significant rearrangements of the overhang and loop nucleotides capping the flipped tetrad. Sugar pucker preferences of the FG analogs may be rationalized by different orientations of the fluorine atom and its resistance to be positioned within the narrow groove with its highly negative electrostatic potential and spine of water molecules.
5mjx DNA NMR 2'F-ANA/DNA Chimeric TBA Quadruplex structure; 3Dmol view (2017) "Mapping the affinity landscape of Thrombin-binding aptamers on 2 F-ANA/DNA chimeric G-Quadruplex microarrays." Nucleic Acids Res., 45, 1619-1632. pubmed Lietard, J., Abou Assi, H., Gomez-Pinto, I., Gonzalez, C., Somoza, M.M., Damha, M.J. In situ fabricated nucleic acids microarrays are versatile and very high-throughput platforms for aptamer optimization and discovery, but the chemical space that can be probed against a given target has largely been confined to DNA, while RNA and non-natural nucleic acid microarrays are still an essentially uncharted territory. 2΄-Fluoroarabinonucleic acid (2΄F-ANA) is a prime candidate for such use in microarrays. Indeed, 2΄F-ANA chemistry is readily amenable to photolithographic microarray synthesis and its potential in high affinity aptamers has been recently discovered. We thus synthesized the first microarrays containing 2΄F-ANA and 2΄F-ANA/DNA chimeric sequences to fully map the binding affinity landscape of the TBA1 thrombin-binding G-quadruplex aptamer containing all 32 768 possible DNA-to-2΄F-ANA mutations. The resulting microarray was screened against thrombin to identify a series of promising 2΄F-ANA-modified aptamer candidates with Kds significantly lower than that of the unmodified control and which were found to adopt highly stable, antiparallel-folded G-quadruplex structures. The solution structure of the TBA1 aptamer modified with 2΄F-ANA at position T3 shows that fluorine substitution preorganizes the dinucleotide loop into the proper conformation for interaction with thrombin. Overall, our work strengthens the potential of 2΄F-ANA in aptamer research and further expands non-genomic applications of nucleic acids microarrays.
5mta DNA NMR G-quadruplex formed within promoters of Plasmodium falciparum B var genes; 3Dmol view "Stabilizing interactions in long-loop G-quadruplex formed within promoters of Plasmodium falciparum B var genes." To Be Published Juribasic Kulcsar, M., Gabelica, V., Plavec, J.
5mtg DNA NMR G-quadruplex formed within promoters of Plasmodium falciparum B var genes - form I; 3Dmol view "Stabilizing interactions in long-loop G-quadruplex formed within promoters of Plasmodium falciparum B var genes." To Be Published Juribasic Kulcsar, M., Gabelica, V., Plavec, J.
5mvb DNA NMR Solution structure of a human G-Quadruplex hybrid-2 form in complex with a Gold-ligand.; 3Dmol view (2017) "Solution NMR Structure of a Ligand/Hybrid-2-G-Quadruplex Complex Reveals Rearrangements that Affect Ligand Binding." Angew. Chem. Int. Ed. Engl., 56, 7102-7106. pubmed Wirmer-Bartoschek, J., Bendel, L.E., Jonker, H.R.A., Grun, J.T., Papi, F., Bazzicalupi, C., Messori, L., Gratteri, P., Schwalbe, H. Telomeric G-quadruplexes have recently emerged as drug targets in cancer research. Herein, we present the first NMR structure of a telomeric DNA G-quadruplex that adopts the biologically relevant hybrid-2 conformation in a ligand-bound state. We solved the complex with a metalorganic gold(III) ligand that stabilizes G-quadruplexes. Analysis of the free and bound structures reveals structural changes in the capping region of the G-quadruplex. The ligand is sandwiched between one terminal G-tetrad and a flanking nucleotide. This complex structure involves a major structural rearrangement compared to the free G-quadruplex structure as observed for other G-quadruplexes in different conformations, invalidating simple docking approaches to ligand-G-quadruplex structure determination.
5nys DNA NMR M2 G-quadruplex dilute solution; 3Dmol view (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. pubmed Trajkovski, M., Endoh, T., Tateishi-Karimata, H., Ohyama, T., Tanaka, S., Plavec, J., Sugimoto, N. Molecular crowding conditions provided by high concentration of cosolutes are utilized for characterization of biomolecules in cell-mimicking environment and development of drug-delivery systems. In this context, (poly)ethylene glycols are often used for studying non-canonical DNA structures termed G-quadruplexes, which came into focus by emerging structural biology findings and new therapeutic drug design approaches. Recently, several reports were made arguing against using (poly)ethylene glycols in role of molecular crowding agents due to their direct impact on DNA G-quadruplex stability and topology. However, the available data on structural details underlying DNA interaction is very scarce and thus limits in-depth comprehension. Herein, structural and thermodynamic analyses were strategically combined to assess G-quadruplex-cosolute interactions and address previously reported variances regarding the driving forces of G-rich DNA structural transformations under molecular crowding conditions. With the use of complementary (CD, NMR and UV) spectroscopic methods and model approach we characterized DNA G-quadruplex in the presence of the smallest and one of the largest typically used (poly)ethylene glycols. Dehydration effect is the key contributor to ethylene-glycol-induced increased stability of the G-quadruplex, which is in the case of the large cosolute mainly guided by the subtle direct interactions between PEG 8000 and the outer G-quartet regions.
5nyt DNA NMR M2 G-quadruplex 20 wt% ethylene glycol; 3Dmol view (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. pubmed Trajkovski, M., Endoh, T., Tateishi-Karimata, H., Ohyama, T., Tanaka, S., Plavec, J., Sugimoto, N. Molecular crowding conditions provided by high concentration of cosolutes are utilized for characterization of biomolecules in cell-mimicking environment and development of drug-delivery systems. In this context, (poly)ethylene glycols are often used for studying non-canonical DNA structures termed G-quadruplexes, which came into focus by emerging structural biology findings and new therapeutic drug design approaches. Recently, several reports were made arguing against using (poly)ethylene glycols in role of molecular crowding agents due to their direct impact on DNA G-quadruplex stability and topology. However, the available data on structural details underlying DNA interaction is very scarce and thus limits in-depth comprehension. Herein, structural and thermodynamic analyses were strategically combined to assess G-quadruplex-cosolute interactions and address previously reported variances regarding the driving forces of G-rich DNA structural transformations under molecular crowding conditions. With the use of complementary (CD, NMR and UV) spectroscopic methods and model approach we characterized DNA G-quadruplex in the presence of the smallest and one of the largest typically used (poly)ethylene glycols. Dehydration effect is the key contributor to ethylene-glycol-induced increased stability of the G-quadruplex, which is in the case of the large cosolute mainly guided by the subtle direct interactions between PEG 8000 and the outer G-quartet regions.
5nyu DNA NMR M2 G-quadruplex 10 wt% PEG8000; 3Dmol view (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. pubmed Trajkovski, M., Endoh, T., Tateishi-Karimata, H., Ohyama, T., Tanaka, S., Plavec, J., Sugimoto, N. Molecular crowding conditions provided by high concentration of cosolutes are utilized for characterization of biomolecules in cell-mimicking environment and development of drug-delivery systems. In this context, (poly)ethylene glycols are often used for studying non-canonical DNA structures termed G-quadruplexes, which came into focus by emerging structural biology findings and new therapeutic drug design approaches. Recently, several reports were made arguing against using (poly)ethylene glycols in role of molecular crowding agents due to their direct impact on DNA G-quadruplex stability and topology. However, the available data on structural details underlying DNA interaction is very scarce and thus limits in-depth comprehension. Herein, structural and thermodynamic analyses were strategically combined to assess G-quadruplex-cosolute interactions and address previously reported variances regarding the driving forces of G-rich DNA structural transformations under molecular crowding conditions. With the use of complementary (CD, NMR and UV) spectroscopic methods and model approach we characterized DNA G-quadruplex in the presence of the smallest and one of the largest typically used (poly)ethylene glycols. Dehydration effect is the key contributor to ethylene-glycol-induced increased stability of the G-quadruplex, which is in the case of the large cosolute mainly guided by the subtle direct interactions between PEG 8000 and the outer G-quartet regions.
5o4d DNA NMR G-quadruplex of Human papillomavirus type 52; 3Dmol view (2019) "Towards Understanding of Polymorphism of the G-rich Region of Human Papillomavirus Type 52." Molecules, 24 pubmed Marusic, M., Plavec, J. The potential to affect gene expression via G-quadruplex stabilization has been extended to all domains of life, including viruses. Here, we investigate the polymorphism and structures of G-quadruplexes of the human papillomavirus type 52 with UV, CD and NMR spectroscopy and gel electrophoresis. We show that oligonucleotide with five G-tracts folds into several structures and that naturally occurring single nucleotide polymorphisms (SNPs) have profound effects on the structural polymorphism in the context of G-quadruplex forming propensity, conformational heterogeneity and folding stability. With help of SNP analysis, we were able to select one of the predominant forms, formed by G-rich sequence d(G₃TAG₃CAG₄ACACAG₃T). This oligonucleotide termed HPV52(1-4) adopts a three G-quartet snap back (3 + 1) type scaffold with four syn guanine residues, two edgewise loops spanning the same groove, a no-residue V loop and a propeller type loop. The first guanine residue is incorporated in the central G-quartet and all four-guanine residues from G4 stretch are included in the three quartet G-quadruplex core. Modification studies identified several structural elements that are important for stabilization of the described G-quadruplex fold. Our results expand set of G-rich targets in viral genomes and address the fundamental questions regarding folding of G-rich sequences.
