Created and maintained by Xiang-Jun Lu <xiangjun@x3dna.org> · Updated on 2024-11-15
Citation: Please cite the NAR'20 DSSR-PyMOL schematics paper and/or the NAR'15 DSSR method paper.
| pdb id | class | method | authors | reference | annotation |
|---|---|---|---|---|---|
| 139d | DNA | NMR | Wang Y, Patel DJ | (1993) "Solution structure of a parallel-stranded G-quadruplex DNA." J.Mol.Biol., 234, 1171-1183. doi: 10.1006/jmbi.1993.1668. | Solution structure of a parallel-stranded g-quadruplex DNA. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 143d | DNA | NMR | Wang Y, Patel DJ | (1993) "Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex." Structure, 1, 263-282. doi: 10.1016/0969-2126(93)90015-9. | Solution structure of the human telomeric repeat d(ag3[t2ag3]3) of the g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-LwD+Ln), basket(2+2), UDDU |
| 148d | DNA | NMR | Schultze P, Macaya RF, Feigon J | (1994) "Three-dimensional solution structure of the thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG)." J.Mol.Biol., 235, 1532-1547. doi: 10.1006/jmbi.1994.1105. | Three-dimensional solution structure of the thrombin binding DNA aptamer d(ggttggtgtggttgg). ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 156d | DNA | NMR | Schultze P, Smith FW, Feigon J | (1994) "Refined solution structure of the dimeric quadruplex formed from the Oxytricha telomeric oligonucleotide d(GGGGTTTTGGGG)." Structure, 2, 221-233. doi: 10.1016/S0969-2126(00)00023-X. | Refined solution structure of the dimeric quadruplex formed from the oxytricha telomeric oligonucleotide d(ggggttttgggg). ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 186d | DNA | NMR | Wang Y, Patel DJ | (1994) "Solution structure of the Tetrahymena telomeric repeat d(T2G4)4 G-tetraplex." Structure, 2, 1141-1156. doi: 10.1016/S0969-2126(94)00117-0. | Solution structure of the tetrahymena telomeric repeat d(t2g4)4 g-tetraplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 1a6h | DNA | NMR | Kettani A, Kumar RA, Patel DJ | (1995) "Solution structure of a DNA quadruplex containing the fragile X syndrome triplet repeat." J.Mol.Biol., 254, 638-656. doi: 10.1006/jmbi.1995.0644. | DNA quadruplex containing gcgc tetrad, NMR, 4 structures. ➥ 2 G-tetrads |
| 1a8n | DNA | NMR | Kettani A, Bouaziz S, Gorin A, Zhao H, Jones RA, Patel DJ | (1998) "Solution structure of a Na cation stabilized DNA quadruplex containing G.G.G.G and G.C.G.C tetrads formed by G-G-G-C repeats observed in adeno-associated viral DNA." J.Mol.Biol., 282, 619-636. doi: 10.1006/jmbi.1998.2030. | Solution structure of a na+ cation stabilized DNA quadruplex containing g.g.g.g and g.c.g.c tetrads formed by g-g-g-c repeats observed in aav and human chromosome 19, NMR, 8 structures. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD |
| 1a8w | DNA | NMR | Bouaziz S, Kettani A, Patel DJ | (1998) "A K cation-induced conformational switch within a loop spanning segment of a DNA quadruplex containing G-G-G-C repeats." J.Mol.Biol., 282, 637-652. doi: 10.1006/jmbi.1998.2031. | A k+ cation-induced conformational switch within a loop spanning segment of a DNA quadruplex containing g-g-g-c repeats, NMR, 8 structures. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD |
| 1aff | DNA | NMR | Kettani A, Bouaziz S, Wang W, Jones RA, Patel DJ | (1997) "Bombyx mori single repeat telomeric DNA sequence forms a G-quadruplex capped by base triads." Nat.Struct.Biol., 4, 382-389. doi: 10.1038/nsb0597-382. | DNA quadruplex containing gggg tetrads and (t.a).a triads, NMR, 8 structures. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UUDD |