5ob3 RNA X-ray (2.0 Å) iSpinach aptamer; 3Dmol view (2017) "Crystal structure and fluorescence properties of the iSpinach aptamer in complex with DFHBI." RNA, 23, 1788-1795. pubmed Fernandez-Millan, P., Autour, A., Ennifar, E., Westhof, E., Ryckelynck, M. Fluorogenic RNA aptamers are short nucleic acids able to specifically interact with small molecules and strongly enhance their fluorescence upon complex formation. Among the different systems recently introduced, Spinach, an aptamer forming a fluorescent complex with the 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI), is one of the most promising. Using random mutagenesis and ultrahigh-throughput screening, we recently developed iSpinach, an improved version of the aptamer, endowed with an increased folding efficiency and thermal stability. iSpinach is a shorter version of Spinach, comprising five mutations for which the exact role has not yet been deciphered. In this work, we cocrystallized a reengineered version of iSpinach in complex with the DFHBI and solved the X-ray structure of the complex at 2 Å resolution. Only a few mutations were required to optimize iSpinach production and crystallization, underlying the good folding capacity of the molecule. The measured fluorescence half-lives in the crystal were 60% higher than in solution. Comparisons with structures previously reported for Spinach sheds some light on the possible function of the different beneficial mutations carried by iSpinach.
5oph DNA NMR G-quadruplex structure of DNA oligonucleotide containing GGGGCC repeats linked to ALS and FTD; 3Dmol view (2018) "NMR structure of a G-quadruplex formed by four d(G4C2) repeats: insights into structural polymorphism." Nucleic Acids Res., 46, 11605-11617. pubmed Brcic, J., Plavec, J. Most frequent genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), is a largely increased number of d(G4C2)n•(G2C4)n repeats located in the non-coding region of C9orf72 gene. Non-canonical structures, including G-quadruplexes, formed within expanded repeats have been proposed to drive repeat expansion and pathogenesis of ALS and FTD. Oligonucleotide d[(G4C2)3G4], which represents the shortest oligonucleotide model of d(G4C2) repeats with the ability to form a unimolecular G-quadruplex, forms two major G-quadruplex structures in addition to several minor species which coexist in solution with K+ ions. Herein, we used solution-state NMR to determine the high-resolution structure of one of the major G-quadruplex species adopted by d[(G4C2)3G4]. Structural characterization of the G-quadruplex named AQU was facilitated by a single substitution of dG with 8Br-dG at position 21 and revealed an antiparallel fold composed of four G-quartets and three lateral C-C loops. The G-quadruplex exhibits high thermal stability and is favored kinetically and under slightly acidic conditions. An unusual structural element distinct from a C-quartet is observed in the structure. Two C•C base pairs are stacked on the nearby G-quartet and are involved in a dynamic equilibrium between symmetric N3-amino and carbonyl-amino geometries and protonated C+•C state.
5ov2 DNA NMR 2'F-ANA-G modified quadruplex with a flipped tetrad; 3Dmol view (2017) "Nonconventional C-HF Hydrogen Bonds Support a Tetrad Flip in Modified G-Quadruplexes." J Phys Chem Lett, 8, 5148-5152. pubmed Dickerhoff, J., Weisz, K. A G-quadruplex adopting a (3 + 1)-hybrid structure was substituted at its 5'-tetrad by 2'-deoxy-2'-fluoro-arabinoguanosine (FaraG) analogs. Incorporation of anti-favoring FaraG at syn-positions of the 5'-outer tetrad induced a reversal of the tetrad polarity without noticeably compromising the quadruplex stability. This conformational change is shown to be promoted by nonconventional C-H···F hydrogen bonds acting within the anti-FaraG residues.
5ua3 DNA X-ray (1.88 Å) Crystal Structure of a DNA G-Quadruplex with a Cytosine Bulge; 3Dmol view (2018) "Structure and hydrodynamics of a DNA G-quadruplex with a cytosine bulge." Nucleic Acids Res., 46, 5319-5331. pubmed Meier, M., Moya-Torres, A., Krahn, N.J., McDougall, M.D., Orriss, G.L., McRae, E.K.S., Booy, E.P., McEleney, K., Patel, T.R., McKenna, S.A., Stetefeld, J. The identification of four-stranded G-quadruplexes (G4s) has highlighted the fact that DNA has additional spatial organisations at its disposal other than double-stranded helices. Recently, it became clear that the formation of G4s is not limited to the traditional G3+NL1G3+NL2G3+NL3G3+ sequence motif. Instead, the G3 triplets can be interrupted by deoxythymidylate (DNA) or uridylate (RNA) where the base forms a bulge that loops out from the G-quadruplex core. Here, we report the first high-resolution X-ray structure of a unique unimolecular DNA G4 with a cytosine bulge. The G4 forms a dimer that is stacked via its 5'-tetrads. Analytical ultracentrifugation, static light scattering and small angle X-ray scattering confirmed that the G4 adapts a predominantly dimeric structure in solution. We provide a comprehensive comparison of previously published G4 structures containing bulges and report a special γ torsion angle range preferentially populated by the G4 core guanylates adjacent to bulges. Since the penalty for introducing bulges appears to be negligible, it should be possible to functionalize G4s by introducing artificial or modified nucleotides at such positions. The presence of the bulge alters the surface of the DNA, providing an opportunity to develop drugs that can specifically target individual G4s.
5v3f RNA X-ray (1.7 Å) Co-crystal structure of the fluorogenic RNA Mango; 3Dmol view (2017) "Structural basis for high-affinity fluorophore binding and activation by RNA Mango." Nat. Chem. Biol., 13, 807-813. pubmed Trachman, R.J., Demeshkina, N.A., Lau, M.W.L., Panchapakesan, S.S.S., Jeng, S.C.Y., Unrau, P.J., Ferre-D'Amare, A.R. Genetically encoded fluorescent protein tags have revolutionized proteome studies, whereas the lack of intrinsically fluorescent RNAs has hindered transcriptome exploration. Among several RNA-fluorophore complexes that potentially address this problem, RNA Mango has an exceptionally high affinity for its thiazole orange (TO)-derived fluorophore, TO1-Biotin (Kd ∼3 nM), and, in complex with related ligands, it is one of the most redshifted fluorescent macromolecular tags known. To elucidate how this small aptamer exhibits such properties, which make it well suited for studying low-copy cellular RNAs, we determined its 1.7-Å-resolution co-crystal structure. Unexpectedly, the entire ligand, including TO, biotin and the linker connecting them, abuts one of the near-planar faces of the three-tiered G-quadruplex. The two heterocycles of TO are held in place by two loop adenines and form a 45° angle with respect to each other. Minimizing this angle would increase quantum yield and further improve this tool for in vivo RNA visualization.
5vhe hydrolase X-ray (3.79 Å) DHX36 in complex with the c-Myc G-quadruplex; 3Dmol view (2018) "Structural basis of G-quadruplex unfolding by the DEAH/RHA helicase DHX36." Nature, 558, 465-469. pubmed Chen, M.C., Tippana, R., Demeshkina, N.A., Murat, P., Balasubramanian, S., Myong, S., Ferre-D'Amare, A.R. Guanine-rich nucleic acid sequences challenge the replication, transcription, and translation machinery by spontaneously folding into G-quadruplexes, the unfolding of which requires forces greater than most polymerases can exert1,2. Eukaryotic cells contain numerous helicases that can unfold G-quadruplexes 3 . The molecular basis of the recognition and unfolding of G-quadruplexes by helicases remains poorly understood. DHX36 (also known as RHAU and G4R1), a member of the DEAH/RHA family of helicases, binds both DNA and RNA G-quadruplexes with extremely high affinity4-6, is consistently found bound to G-quadruplexes in cells7,8, and is a major source of G-quadruplex unfolding activity in HeLa cell lysates 6 . DHX36 is a multi-functional helicase that has been implicated in G-quadruplex-mediated transcriptional and post-transcriptional regulation, and is essential for heart development, haematopoiesis, and embryogenesis in mice9-12. Here we report the co-crystal structure of bovine DHX36 bound to a DNA with a G-quadruplex and a 3' single-stranded DNA segment. We show that the N-terminal DHX36-specific motif folds into a DNA-binding-induced α-helix that, together with the OB-fold-like subdomain, selectively binds parallel G-quadruplexes. Comparison with unliganded and ATP-analogue-bound DHX36 structures, together with single-molecule fluorescence resonance energy transfer (FRET) analysis, suggests that G-quadruplex binding alone induces rearrangements of the helicase core; by pulling on the single-stranded DNA tail, these rearrangements drive G-quadruplex unfolding one residue at a time.
5w77 DNA-inhibitor NMR Complex of DNA and compounds; 3Dmol view (2018) "Chemical and structural studies provide a mechanistic basis for recognition of the MYC G-quadruplex." Nat Commun, 9, 4229-4229. pubmed Calabrese, D.R., Chen, X., Leon, E.C., Gaikwad, S.M., Phyo, Z., Hewitt, W.M., Alden, S., Hilimire, T.A., He, F., Michalowski, A.M., Simmons, J.K., Saunders, L.B., Zhang, S., Connors, D., Walters, K.J., Mock, B.A., Schneekloth Jr., J.S. G-quadruplexes (G4s) are noncanonical DNA structures that frequently occur in the promoter regions of oncogenes, such as MYC, and regulate gene expression. Although G4s are attractive therapeutic targets, ligands capable of discriminating between different G4 structures are rare. Here, we describe DC-34, a small molecule that potently downregulates MYC transcription in cancer cells by a G4-dependent mechanism. Inhibition by DC-34 is significantly greater for MYC than other G4-driven genes. We use chemical, biophysical, biological, and structural studies to demonstrate a molecular rationale for the recognition of the MYC G4. We solve the structure of the MYC G4 in complex with DC-34 by NMR spectroscopy and illustrate specific contacts responsible for affinity and selectivity. Modification of DC-34 reveals features required for G4 affinity, biological activity, and validates the derived NMR structure. This work advances the design of quadruplex-interacting small molecules to control gene expression in therapeutic areas such as cancer.
5yey DNA NMR The structure of a chair-type G-quadruplex of the human telomeric variant in K+ solution; 3Dmol view (2019) "A chair-type G-quadruplex structure formed by a human telomeric variant DNA in K+solution." Chem Sci, 10, 218-226. pubmed Liu, C., Zhou, B., Geng, Y., Yan Tam, D., Feng, R., Miao, H., Xu, N., Shi, X., You, Y., Hong, Y., Tang, B.Z., Kwan Lo, P., Kuryavyi, V., Zhu, G. Guanine tracts of human telomeric DNA sequences are known to fold into eight different four-stranded structures that vary by the conformation of guanine nucleotides arranged in the stack of G-tetrads in their core and by different kinds and orders of connecting loops, called G-quadruplexes. Here, we present a novel G-quadruplex structure formed in K+ solution by a human telomeric variant d[(GGGTTA)2GGGTTTGGG], htel21T18. This variant DNA is located in the subtelomeric regions of human chromosomes 8, 11, 17, and 19 as well as in the DNase hypersensitive region and in the subcentromeric region of chromosome 5. Interestingly, single A18T substitution that makes htel21T18 different from the human telomeric sequence results in the formation of a three-layer chair-type G-quadruplex, a fold previously unknown among human telomeric repeats, with two loops interacting through the reverse Watson-Crick A6·T18 base pair. The loops are edgewise; glycosidic conformation of guanines is syn·anti·syn·anti around each tetrad, and each strand of the core has two antiparallel adjacent strands. Our results expand the repertoire of known G-quadruplex folding topologies and may provide a potential target for structure-based anticancer drug design.
5z80 DNA NMR Solution structure for the 1:1 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex; 3Dmol view (2018) "Solution structures of multiple G-quadruplex complexes induced by a platinum(II)-based tripod reveal dynamic binding." Nat Commun, 9, 3496-3496. pubmed Liu, W., Zhong, Y.F., Liu, L.Y., Shen, C.T., Zeng, W., Wang, F., Yang, D., Mao, Z.W. DNA G-quadruplexes are not only attractive drug targets for cancer therapeutics, but also have important applications in supramolecular assembly. Here, we report a platinum(II)-based tripod (Pt-tripod) specifically binds the biological relevant hybrid-1 human telomeric G-quadruplex (Tel26), and strongly inhibits telomerase activity. Further investigations illustrate Pt-tripod induces the formation of monomeric and multimeric Pt-tripod‒Tel26 complex structures in solution. We solve the 1:1 and the unique dimeric 4:2 Pt-tripod-Tel26 complex structures by NMR. The structures indicate preferential binding of Pt-tripod to the 5'-end of Tel26 at a low Pt-tripod/Tel26 ratio of 0-1.0. After adding more Pt-tripod, the Pt-tripod binds the 3'-end of Tel26, unexpectedly inducing a unique dimeric 4:2 structure interlocked by an A:A non-canonical pair at the 3'-end. Our structures provide a structural basis for understanding the dynamic binding of small molecules with G-quadruplex and DNA damage mechanisms, and insights into the recognition and assembly of higher-order G-quadruplexes.
5z8f DNA NMR Solution structure for the unique dimeric 4:2 complex of a platinum(II)-based tripod bound to a hybrid-1 human telomeric G-quadruplex; 3Dmol view (2018) "Solution structures of multiple G-quadruplex complexes induced by a platinum(II)-based tripod reveal dynamic binding." Nat Commun, 9, 3496-3496. pubmed Liu, W., Zhong, Y.F., Liu, L.Y., Shen, C.T., Zeng, W., Wang, F., Yang, D., Mao, Z.W. DNA G-quadruplexes are not only attractive drug targets for cancer therapeutics, but also have important applications in supramolecular assembly. Here, we report a platinum(II)-based tripod (Pt-tripod) specifically binds the biological relevant hybrid-1 human telomeric G-quadruplex (Tel26), and strongly inhibits telomerase activity. Further investigations illustrate Pt-tripod induces the formation of monomeric and multimeric Pt-tripod‒Tel26 complex structures in solution. We solve the 1:1 and the unique dimeric 4:2 Pt-tripod-Tel26 complex structures by NMR. The structures indicate preferential binding of Pt-tripod to the 5'-end of Tel26 at a low Pt-tripod/Tel26 ratio of 0-1.0. After adding more Pt-tripod, the Pt-tripod binds the 3'-end of Tel26, unexpectedly inducing a unique dimeric 4:2 structure interlocked by an A:A non-canonical pair at the 3'-end. Our structures provide a structural basis for understanding the dynamic binding of small molecules with G-quadruplex and DNA damage mechanisms, and insights into the recognition and assembly of higher-order G-quadruplexes.
5zev DNA NMR Solution structure of G-quadruplex formed in vegfr-2 proximal promoter sequence; 3Dmol view (2018) "A putative G-quadruplex structure in the proximal promoter ofVEGFR-2has implications for drug design to inhibit tumor angiogenesis." J. Biol. Chem., 293, 8947-8955. pubmed Liu, Y., Lan, W., Wang, C., Cao, C. Tumor angiogenesis is mainly regulated by vascular endothelial growth factor (VEGF) produced by cancer cells. It is active on the endothelium via VEGF receptor 2 (VEGFR-2). G-quadruplexes are DNA secondary structures formed by guanine-rich sequences, for example, within gene promoters where they may contribute to transcriptional activity. The proximal promoter of VEGFR-2 contains a G-quadruplex, which has been suggested to interact with small molecules that inhibit VEGFR-2 expression and thereby tumor angiogenesis. However, its structure is not known. Here, we determined its NMR solution structure, which is composed of three stacked G-tetrads containing three syn guanines. The first guanine (G1) is positioned within the central G-tetrad. We also observed that a noncanonical, V-shaped loop spans three G-tetrad planes, including no bridging nucleotides. A long and diagonal loop, which includes six nucleotides, connects reversal double chains. With a melting temperature of 54.51 °C, the scaffold of this quadruplex is stabilized by one G-tetrad plane stacking with one nonstandard bp, G3-C8, whose bases interact with each other through only one hydrogen bond. In summary, the NMR solution structure of the G-quadruplex in the proximal promoter region of the VEGFR-2 gene reported here has uncovered its key features as a potential anticancer drug target.
6a7y DNA NMR Solution structure of an intermolecular leaped V-shape G-quadruplex; 3Dmol view (2019) "NMR solution structure of an asymmetric intermolecular leaped V-shape G-quadruplex: selective recognition of the d(G2NG3NG4) sequence motif by a short linear G-rich DNA probe." Nucleic Acids Res., 47, 1544-1556. pubmed Wan, C., Fu, W., Jing, H., Zhang, N. Aside from classical loops among G-quadruplexes, the unique leaped V-shape scaffold spans over three G-tetrads, without any intervening residues. This scaffold enables a sharp reversal of two adjacent strand directions and simultaneously participates in forming the G-tetrad core. These features make this scaffold itself distinctive and thus an essentially more accessible target. As an alternative to the conventional antisense method using a complementary chain, forming an intermolecular G-quadruplex from two different oligomers, in which the longer one as the target is captured by a short G-rich fragment, could be helpful for recognizing G-rich sequences and structural motifs. However, such an intermolecular leaped V-shape G-quadruplex consisting of DNA oligomers of quite different lengths has not been evaluated. Here, we present the first nuclear magnetic resonance (NMR) study of an asymmetric intermolecular leaped V-shape G-quadruplex assembled between an Oxytricha nova telomeric sequence d(G2T4G4T4G4) and a single G-tract fragment d(TG4A). Furthermore, we explored the selectivity of this short fragment as a potential probe, examined the kinetic discrimination for probing a specific mutant, and proposed the key sequence motif d(G2NG3NG4) essential for building the leaped V-shape G-quadruplexes.
6a85 DNA X-ray (1.45 Å) Crystal structure of a novel DNA quadruplex; 3Dmol view (2018) "High-resolution DNA quadruplex structure containing all the A-, G-, C-, T-tetrads." Nucleic Acids Res., 46, 11627-11638. pubmed Liu, H.H., Wang, R., Yu, X., Shen, F.S., Lan, W.X., Haruehanroengra, P., Yao, Q.Q., Zhang, J., Chen, Y.Q., Li, S.H., Wu, B.X., Zheng, L.N., Ma, J.B., Lin, J.Z., Cao, C.Y., Li, J.X., Sheng, J., Gan, J.H. DNA can form diverse structures, which predefine their physiological functions. Besides duplexes that carry the genetic information, quadruplexes are the most well-studied DNA structures. In addition to their important roles in recombination, replication, transcription and translation, DNA quadruplexes have also been applied as diagnostic aptamers and antidisease therapeutics. Herein we further expand the sequence and structure complexity of DNA quadruplex by presenting a high-resolution crystal structure of DNA1 (5'-AGAGAGATGGGTGCGTT-3'). This is the first quadruplex structure that contains all the internal A-, G-, C-, T-tetrads, A:T:A:T tetrads and bulged nucleotides in one single structure; as revealed by site-specific mutagenesis and biophysical studies, the central ATGGG motif plays important role in the quadruplex formation. Interestingly, our structure also provides great new insights into cation recognition, including the first-time reported Pb2+, by tetrad structures.