| 1bub | DNA | NMR | Beger RD, Marathias VM, Volkman BF, Bolton PH | (1998) "Determination of internuclear angles of DNA using paramagnetic-assisted magnetic alignment." J.Magn.Reson., 135, 256-259. doi: 10.1006/jmre.1998.1527. | Determination of internuclear angles of DNA using paramagnetic assisted magnetic alignment. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 1c32 | DNA | NMR | Marathias VM, Bolton PH | (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. doi: 10.1093/nar/28.9.1969. | Solution structure of a quadruplex forming DNA and its intermidiate. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Lx+Lx+Ln), (2+2), UDUD |
| 1c34 | DNA | NMR | Marathias VM, Bolton PH | (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. doi: 10.1093/nar/28.9.1969. | Solution structure of a quadruplex forming DNA and its intermidiate. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Lx), (2+2), UDUD |
| 1c35 | DNA | NMR | Marathias VM, Bolton PH | (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. doi: 10.1093/nar/28.9.1969. | Solution structure of a quadruplex forming DNA and its intermidiate. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Lx+Lx+Ln), (2+2), UDUD |
| 1c38 | DNA | NMR | Marathias VM, Bolton PH | (2000) "Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA." Nucleic Acids Res., 28, 1969-1977. doi: 10.1093/nar/28.9.1969. | Solution structure of a quadruplex forming DNA and its intermediate. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Lx), (2+2), UDUD |
| 1d59 | DNA | X-ray (2.3 Å) | Kang C, Zhang X, Ratliff R, Moyzis R, Rich A | (1992) "Crystal structure of four-stranded Oxytricha telomeric DNA." Nature, 356, 126-131. doi: 10.1038/356126a0. | Crystal structure of 4-stranded oxytricha telomeric DNA. ➥ 8 G-tetrads, 2 G4 helices, 2 G4 stems, (2+2), UDUD |
| 1d6d | DNA | NMR | Kuryavyi V, Kettani A, Wang W, Jones R, Patel DJ | (2000) "A diamond-shaped zipper-like DNA architecture containing triads sandwiched between mismatches and tetrads." J.Mol.Biol., 295, 455-469. doi: 10.1006/jmbi.1999.3345. | Solution DNA structure containing (a-a)-t triads interdigitated between a-t base pairs and gggg tetrads; NMR, 8 struct.. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UUDD |
| 1eeg | DNA | NMR | Kettani A, Gorin A, Majumdar A, Hermann T, Skripkin E, Zhao H, Jones R, Patel DJ | (2000) "A dimeric DNA interface stabilized by stacked A.(G.G.G.G).A hexads and coordinated monovalent cations." J.Mol.Biol., 297, 627-644. doi: 10.1006/jmbi.2000.3524. | A(gggg)a hexad pairing aligment for the d(g-g-a-g-g-a-g) sequence. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 1emq | DNA | NMR | Patel PK, Hosur RV | (1999) "NMR observation of T-tetrads in a parallel stranded DNA quadruplex formed by Saccharomyces cerevisiae telomere repeats." Nucleic Acids Res., 27, 2457-2464. doi: 10.1093/nar/27.12.2457. | NMR observation of t-tetrads in a parallel stranded DNA quadruplex formed by saccharomyces cerevisiae telomere repeats. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/5' |