6ac7 DNA NMR Structure of a (3+1) hybrid G-quadruplex in the PARP1 promoter; 3Dmol view (2019) "Structure of a (3+1) hybrid G-quadruplex in the PARP1 promoter." Nucleic Acids Res., 47, 1564-1572. pubmed Sengar, A., Vandana, J.J., Chambers, V.S., Di Antonio, M., Winnerdy, F.R., Balasubramanian, S., Phan, A.T. Poly (ADP-ribose) polymerase 1 (PARP1) has emerged as an attractive target for cancer therapy due to its key role in DNA repair processes. Inhibition of PARP1 in BRCA-mutated cancers has been observed to be clinically beneficial. Recent genome-mapping experiments have identified a non-canonical G-quadruplex-forming sequence containing bulges within the PARP1 promoter. Structural features, like bulges, provide opportunities for selective chemical targeting of the non-canonical G-quadruplex structure within the PARP1 promoter, which could serve as an alternative therapeutic approach for the regulation of PARP1 expression. Here we report the G-quadruplex structure formed by a 23-nucleotide G-rich sequence in the PARP1 promoter. Our study revealed a three-layered intramolecular (3+1) hybrid G-quadruplex scaffold, in which three strands are oriented in one direction and the fourth in the opposite direction. This structure exhibits unique structural features such as an adenine bulge and a G·G·T base triple capping structure formed between the central edgewise loop, propeller loop and 5' flanking terminal. Given the highly important role of PARP1 in DNA repair and cancer intervention, this structure presents an attractive opportunity to explore the therapeutic potential of PARP1 inhibition via G-quadruplex DNA targeting.
6au4 DNA X-ray (2.35 Å) Crystal structure of the major quadruplex formed in the human c-MYC promoter; 3Dmol view (2018) "Crystal structure of the major quadruplex formed in the promoter region of the human c-MYC oncogene." PLoS ONE, 13, e0205584-e0205584. pubmed Stump, S., Mou, T.C., Sprang, S.R., Natale, N.R., Beall, H.D. The c-MYC oncogene mediates multiple tumor cell survival pathways and is dysregulated or overexpressed in the majority of human cancers. The NHE III1 region of the c-MYC promoter forms a DNA quadruplex. Stabilization of this structure with small molecules has been shown to reduce expression of c-MYC, and targeting the c-MYC quadruplex has become an emerging strategy for development of antitumor compounds. Previous solution NMR studies of the c-MYC quadruplex have assigned the major conformer and topology of this important target, however, regions outside the G-quartet core were not as well-defined. Here, we report a high-resolution crystal structure (2.35 Å) of the major quadruplex formed in the NHE III1 region of the c-MYC promoter. The crystal structure is in general agreement with the solution NMR structure, however, key differences are observed in the position of nucleotides outside the G-quartet core. The crystal structure provides an alternative model that, along with comparisons to other reported quadruplex crystal structures, will be important to the rational design of selective compounds. This work will aid in development of ligands to target the c-MYC promoter quadruplex with the goal of creating novel anticancer therapies.
6b14 immune system-RNA X-ray (1.64 Å) Crystal structure of Spinach RNA aptamer in complex with Fab BL3-6S97N; 3Dmol view (2018) "Affinity maturation of a portable Fab-RNA module for chaperone-assisted RNA crystallography." Nucleic Acids Res., 46, 2624-2635. pubmed Koirala, D., Shelke, S.A., Dupont, M., Ruiz, S., DasGupta, S., Bailey, L.J., Benner, S.A., Piccirilli, J.A. Antibody fragments such as Fabs possess properties that can enhance protein and RNA crystallization and therefore can facilitate macromolecular structure determination. In particular, Fab BL3-6 binds to an AAACA RNA pentaloop closed by a GC pair with ∼100 nM affinity. The Fab and hairpin have served as a portable module for RNA crystallization. The potential for general application make it desirable to adjust the properties of this crystallization module in a manner that facilitates its use for RNA structure determination, such as ease of purification, surface entropy or binding affinity. In this work, we used both in vitro RNA selection and phage display selection to alter the epitope and paratope sides of the binding interface, respectively, for improved binding affinity. We identified a 5'-GNGACCC-3' consensus motif in the RNA and S97N mutation in complimentarity determining region L3 of the Fab that independently impart about an order of magnitude improvement in affinity, resulting from new hydrogen bonding interactions. Using a model RNA, these modifications facilitated crystallization under a wider range of conditions and improved diffraction. The improved features of the Fab-RNA module may facilitate its use as an affinity tag for RNA purification and imaging and as a chaperone for RNA crystallography.
6b3k immune system-RNA X-ray (2.09 Å) Crystal structure of mutant Spinach RNA aptamer in complex with Fab BL3-6; 3Dmol view (2018) "Affinity maturation of a portable Fab-RNA module for chaperone-assisted RNA crystallography." Nucleic Acids Res., 46, 2624-2635. pubmed Koirala, D., Shelke, S.A., Dupont, M., Ruiz, S., DasGupta, S., Bailey, L.J., Benner, S.A., Piccirilli, J.A. Antibody fragments such as Fabs possess properties that can enhance protein and RNA crystallization and therefore can facilitate macromolecular structure determination. In particular, Fab BL3-6 binds to an AAACA RNA pentaloop closed by a GC pair with ∼100 nM affinity. The Fab and hairpin have served as a portable module for RNA crystallization. The potential for general application make it desirable to adjust the properties of this crystallization module in a manner that facilitates its use for RNA structure determination, such as ease of purification, surface entropy or binding affinity. In this work, we used both in vitro RNA selection and phage display selection to alter the epitope and paratope sides of the binding interface, respectively, for improved binding affinity. We identified a 5'-GNGACCC-3' consensus motif in the RNA and S97N mutation in complimentarity determining region L3 of the Fab that independently impart about an order of magnitude improvement in affinity, resulting from new hydrogen bonding interactions. Using a model RNA, these modifications facilitated crystallization under a wider range of conditions and improved diffraction. The improved features of the Fab-RNA module may facilitate its use as an affinity tag for RNA purification and imaging and as a chaperone for RNA crystallography.
6c63 RNA X-ray (2.9 Å) Crystal Structure of the Mango-II Fluorescent Aptamer Bound to TO1-Biotin; 3Dmol view (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. pubmed Trachman 3rd., R.J., Abdolahzadeh, A., Andreoni, A., Cojocaru, R., Knutson, J.R., Ryckelynck, M., Unrau, P.J., Ferre-D'Amare, A.R. Several RNA aptamers that bind small molecules and enhance their fluorescence have been successfully used to tag and track RNAs in vivo, but these genetically encodable tags have not yet achieved single-fluorophore resolution. Recently, Mango-II, an RNA that binds TO1-Biotin with ∼1 nM affinity and enhances its fluorescence by >1500-fold, was isolated by fluorescence selection from the pool that yielded the original RNA Mango. We determined the crystal structures of Mango-II in complex with two fluorophores, TO1-Biotin and TO3-Biotin, and found that despite their high affinity, the ligands adopt multiple distinct conformations, indicative of a binding pocket with modest stereoselectivity. Mutational analysis of the binding site led to Mango-II(A22U), which retains high affinity for TO1-Biotin but now discriminates >5-fold against TO3-biotin. Moreover, fluorescence enhancement of TO1-Biotin increases by 18%, while that of TO3-Biotin decreases by 25%. Crystallographic, spectroscopic, and analogue studies show that the A22U mutation improves conformational homogeneity and shape complementarity of the fluorophore-RNA interface. Our work demonstrates that even after extensive functional selection, aptamer RNAs can be further improved through structure-guided engineering.
6c64 RNA X-ray (3.0 Å) Crystal Structure of the Mango-II Fluorescent Aptamer Bound to TO3-Biotin; 3Dmol view (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. pubmed Trachman 3rd., R.J., Abdolahzadeh, A., Andreoni, A., Cojocaru, R., Knutson, J.R., Ryckelynck, M., Unrau, P.J., Ferre-D'Amare, A.R. Several RNA aptamers that bind small molecules and enhance their fluorescence have been successfully used to tag and track RNAs in vivo, but these genetically encodable tags have not yet achieved single-fluorophore resolution. Recently, Mango-II, an RNA that binds TO1-Biotin with ∼1 nM affinity and enhances its fluorescence by >1500-fold, was isolated by fluorescence selection from the pool that yielded the original RNA Mango. We determined the crystal structures of Mango-II in complex with two fluorophores, TO1-Biotin and TO3-Biotin, and found that despite their high affinity, the ligands adopt multiple distinct conformations, indicative of a binding pocket with modest stereoselectivity. Mutational analysis of the binding site led to Mango-II(A22U), which retains high affinity for TO1-Biotin but now discriminates >5-fold against TO3-biotin. Moreover, fluorescence enhancement of TO1-Biotin increases by 18%, while that of TO3-Biotin decreases by 25%. Crystallographic, spectroscopic, and analogue studies show that the A22U mutation improves conformational homogeneity and shape complementarity of the fluorophore-RNA interface. Our work demonstrates that even after extensive functional selection, aptamer RNAs can be further improved through structure-guided engineering.
6c65 RNA X-ray (2.8 Å) Crystal Structure of the Mango-II-A22U Fluorescent Aptamer Bound to TO1-Biotin; 3Dmol view (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. pubmed Trachman 3rd., R.J., Abdolahzadeh, A., Andreoni, A., Cojocaru, R., Knutson, J.R., Ryckelynck, M., Unrau, P.J., Ferre-D'Amare, A.R. Several RNA aptamers that bind small molecules and enhance their fluorescence have been successfully used to tag and track RNAs in vivo, but these genetically encodable tags have not yet achieved single-fluorophore resolution. Recently, Mango-II, an RNA that binds TO1-Biotin with ∼1 nM affinity and enhances its fluorescence by >1500-fold, was isolated by fluorescence selection from the pool that yielded the original RNA Mango. We determined the crystal structures of Mango-II in complex with two fluorophores, TO1-Biotin and TO3-Biotin, and found that despite their high affinity, the ligands adopt multiple distinct conformations, indicative of a binding pocket with modest stereoselectivity. Mutational analysis of the binding site led to Mango-II(A22U), which retains high affinity for TO1-Biotin but now discriminates >5-fold against TO3-biotin. Moreover, fluorescence enhancement of TO1-Biotin increases by 18%, while that of TO3-Biotin decreases by 25%. Crystallographic, spectroscopic, and analogue studies show that the A22U mutation improves conformational homogeneity and shape complementarity of the fluorophore-RNA interface. Our work demonstrates that even after extensive functional selection, aptamer RNAs can be further improved through structure-guided engineering.
6ccw DNA NMR Hybrid-2 form Human Telomeric G Quadruplex in Complex with Epiberberine; 3Dmol view (2018) "Molecular Recognition of the Hybrid-2 Human Telomeric G-Quadruplex by Epiberberine: Insights into Conversion of Telomeric G-Quadruplex Structures." Angew. Chem. Int. Ed. Engl., 57, 10888-10893. pubmed Lin, C., Wu, G., Wang, K., Onel, B., Sakai, S., Shao, Y., Yang, D. Human telomeres can form DNA G-quadruplex (G4), an attractive target for anticancer drugs. Human telomeric G4s bear inherent structure polymorphism, challenging for understanding specific recognition by ligands or proteins. Protoberberines are medicinal natural-products known to stabilize telomeric G4s and inhibit telomerase. Here we report epiberberine (EPI) specifically recognizes the hybrid-2 telomeric G4 predominant in physiologically relevant K+ solution and converts other telomeric G4 forms to hybrid-2, the first such example reported. Our NMR structure in K+ solution shows EPI binding induces extensive rearrangement of the previously disordered 5'-flanking and loop segments to form an unprecedented four-layer binding pocket specific to the hybrid-2 telomeric G4; EPI recruits the (-1) adenine to form a "quasi-triad" intercalated between the external tetrad and a T:T:A triad, capped by a T:T base pair. Our study provides structural basis for small-molecule drug design targeting the human telomeric G4.
6e8s RNA X-ray (2.35 Å) Structure of the iMango-III aptamer bound to TO1-Biotin; 3Dmol view (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. pubmed Trachman 3rd., R.J., Autour, A., Jeng, S.C.Y., Abdolahzadeh, A., Andreoni, A., Cojocaru, R., Garipov, R., Dolgosheina, E.V., Knutson, J.R., Ryckelynck, M., Unrau, P.J., Ferre-D'Amare, A.R. Several turn-on RNA aptamers that activate small-molecule fluorophores have been selected in vitro. Among these, the ~30 nucleotide Mango-III is notable because it binds the thiazole orange derivative TO1-Biotin with high affinity and fluoresces brightly (quantum yield 0.55). Uniquely among related aptamers, Mango-III exhibits biphasic thermal melting, characteristic of molecules with tertiary structure. We report crystal structures of TO1-Biotin complexes of Mango-III, a structure-guided mutant Mango-III(A10U), and a functionally reselected mutant iMango-III. The structures reveal a globular architecture arising from an unprecedented pseudoknot-like connectivity between a G-quadruplex and an embedded non-canonical duplex. The fluorophore is restrained into a planar conformation by the G-quadruplex, a lone, long-range trans Watson-Crick pair (whose A10U mutation increases quantum yield to 0.66), and a pyrimidine perpendicular to the nucleobase planes of those motifs. The improved iMango-III and Mango-III(A10U) fluoresce ~50% brighter than enhanced green fluorescent protein, making them suitable tags for live cell RNA visualization.
6e8t RNA X-ray (2.9 Å) Structure of the Mango-III (A10U) aptamer bound to TO1-Biotin; 3Dmol view (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. pubmed Trachman 3rd., R.J., Autour, A., Jeng, S.C.Y., Abdolahzadeh, A., Andreoni, A., Cojocaru, R., Garipov, R., Dolgosheina, E.V., Knutson, J.R., Ryckelynck, M., Unrau, P.J., Ferre-D'Amare, A.R. Several turn-on RNA aptamers that activate small-molecule fluorophores have been selected in vitro. Among these, the ~30 nucleotide Mango-III is notable because it binds the thiazole orange derivative TO1-Biotin with high affinity and fluoresces brightly (quantum yield 0.55). Uniquely among related aptamers, Mango-III exhibits biphasic thermal melting, characteristic of molecules with tertiary structure. We report crystal structures of TO1-Biotin complexes of Mango-III, a structure-guided mutant Mango-III(A10U), and a functionally reselected mutant iMango-III. The structures reveal a globular architecture arising from an unprecedented pseudoknot-like connectivity between a G-quadruplex and an embedded non-canonical duplex. The fluorophore is restrained into a planar conformation by the G-quadruplex, a lone, long-range trans Watson-Crick pair (whose A10U mutation increases quantum yield to 0.66), and a pyrimidine perpendicular to the nucleobase planes of those motifs. The improved iMango-III and Mango-III(A10U) fluoresce ~50% brighter than enhanced green fluorescent protein, making them suitable tags for live cell RNA visualization.
6e8u RNA X-ray (1.55 Å) Structure of the Mango-III (A10U) aptamer bound to TO1-Biotin; 3Dmol view (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. pubmed Trachman 3rd., R.J., Autour, A., Jeng, S.C.Y., Abdolahzadeh, A., Andreoni, A., Cojocaru, R., Garipov, R., Dolgosheina, E.V., Knutson, J.R., Ryckelynck, M., Unrau, P.J., Ferre-D'Amare, A.R. Several turn-on RNA aptamers that activate small-molecule fluorophores have been selected in vitro. Among these, the ~30 nucleotide Mango-III is notable because it binds the thiazole orange derivative TO1-Biotin with high affinity and fluoresces brightly (quantum yield 0.55). Uniquely among related aptamers, Mango-III exhibits biphasic thermal melting, characteristic of molecules with tertiary structure. We report crystal structures of TO1-Biotin complexes of Mango-III, a structure-guided mutant Mango-III(A10U), and a functionally reselected mutant iMango-III. The structures reveal a globular architecture arising from an unprecedented pseudoknot-like connectivity between a G-quadruplex and an embedded non-canonical duplex. The fluorophore is restrained into a planar conformation by the G-quadruplex, a lone, long-range trans Watson-Crick pair (whose A10U mutation increases quantum yield to 0.66), and a pyrimidine perpendicular to the nucleobase planes of those motifs. The improved iMango-III and Mango-III(A10U) fluoresce ~50% brighter than enhanced green fluorescent protein, making them suitable tags for live cell RNA visualization.
6eo6 hydrolase-DNA X-ray (1.69 Å) X-ray structure of the complex between human alpha-thrombin and modified 15-mer DNA aptamer containing 5-(3-(2-(1H-indol-3-yl)acetamide-N-yl)-1-propen-1-yl)-2'-deoxyuridine residue; 3Dmol view (2018) "Crystal structures of thrombin in complex with chemically modified thrombin DNA aptamers reveal the origins of enhanced affinity." Nucleic Acids Res., 46, 4819-4830. pubmed Dolot, R., Lam, C.H., Sierant, M., Zhao, Q., Liu, F.W., Nawrot, B., Egli, M., Yang, X. Thrombin-binding aptamer (TBA) is a DNA 15-mer of sequence 5'-GGT TGG TGT GGT TGG-3' that folds into a G-quadruplex structure linked by two T-T loops located on one side and a T-G-T loop on the other. These loops are critical for post-SELEX modification to improve TBA target affinity. With this goal in mind we synthesized a T analog, 5-(indolyl-3-acetyl-3-amino-1-propenyl)-2'-deoxyuridine (W) to substitute one T or a pair of Ts. Subsequently, the affinity for each analog was determined by biolayer interferometry. An aptamer with W at position 4 exhibited about 3-fold increased binding affinity, and replacing both T4 and T12 with W afforded an almost 10-fold enhancement compared to native TBA. To better understand the role of the substituent's aromatic moiety, an aptamer with 5-(methyl-3-acetyl-3-amino-1-propenyl)-2'-deoxyuridine (K; W without the indole moiety) in place of T4 was also synthesized. This K4 aptamer was found to improve affinity 7-fold relative to native TBA. Crystal structures of aptamers with T4 replaced by either W or K bound to thrombin provide insight into the origins of the increased affinities. Our work demonstrates that facile chemical modification of a simple DNA aptamer can be used to significantly improve its binding affinity for a well-established pharmacological target protein.
6eo7 hydrolase-DNA X-ray (2.24 Å) X-ray structure of the complex between human alpha-thrombin and modified 15-mer DNA aptamer containing 5-(3-(acetamide-N-yl)-1-propen-1-yl)-2'-deoxyuridine residue; 3Dmol view (2018) "Crystal structures of thrombin in complex with chemically modified thrombin DNA aptamers reveal the origins of enhanced affinity." Nucleic Acids Res., 46, 4819-4830. pubmed Dolot, R., Lam, C.H., Sierant, M., Zhao, Q., Liu, F.W., Nawrot, B., Egli, M., Yang, X. Thrombin-binding aptamer (TBA) is a DNA 15-mer of sequence 5'-GGT TGG TGT GGT TGG-3' that folds into a G-quadruplex structure linked by two T-T loops located on one side and a T-G-T loop on the other. These loops are critical for post-SELEX modification to improve TBA target affinity. With this goal in mind we synthesized a T analog, 5-(indolyl-3-acetyl-3-amino-1-propenyl)-2'-deoxyuridine (W) to substitute one T or a pair of Ts. Subsequently, the affinity for each analog was determined by biolayer interferometry. An aptamer with W at position 4 exhibited about 3-fold increased binding affinity, and replacing both T4 and T12 with W afforded an almost 10-fold enhancement compared to native TBA. To better understand the role of the substituent's aromatic moiety, an aptamer with 5-(methyl-3-acetyl-3-amino-1-propenyl)-2'-deoxyuridine (K; W without the indole moiety) in place of T4 was also synthesized. This K4 aptamer was found to improve affinity 7-fold relative to native TBA. Crystal structures of aptamers with T4 replaced by either W or K bound to thrombin provide insight into the origins of the increased affinities. Our work demonstrates that facile chemical modification of a simple DNA aptamer can be used to significantly improve its binding affinity for a well-established pharmacological target protein.