| 1evm | DNA | NMR | Patel PK, Koti AS, Hosur RV | (1999) "NMR studies on truncated sequences of human telomeric DNA: observation of a novel A-tetrad." Nucleic Acids Res., 27, 3836-3843. doi: 10.1093/nar/27.19.3836. | NMR observation of a-tetrad. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 1evn | DNA | NMR | Patel PK, Koti AS, Hosur RV | (1999) "NMR studies on truncated sequences of human telomeric DNA: observation of a novel A-tetrad." Nucleic Acids Res., 27, 3836-3843. doi: 10.1093/nar/27.19.3836. | NMR observation of a-tetrad. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 1evo | DNA | NMR | Patel PK, Bhavesh NS, Hosur RV | (2000) "NMR observation of a novel C-tetrad in the structure of the SV40 repeat sequence GGGCGG." Biochem.Biophys.Res.Commun., 270, 967-971. doi: 10.1006/bbrc.2000.2479. | NMR observation of a novel c-tetrad. ➥ 5 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/5' |
| 1f3s | DNA | NMR | Kettani A, Basu G, Gorin A, Majumdar A, Skripkin E, Patel DJ | (2000) "A two-stranded template-based approach to G.(C-A) triad formation: designing novel structural elements into an existing DNA framework." J.Mol.Biol., 301, 129-146. doi: 10.1006/jmbi.2000.3932. | Solution structure of DNA sequence gggttcagg forms gggg tetrade and g(c-a) triad.. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD |
| 1fqp | DNA | NMR | Keniry MA, Strahan GD, Owen EA, Shafer RH | (1995) "Solution structure of the Na+ form of the dimeric guanine quadruplex [d(G3T4G3)]2." Eur.J.Biochem., 233, 631-643. doi: 10.1111/j.1432-1033.1995.631_2.x. | Intramolecular quadruplex DNA with three gggg repeats, NMR, ph 6.7, 0.1 m na+ and 4 mm (strand concentration), 5 structures. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1hao | hydrolase-hydrolase inhibitor-DNA | X-ray (2.8 Å) | Padmanabhan K, Tulinsky A | (1996) "An ambiguous structure of a DNA 15-mer thrombin complex." Acta Crystallogr.,Sect.D, 52, 272-282. doi: 10.1107/S0907444995013977. | Complex of human alpha-thrombin with a 15mer oligonucleotide ggttggtgtggttgg (based on NMR model of DNA). ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 1hap | hydrolase-hydrolase inhibitor-DNA | X-ray (2.8 Å) | Padmanabhan K, Tulinsky A | (1996) "An ambiguous structure of a DNA 15-mer thrombin complex." Acta Crystallogr.,Sect.D, 52, 272-282. doi: 10.1107/S0907444995013977. | Complex of human alpha-thrombin with a 15mer oligonucleotide ggttggtgtggttgg (based on x-ray model of DNA). ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-Lw-Ln-Lw), chair(2+2), UDUD |
| 1hut | hydrolase-hydrolase inhibitor-DNA | X-ray (2.9 Å) | Padmanabhan K, Padmanabhan KP, Ferrara JD, Sadler JE, Tulinsky A | (1993) "The structure of alpha-thrombin inhibited by a 15-mer single-stranded DNA aptamer." J.Biol.Chem., 268, 17651-17654. | The structure of alpha-thrombin inhibited by a 15-mer single-stranded DNA aptamer. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-Lw-Ln-Lw), chair(2+2), UDUD |
| 1i34 | DNA | NMR | Kuryavyi V, Majumdar A, Shallop A, Chernichenko N, Skripkin E, Jones R, Patel DJ | (2001) "A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple." J.Mol.Biol., 310, 181-194. doi: 10.1006/jmbi.2001.4759. | Solution DNA quadruplex with double chain reversal loop and two diagonal loops connecting gggg tetrads flanked by g-(t-t) triad and t-t-t triple. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(D+PD), (2+2), UDDU |