6erl DNA NMR Quadruplex with flipped tetrad formed by the c-myc promoter sequence; 3Dmol view (2018) "Loop Length Affects Syn-Anti Conformational Rearrangements in Parallel G-Quadruplexes." Chemistry pubmed Karg, B., Weisz, K. A G-quadruplex forming sequence from the MYC promoter region was modified with syn-favoring 8-bromo-2'-deoxyguanosine residues. Depending on the number and position of modifications in the intramolecular parallel G-quadruplex, substitutions with the bromoguanosine analogue at the 5'-tetrad induce conformational rearrangements with concerted all-anti to all-syn transitions for all residues of the modified G-quartet. No unfavorable steric interactions of the C8-substituents in the medium grooves are apparent in the high-resolution structure as determined for a tetrasubstituted MYC quadruplex that exclusively forms the all-syn isomer. In contrast, considerable steric clashes with 5'-phosphate oxygen atoms for those analogues that follow a less flexible 1-nucleotide loop in the native all-anti conformation seem to constitute the major driving force for the tetrad inversion and allow for the rational design of appropriately substituted sequences. Correlations found between the population of species subjected to a tetrad flip and melting temperatures indicate that more effective conformational transitions are compromised by lower thermal stabilities of the modified parallel quadruplexes.
6evv hydrolase X-ray (2.5 Å) X-ray structure of the complex between human alpha thrombin and NU172, a duplex/quadruplex 26-mer DNA aptamer, in the presence of potassium ions.; 3Dmol view (2018) "Several structural motifs cooperate in determining the highly effective anti-thrombin activity of NU172 aptamer." Nucleic Acids Res., 46, 12177-12185. pubmed Troisi, R., Napolitano, V., Spiridonova, V., Russo Krauss, I., Sica, F. Despite aptamers are very promising alternative to antibodies, very few of them are under clinical trials or are used as drugs. Among them, NU172 is currently in Phase II as anticoagulant in heart disease treatments. It inhibits thrombin activity much more effectively than TBA, the best-known thrombin binding aptamer. The crystal structure of thrombin-NU172 complex reveals a bimodular duplex/quadruplex architecture for the aptamer, which binds thrombin exosite I through a highly complementary surface involving all three loops of the G-quadruplex module. Although the duplex domain does not interact directly with thrombin, the features of the duplex/quadruplex junction and the solution data on two newly designed NU172 mutants indicate that the duplex moiety is important for the optimization of the protein-ligand interaction and for the inhibition of the enzyme activity. Our work discloses the structural features determining the inhibition of thrombin by NU172 and put the basis for the design of mutants with improved properties.
6f4z DNA NMR 2'F-araG modified quadruplex with flipped G-tract and central tetrad; 3Dmol view (2018) "Fluorine-Mediated Editing of a G-Quadruplex Folding Pathway." Chembiochem, 19, 927-930. pubmed Dickerhoff, J., Weisz, K. A (3+1)-hybrid-type G-quadruplex was substituted within its central tetrad by a single 2'-fluoro-modified guanosine. Driven by the anti-favoring nucleoside analogue, a novel quadruplex fold with inversion of a single G-tract and conversion of a propeller loop into a lateral loop emerges. In addition, scalar couplings across hydrogen bonds demonstrate the formation of intra- and inter-residual F⋅⋅⋅H8-C8 pseudo-hydrogen bonds within the modified quadruplexes. Alternative folding can be rationalized by the impact of fluorine on intermediate species on the basis of a kinetic partitioning mechanism. Apparently, chemical or other environmental perturbations are able to redirect folding of a quadruplex, possibly modulating its regulatory role in physiological processes.
6fc9 DNA NMR The 1,8-bis(aminomethyl)anthracene and Quadruplex-duplex junction complex; 3Dmol view "Minimalistic scaffolds for the selective recognition of Quad-ruplex-Duplex Junctions: Targeting the G4 Hot-Spot." To Be Published Santana, A., Serrano, I., Montalvillo-Jimenez, L., Corzana, F., Bastida, A., Jimenez-Barbero, J., Gonzalez, C., Asensio, J.L.
6ffr DNA-RNA hybrid NMR DNA-RNA Hybrid Quadruplex with Flipped Tetrad; 3Dmol view (2018) "DNA-RNA Hybrid Quadruplexes Reveal Interactions that Favor RNA Parallel Topologies." Chemistry, 24, 15365-15371. pubmed Haase, L., Dickerhoff, J., Weisz, K. A DNA G-quadruplex adopting a (3+1)-hybrid structure was substituted at its 5'-tetrad by riboguanosine (rG) analogs. Incorporation of anti-favoring rG at appropriate syn-positions of the 5'-outer tetrad induced conformational rearrangements to yield a quadruplex featuring a 5'-tetrad with reversed polarity. A high-resolution structure of a disubstituted quadruplex variant as well as direct NMR experimental evidence reveals a non-conventional C-H⋅⋅⋅O hydrogen bond in a medium groove between the 2'-OH of an rG residue adopting a C2'-endo sugar pucker and H8 of a 3'-neighboring anti-G residue. In contrast, a C3'-endo sugar conformation for another guanine ribonucleotide prevents formation of a corresponding hydrogen bond but relocates its 2'-OH substituent from the quadruplex narrow groove into a medium groove. Both the formation of favorable CHO hydrogen bridges and unfavorable interactions of the 2'-hydroxyl group in a narrow groove will promote RNA folding into a parallel topology featuring all-anti core residues and four grooves of medium size.
6fq2 DNA X-ray (2.31 Å) Structure of minimal sequence for left -handed G-quadruplex formation; 3Dmol view (2019) "A Minimal Sequence for Left-Handed G-Quadruplex Formation." Angew. Chem. Int. Ed. Engl., 58, 2331-2335. pubmed Bakalar, B., Heddi, B., Schmitt, E., Mechulam, Y., Phan, A.T. Recently, we observed the first example of a left-handed G-quadruplex structure formed by natural DNA, named Z-G4. We analysed the Z-G4 structure and inspected its primary 28-nt sequence in order to identify motifs that convey the unique left-handed twist. Using circular dichroism spectroscopy, NMR spectroscopy, and X-ray crystallography, we revealed a minimal sequence motif of 12 nt (GTGGTGGTGGTG) for formation of the left-handed DNA G-quadruplex, which is found to be highly abundant in the human genome. A systematic analysis of thymine loop mutations revealed a moderate sequence tolerance, which would further broaden the space of sequences prone to left-handed G-quadruplex formation.
6ftu DNA X-ray (2.95 Å) Structure of a Quadruplex forming sequence from D. discoideum; 3Dmol view (2018) "Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome." Nucleic Acids Res., 46, 5297-5307. pubmed Guedin, A., Lin, L.Y., Armane, S., Lacroix, L., Mergny, J.L., Thore, S., Yatsunyk, L.A. Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.
6ge1 RNA NMR Solution structure of the r(UGGUGGU)4 RNA quadruplex; 3Dmol view (2019) "Unraveling the structural basis for the exceptional stability of RNA G-quadruplexes capped by a uridine tetrad at the 3' terminus." RNA, 25, 121-134. pubmed Andralojc, W., Malgowska, M., Sarzynska, J., Pasternak, K., Szpotkowski, K., Kierzek, R., Gdaniec, Z. Uridine tetrads (U-tetrads) are a structural element encountered in RNA G-quadruplexes, for example, in the structures formed by the biologically relevant human telomeric repeat RNA. For these molecules, an unexpectedly strong stabilizing influence of a U-tetrad forming at the 3' terminus of a quadruplex was reported. Here we present the high-resolution solution NMR structure of the r(UGGUGGU)4 quadruplex which, in our opinion, provides an explanation for this stabilization. Our structure features a distinctive, abrupt chain reversal just prior to the 3' uridine tetrad. Similar "reversed U-tetrads" were already observed in the crystalline phase. However, our NMR structure coupled with extensive explicit solvent molecular dynamics (MD) simulations identifies some key features of this motif that up to now remained overlooked. These include the presence of an exceptionally stable 2'OH to phosphate hydrogen bond, as well as the formation of an additional K+ binding pocket in the quadruplex groove.
6gh0 DNA NMR Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure; 3Dmol view (2019) "Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure." Nucleic Acids Res., 47, 2641-2653. pubmed Kotar, A., Rigo, R., Sissi, C., Plavec, J. In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.
6gn7 hydrolase X-ray (2.8 Å) X-ray structure of the complex between human alpha thrombin and NU172, a duplex/quadruplex 26-mer DNA aptamer, in the presence of sodium ions.; 3Dmol view (2018) "Several structural motifs cooperate in determining the highly effective anti-thrombin activity of NU172 aptamer." Nucleic Acids Res., 46, 12177-12185. pubmed Troisi, R., Napolitano, V., Spiridonova, V., Russo Krauss, I., Sica, F. Despite aptamers are very promising alternative to antibodies, very few of them are under clinical trials or are used as drugs. Among them, NU172 is currently in Phase II as anticoagulant in heart disease treatments. It inhibits thrombin activity much more effectively than TBA, the best-known thrombin binding aptamer. The crystal structure of thrombin-NU172 complex reveals a bimodular duplex/quadruplex architecture for the aptamer, which binds thrombin exosite I through a highly complementary surface involving all three loops of the G-quadruplex module. Although the duplex domain does not interact directly with thrombin, the features of the duplex/quadruplex junction and the solution data on two newly designed NU172 mutants indicate that the duplex moiety is important for the optimization of the protein-ligand interaction and for the inhibition of the enzyme activity. Our work discloses the structural features determining the inhibition of thrombin by NU172 and put the basis for the design of mutants with improved properties.
6gz6 DNA X-ray (2.01 Å) Structure of a left-handed G-quadruplex; 3Dmol view (2019) "A Minimal Sequence for Left-Handed G-Quadruplex Formation." Angew.Chem.Int.Ed.Engl., 58, 2331-2335. pubmed Bakalar, B., Heddi, B., Schmitt, E., Mechulam, Y., Phan, A.T. Recently, we observed the first example of a left-handed G-quadruplex structure formed by natural DNA, named Z-G4. We analysed the Z-G4 structure and inspected its primary 28-nt sequence in order to identify motifs that convey the unique left-handed twist. Using circular dichroism spectroscopy, NMR spectroscopy, and X-ray crystallography, we revealed a minimal sequence motif of 12 nt (GTGGTGGTGGTG) for formation of the left-handed DNA G-quadruplex, which is found to be highly abundant in the human genome. A systematic analysis of thymine loop mutations revealed a moderate sequence tolerance, which would further broaden the space of sequences prone to left-handed G-quadruplex formation.
6gzn DNA NMR Adenine-driven structural switch from two- to three-quartet DNA G-quadruplex; 3Dmol view (2018) "Adenine-Driven Structural Switch from a Two- to Three-Quartet DNA G-Quadruplex." Angew. Chem. Int. Ed. Engl., 57, 15395-15399. pubmed Lenarcic Zivkovic, M., Rozman, J., Plavec, J. A G-rich sequence found in the regulatory region of the RANKL gene, which is associated with homeostasis of bone metabolism, folds into a two-quartet basket-type G-quadruplex stabilized by A⋅G⋅A and G⋅G⋅G base-triads. Perusal of local structural features together with G/A-to-T modifications uncovered the critical role of A5 for the formation of a distinct antiparallel two-quartet topology and not the three-quartet topology that would be expected based on the sequence with four GGG-tracts alone. The structural changes induced by the A5-to-T5 modification include a switch in orientation and relative positions of G-strands that together with anti to syn reorientation of G12 provide insights into the complexity of the interactions that influence the folding of G-rich DNA. Understanding the impact of loop residues on the stability and formation of G-quadruplexes advances our knowledge and ability to predict structures adopted by G-rich sequences, which are involved in regulatory mechanisms in the cell, and may also facilitate drug design.
6h1k DNA NMR The major G-quadruplex form of HIV-1 LTR; 3Dmol view (2018) "Major G-Quadruplex Form of HIV-1 LTR Reveals a (3 + 1) Folding Topology Containing a Stem-Loop." J. Am. Chem. Soc., 140, 13654-13662. pubmed Butovskaya, E., Heddi, B., Bakalar, B., Richter, S.N., Phan, A.T. Nucleic acids can form noncanonical four-stranded structures called G-quadruplexes. G-quadruplex-forming sequences are found in several genomes including human and viruses. Previous studies showed that the G-rich sequence located in the U3 promoter region of the HIV-1 long terminal repeat (LTR) folds into a set of dynamically interchangeable G-quadruplex structures. G-quadruplexes formed in the LTR could act as silencer elements to regulate viral transcription. Stabilization of LTR G-quadruplexes by G-quadruplex-specific ligands resulted in decreased viral production, suggesting the possibility of targeting viral G-quadruplex structures for antiviral purposes. Among all the G-quadruplexes formed in the LTR sequence, LTR-III was shown to be the major G-quadruplex conformation in vitro. Here we report the NMR structure of LTR-III in K+ solution, revealing the formation of a unique quadruplex-duplex hybrid consisting of a three-layer (3 + 1) G-quadruplex scaffold, a 12-nt diagonal loop containing a conserved duplex-stem, a 3-nt lateral loop, a 1-nt propeller loop, and a V-shaped loop. Our structure showed several distinct features including a quadruplex-duplex junction, representing an attractive motif for drug targeting. The structure solved in this study may be used as a promising target to selectively impair the viral cycle.
6h5r DNA X-ray (2.0 Å) Structure of the complex of a human telomeric DNA with bis(1-butyl-3-methyl-imidazole-2-ylidene) gold(I); 3Dmol view (2018) "Interaction of a gold(i) dicarbene anticancer drug with human telomeric DNA G-quadruplex: solution and computationally aided X-ray diffraction analysis." Dalton Trans, 47, 16132-16138. pubmed Guarra, F., Marzo, T., Ferraroni, M., Papi, F., Bazzicalupi, C., Gratteri, P., Pescitelli, G., Messori, L., Biver, T., Gabbiani, C. The bis carbene gold(i) complex [Au(1-butyl-3-methyl-2-ylidene)2]PF6, ([Au(NHC)2]PF6 hereafter), holds remarkable interest as a perspective anticancer agent. The compound is stable under physiological like conditions: its original structure is retained even in the presence of excess glutathione (GSH). Previous studies revealed its high cytotoxicity in vitro that correlates with the impairment of crucial metabolic and enzymatic cellular processes (Magherini et al., Oncotarget, 2018, 9, 28042). Here, the interaction of [Au(NHC)2]PF6 with the human telomeric DNA G-quadruplex Tel23 has been investigated in solution by means of high resolution mass spectrometry. ESI MS experiments well document the formation of stable 1 : 1 adducts between the biscarbene gold complex - in its intact form - and the DNA G-quadruplex Tel23. Next, through independent biophysical methods, we show that [Au(NHC)2]PF6 binding does not significantly affect the G quadruplex melting temperature nor its conformation. The crystal structure for the [Au(NHC)2]+/Tel24 adduct was eventually determined by a joint X-ray diffraction and in silico simulation approach. Through the careful integration of solution and solid-state data, a quite clear picture emerges for the interaction of this gold complex with the Tel23 G-quadruplex.
6ia0 DNA NMR Human telomeric G-quadruplex with 8-oxo-G substitution in the central G-quartet; 3Dmol view (2019) "Impact of Oxidative Lesions on the Human Telomeric G-Quadruplex." J. Am. Chem. Soc., 141, 2594-2603. pubmed Bielskute, S., Plavec, J., Podbevsek, P. Telomere attrition is closely associated with cell aging and exposure to reactive oxygen species (ROS). While oxidation products of nucleotides have been studied extensively in the past, the underlying secondary/tertiary structural changes in DNA remain poorly understood. In this work, we systematically probed guanine positions in the human telomeric oligonucleotide sequence (hTel) by substitutions with the major product of ROS, 8-oxo-7,8-dihydroguanine (oxoG), and evaluated the G-quadruplex forming ability of such oligonucleotides. Due to reduced hydrogen-bonding capability caused by oxoG, a loss of G-quadruplex structure was observed for most oligonucleotides containing oxidative lesions. However, some positions in the hTel sequence were found to tolerate substitutions with oxoG. Due to oxo G's preference for the syn conformation, distinct responses were observed when replacing guanines with different glycosidic conformations. Accommodation of oxoG at sites originally in syn or anti in nonsubstituted hTel G-quadruplex requires a minor structural rearrangement or a major conformational shift, respectively. The system responds by retaining or switching to a fold where oxoG is in syn conformation. Most importantly, these G-quadruplex structures are still stable at physiological temperatures and should be considered detrimental in higher-order telomere structures.
6ia4 DNA NMR Human telomeric G-quadruplex with 8-oxo-G substitution in the outer G-quartet; 3Dmol view (2019) "Impact of Oxidative Lesions on the Human Telomeric G-Quadruplex." J. Am. Chem. Soc., 141, 2594-2603. pubmed Bielskute, S., Plavec, J., Podbevsek, P. Telomere attrition is closely associated with cell aging and exposure to reactive oxygen species (ROS). While oxidation products of nucleotides have been studied extensively in the past, the underlying secondary/tertiary structural changes in DNA remain poorly understood. In this work, we systematically probed guanine positions in the human telomeric oligonucleotide sequence (hTel) by substitutions with the major product of ROS, 8-oxo-7,8-dihydroguanine (oxoG), and evaluated the G-quadruplex forming ability of such oligonucleotides. Due to reduced hydrogen-bonding capability caused by oxoG, a loss of G-quadruplex structure was observed for most oligonucleotides containing oxidative lesions. However, some positions in the hTel sequence were found to tolerate substitutions with oxoG. Due to oxo G's preference for the syn conformation, distinct responses were observed when replacing guanines with different glycosidic conformations. Accommodation of oxoG at sites originally in syn or anti in nonsubstituted hTel G-quadruplex requires a minor structural rearrangement or a major conformational shift, respectively. The system responds by retaining or switching to a fold where oxoG is in syn conformation. Most importantly, these G-quadruplex structures are still stable at physiological temperatures and should be considered detrimental in higher-order telomere structures.
6ip3 DNA X-ray (1.4 Å) Structure of human telomeric DNA at 1.4 Angstroms resolution; 3Dmol view (2019) "Probing G-quadruplex topologies and recognition concurrently in real time and 3D using a dual-app nucleoside probe." Nucleic Acids Res. pubmed Nuthanakanti, A., Ahmed, I., Khatik, S.Y., Kayarat, S., Srivatsan, S.G. Comprehensive understanding of structure and recognition properties of regulatory nucleic acid elements in real time and atomic level is highly important to devise efficient therapeutic strategies. Here, we report the establishment of an innovative biophysical platform using a dual-app nucleoside analog, which serves as a common probe to detect and correlate different GQ structures and ligand binding under equilibrium conditions and in 3D by fluorescence and X-ray crystallography techniques. The probe (SedU) is composed of a microenvironment-sensitive fluorophore and an excellent anomalous X-ray scatterer (Se), which is assembled by attaching a selenophene ring at 5-position of 2'-deoxyuridine. SedU incorporated into the loop region of human telomeric DNA repeat fluorescently distinguished subtle differences in GQ topologies and enabled quantify ligand binding to different topologies. Importantly, anomalous X-ray dispersion signal from Se could be used to determine the structure of GQs. As the probe is minimally perturbing, a direct comparison of fluorescence data and crystal structures provided structural insights on how the probe senses different GQ conformations without affecting the native fold. Taken together, our dual-app probe represents a new class of tool that opens up new experimental strategies to concurrently investigate nucleic acid structure and recognition in real time and 3D.
6ip7 DNA X-ray (1.55 Å) Structure of human telomeric DNA with 5-Selenophene-modified deoxyuridine at residue 11; 3Dmol view (2019) "Probing G-quadruplex topologies and recognition concurrently in real time and 3D using a dual-app nucleoside probe." Nucleic Acids Res. pubmed Nuthanakanti, A., Ahmed, I., Khatik, S.Y., Kayarat, S., Srivatsan, S.G. Comprehensive understanding of structure and recognition properties of regulatory nucleic acid elements in real time and atomic level is highly important to devise efficient therapeutic strategies. Here, we report the establishment of an innovative biophysical platform using a dual-app nucleoside analog, which serves as a common probe to detect and correlate different GQ structures and ligand binding under equilibrium conditions and in 3D by fluorescence and X-ray crystallography techniques. The probe (SedU) is composed of a microenvironment-sensitive fluorophore and an excellent anomalous X-ray scatterer (Se), which is assembled by attaching a selenophene ring at 5-position of 2'-deoxyuridine. SedU incorporated into the loop region of human telomeric DNA repeat fluorescently distinguished subtle differences in GQ topologies and enabled quantify ligand binding to different topologies. Importantly, anomalous X-ray dispersion signal from Se could be used to determine the structure of GQs. As the probe is minimally perturbing, a direct comparison of fluorescence data and crystal structures provided structural insights on how the probe senses different GQ conformations without affecting the native fold. Taken together, our dual-app probe represents a new class of tool that opens up new experimental strategies to concurrently investigate nucleic acid structure and recognition in real time and 3D.
6isw DNA X-ray (2.3 Å) Structure of human telomeric DNA with 5-selenophene-modified deoxyuridine at residue 12; 3Dmol view (2019) "Probing G-quadruplex topologies and recognition concurrently in real time and 3D using a dual-app nucleoside probe." Nucleic Acids Res. pubmed Nuthanakanti, A., Ahmed, I., Khatik, S.Y., Kayarat, S., Srivatsan, S.G. Comprehensive understanding of structure and recognition properties of regulatory nucleic acid elements in real time and atomic level is highly important to devise efficient therapeutic strategies. Here, we report the establishment of an innovative biophysical platform using a dual-app nucleoside analog, which serves as a common probe to detect and correlate different GQ structures and ligand binding under equilibrium conditions and in 3D by fluorescence and X-ray crystallography techniques. The probe (SedU) is composed of a microenvironment-sensitive fluorophore and an excellent anomalous X-ray scatterer (Se), which is assembled by attaching a selenophene ring at 5-position of 2'-deoxyuridine. SedU incorporated into the loop region of human telomeric DNA repeat fluorescently distinguished subtle differences in GQ topologies and enabled quantify ligand binding to different topologies. Importantly, anomalous X-ray dispersion signal from Se could be used to determine the structure of GQs. As the probe is minimally perturbing, a direct comparison of fluorescence data and crystal structures provided structural insights on how the probe senses different GQ conformations without affecting the native fold. Taken together, our dual-app probe represents a new class of tool that opens up new experimental strategies to concurrently investigate nucleic acid structure and recognition in real time and 3D.
6jce DNA NMR NMR solution and X-ray crystal structures of a DNA containing both right-and left-handed parallel-stranded G-quadruplexes; 3Dmol view (2019) "NMR solution and X-ray crystal structures of a DNA molecule containing both right- and left-handed parallel-stranded G-quadruplexes." Nucleic Acids Res. pubmed Winnerdy, F.R., Bakalar, B., Maity, A., Vandana, J.J., Mechulam, Y., Schmitt, E., Phan, A.T. Analogous to the B- and Z-DNA structures in double-helix DNA, there exist both right- and left-handed quadruple-helix (G-quadruplex) DNA. Numerous conformations of right-handed and a few left-handed G-quadruplexes were previously observed, yet they were always identified separately. Here, we present the NMR solution and X-ray crystal structures of a right- and left-handed hybrid G-quadruplex. The structure reveals a stacking interaction between two G-quadruplex blocks with different helical orientations and displays features of both right- and left-handed G-quadruplexes. An analysis of loop mutations suggests that single-nucleotide loops are preferred or even required for the left-handed G-quadruplex formation. The discovery of a right- and left-handed hybrid G-quadruplex further expands the polymorphism of G-quadruplexes and is potentially useful in designing a left-to-right junction in G-quadruplex engineering.
6jkn DNA X-ray (1.4 Å) Crystal Structure of G-quadruplex Formed by Bromo-substituted Human Telomeric DNA; 3Dmol view (2019) "The crystal structure of an antiparallel chair-type G-quadruplex formed by Bromo-substituted human telomeric DNA." Nucleic Acids Res., 47, 5395-5404. pubmed Geng, Y., Liu, C., Zhou, B., Cai, Q., Miao, H., Shi, X., Xu, N., You, Y., Fung, C.P., Din, R.U., Zhu, G. Human telomeric guanine-rich DNA, which could adopt different G-quadruplex structures, plays important roles in protecting the cell from recombination and degradation. Although many of these structures were determined, the chair-type G-quadruplex structure remains elusive. Here, we present a crystal structure of the G-quadruplex composed of the human telomeric sequence d[GGGTTAGG8GTTAGGGTTAGG20G] with two dG to 8Br-dG substitutions at positions 8 and 20 with syn conformation in the K+ solution. It forms a novel three-layer chair-type G-quadruplex with two linking trinucleotide loops. Particularly, T5 and T17 are coplanar with two water molecules stacking on the G-tetrad layer in a sandwich-like mode through a coordinating K+ ion and an A6•A18 base pair. While a twisted Hoogsteen A12•T10 base pair caps on the top of G-tetrad core. The three linking TTA loops are edgewise and each DNA strand has two antiparallel adjacent strands. Our findings contribute to a deeper understanding and highlight the unique roles of loop and water molecule in the folding of the G-quadruplex.
6neb DNA NMR MYC Promoter G-Quadruplex with 1:6:1 loop length; 3Dmol view (2019) "Solution Structure of a MYC Promoter G-Quadruplex with 1:6:1 Loop Length." Acs Omega, 4, 2533-2539. Dickerhoff, J., Onel, B., Chen, L., Chen, Y., Yang, D.
6qjo DNA X-ray (1.8 Å) DNA containing both right- and left-handed parallel-stranded G-quadruplexes; 3Dmol view (2019) "NMR solution and X-ray crystal structures of a DNA molecule containing both right- and left-handed parallel-stranded G-quadruplexes." Nucleic Acids Res. pubmed Winnerdy, F.R., Bakalar, B., Maity, A., Vandana, J.J., Mechulam, Y., Schmitt, E., Phan, A.T. Analogous to the B- and Z-DNA structures in double-helix DNA, there exist both right- and left-handed quadruple-helix (G-quadruplex) DNA. Numerous conformations of right-handed and a few left-handed G-quadruplexes were previously observed, yet they were always identified separately. Here, we present the NMR solution and X-ray crystal structures of a right- and left-handed hybrid G-quadruplex. The structure reveals a stacking interaction between two G-quadruplex blocks with different helical orientations and displays features of both right- and left-handed G-quadruplexes. An analysis of loop mutations suggests that single-nucleotide loops are preferred or even required for the left-handed G-quadruplex formation. The discovery of a right- and left-handed hybrid G-quadruplex further expands the polymorphism of G-quadruplexes and is potentially useful in designing a left-to-right junction in G-quadruplex engineering.
6r9k DNA NMR A quadruplex hybrid structure with lpp loop orientation and 3 syn residues; 3Dmol view (2019) "Duplex-Guided Refolding into Novel G-Quadruplex (3+1) Hybrid Conformations." Angew.Chem.Int.Ed.Engl. pubmed Karg, B., Mohr, S., Weisz, K. The oligomer d(GCGTG3 TCAG3 TG3 TG3 ACGC) with short complementary flanking sequences at the 5'- and 3'-ends was shown to fold into three different DNA G-quadruplex species. In contrast, a corresponding oligomer that lacks base complementarity between the two overhang sequences folds into a single parallel G-quadruplex. The three coexisting quadruplex structures were unambiguously identified and structurally characterized through detailed spectral comparisons with well-defined G-quadruplexes formed upon the deliberate incorporation of syn-favoring 8-bromoguanosine analogues into specific positions of the G-core. Two (3+1) hybrid structures coexist with the parallel fold and feature a novel lateral-propeller-propeller loop architecture that has not yet been confirmed experimentally. Both hybrid quadruplexes adopt the same topology and only differ in their pattern of anti→syn transitions and tetrad stackings.
6r9l DNA NMR A quadruplex hybrid structure with lpp loop orientation and 5 syn residues; 3Dmol view (2019) "Duplex-Guided Refolding into Novel G-Quadruplex (3+1) Hybrid Conformations." Angew.Chem.Int.Ed.Engl. pubmed Karg, B., Mohr, S., Weisz, K. The oligomer d(GCGTG3 TCAG3 TG3 TG3 ACGC) with short complementary flanking sequences at the 5'- and 3'-ends was shown to fold into three different DNA G-quadruplex species. In contrast, a corresponding oligomer that lacks base complementarity between the two overhang sequences folds into a single parallel G-quadruplex. The three coexisting quadruplex structures were unambiguously identified and structurally characterized through detailed spectral comparisons with well-defined G-quadruplexes formed upon the deliberate incorporation of syn-favoring 8-bromoguanosine analogues into specific positions of the G-core. Two (3+1) hybrid structures coexist with the parallel fold and feature a novel lateral-propeller-propeller loop architecture that has not yet been confirmed experimentally. Both hybrid quadruplexes adopt the same topology and only differ in their pattern of anti→syn transitions and tetrad stackings.
pdb_id category method annotation reference authors abstract