| 1j6s | RNA | X-ray (1.4 Å) | Pan B, Xiong Y, Shi K, Deng J, Sundaralingam M | (2003) "Crystal structure of an RNA purine-rich tetraplex containing adenine tetrads: implications for specific binding in RNA tetraplexes." Structure, 11, 815-823. doi: 10.1016/S0969-2126(03)00107-2. | Crystal structure of an RNA tetraplex (ugaggu)4 with a-tetrads, g-tetrads, u-tetrads and g-u octads. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 1j8g | RNA | X-ray (0.61 Å) | Deng J, Xiong Y, Sundaralingam M | (2001) "X-ray analysis of an RNA tetraplex (UGGGGU)(4) with divalent Sr(2+) ions at subatomic resolution (0.61 A)." Proc.Natl.Acad.Sci.USA, 98, 13665-13670. doi: 10.1073/pnas.241374798. | X-ray analysis of a RNA tetraplex r(uggggu)4 at ultra-high resolution. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 1jb7 | DNA-binding protein-DNA | X-ray (1.86 Å) | Horvath MP, Schultz SC | (2001) "DNA G-quartets in a 1.86 A resolution structure of an Oxytricha nova telomeric protein-DNA complex." J.Mol.Biol., 310, 367-377. doi: 10.1006/jmbi.2001.4766. | DNA g-quartets in a 1.86 Å resolution structure of an oxytricha nova telomeric protein-DNA complex. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1jjp | DNA | NMR | Zhang N, Gorin A, Majumdar A, Kettani A, Chernichenko N, Skripkin E, Patel DJ | (2001) "V-shaped scaffold: a new architectural motif identified in an A x (G x G x G x G) pentad-containing dimeric DNA quadruplex involving stacked G(anti) x G(anti) x G(anti) x G(syn) tetrads." J.Mol.Biol., 311, 1063-1079. doi: 10.1006/jmbi.2001.4916. | A(gggg) pentad-containing dimeric DNA quadruplex involving stacked g(anti)g(anti)g(anti)g(syn) tetrads. ➥ 4 G-tetrads, 1 G4 helix |
| 1jpq | DNA | X-ray (1.6 Å) | Haider S, Parkinson GN, Neidle S | (2002) "Crystal structure of the potassium form of an Oxytricha nova G-quadruplex." J.Mol.Biol., 320, 189-200. doi: 10.1016/S0022-2836(02)00428-X. | Crystal structure of the oxytricha telomeric DNA at 1.6a. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1jrn | DNA | X-ray (2.0 Å) | Haider S, Parkinson GN, Neidle S | (2002) "Crystal structure of the potassium form of an Oxytricha nova G-quadruplex." J.Mol.Biol., 320, 189-200. doi: 10.1016/S0022-2836(02)00428-X. | Orthorhombic form of oxytricha telomeric DNA at 2.0a. ➥ 8 G-tetrads, 2 G4 helices, 2 G4 stems, (2+2), UDDU |
| 1jvc | DNA | NMR | Zhang N, Gorin A, Majumdar A, Kettani A, Chernichenko N, Skripkin E, Patel DJ | (2001) "Dimeric DNA quadruplex containing major groove-aligned A-T-A-T and G-C-G-C tetrads stabilized by inter-subunit Watson-Crick A-T and G-C pairs." J.Mol.Biol., 312, 1073-1088. doi: 10.1006/jmbi.2001.5002. | Dimeric DNA quadruplex containing major groove-aligned a.t.a.t and g.c.g.c tetrads stabilized by inter-subunit watson-crick a:t and g:c pairs. ➥ 1 G-tetrad |
| 1k4x | DNA | NMR | Schultze P, Hud NV, Smith FW, Feigon J | (1999) "The effect of sodium, potassium and ammonium ions on the conformation of the dimeric quadruplex formed by the Oxytricha nova telomere repeat oligonucleotide d(G(4)T(4)G(4))." Nucleic Acids Res., 27, 3018-3028. doi: 10.1093/nar/27.15.3018. | Potassium form of oxy-1.5 quadruplex DNA. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1k8p | DNA | X-ray (2.4 Å) | Parkinson GN, Lee MP, Neidle S | (2002) "Crystal structure of parallel quadruplexes from human telomeric DNA." Nature, 417, 876-880. doi: 10.1038/nature755. | Structure of the human g-quadruplex reveals a novel topology. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 1kf1 | DNA | X-ray (2.1 Å) | Parkinson GN, Lee MP, Neidle S | (2002) "Crystal structure of parallel quadruplexes from human telomeric DNA." Nature, 417, 876-880. doi: 10.1038/nature755. | Structure and packing of human telomeric DNA. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 1l1h | DNA | X-ray (1.75 Å) | Haider SM, Parkinson GN, Neidle S | (2003) "Structure of a G-quadruplex-Ligand Complex." J.Mol.Biol., 326, 117-125. doi: 10.1016/S0022-2836(02)01354-2. | Crystal structure of the quadruplex DNA-drug complex. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1lvs | DNA | NMR | Crnugelj M, Hud NV, Plavec J | (2002) "The solution structure of d(G(4)T(4)G(3))(2): a bimolecular G-quadruplex with a novel fold." J.Mol.Biol., 320, 911-924. doi: 10.1016/S0022-2836(02)00569-7. | The solution structure of d(g4t4g3)2. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1mdg | RNA | X-ray (1.5 Å) | Pan BC, Xiong Y, Shi K, Sundaralingam M | (2003) "An Eight-Stranded Helical Fragment in RNA Crystal Structure: Implications for Tetraplex Interaction." Structure, 11, 825-831. doi: 10.1016/S0969-2126(03)00108-4. | An alternating antiparallel octaplex in an RNA crystal structure. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 1my9 | RNA | NMR | Liu H, Matsugami A, Katahira M, Uesugi S | (2002) "A Dimeric RNA Quadruplex Architecture Comprised of Two G:G(:A):G:G(:A) Hexads, G:G:G:G Tetrads and UUUU Loops." J.Mol.Biol., 322, 955-970. doi: 10.1016/S0022-2836(02)00876-8. | Solution structure of a k+ cation stabilized dimeric RNA quadruplex containing two g:g(:a):g:g(:a) hexads, g:g:g:g tetrads and uuuu loops. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 1myq | DNA | NMR | Matsugami A, Ouhashi K, Kanagawa M, Liu H, Kanagawa S, Uesugi S, Katahira M | (2001) "An intramolecular quadruplex of (GGA)(4) triplet repeat DNA with a G:G:G:G tetrad and a G(:A):G(:A):G(:A):G heptad, and its dimeric interaction." J.Mol.Biol., 313, 255-269. doi: 10.1006/jmbi.2001.5047. | An intramolecular quadruplex of (gga)(4) triplet repeat DNA with a g:g:g:g tetrad and a g(:a):g(:a):g(:a):g heptad, and its dimeric interaction. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 1n7a | DNA, RNA | X-ray (1.2 Å) | Ravelli RBG, Leiros H-KS, Pan B, Caffrey M, McSweeney S | (2003) "Specific Radiation-Damage Can Be Used To Solve Macromolecular Crystal Structures." Structure, 11, 217-224. doi: 10.1016/S0969-2126(03)00006-6. | Rip-radiation-damage induced phasing. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED |
| 1n7b | DNA, RNA | X-ray (1.4 Å) | Ravelli RBG, Leiros H-KS, Pan B, Caffrey M, McSweeney S | (2003) "Specific Radiation-Damage Can Be Used To Solve Macromolecular Crystal Structures." Structure, 11, 217-224. doi: 10.1016/S0969-2126(03)00006-6. | Rip-radiation-damage induced phasing. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED |
| 1np9 | DNA | NMR | Gavathiotis E, Searle MS | (2003) "Structure of the parallel-stranded DNA quadruplex d(TTAGGGT)4 containing the human telomeric repeat: evidence for A-tetrad formation from NMR and molecular dynamics simulations." ORG.BIOMOL.CHEM., 1, 1650-1656. doi: 10.1039/b300845m. | Structure of the parallel-stranded DNA quadruplex d(ttaggga)4 containing the human telomeric repeat. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 1nyd | DNA | NMR | Webba da Silva M | (2003) "Association of DNA quadruplexes through G:C:G:C tetrads. Solution structure of d(GCGGTGGAT)." Biochemistry, 42, 14356-14365. doi: 10.1021/bi0355185. | Solution structure of DNA quadruplex gcggtggat. ➥ 4 G-tetrads, 2 G4 helices, 2 G4 stems, parallel(4+0), UUUU |
| 1nzm | DNA | NMR | Gavathiotis E, Heald RA, Stevens MFG, Searle MS | (2003) "Drug Recognition and Stabilisation of the Parallel-stranded DNA Quadruplex d(TTAGGGT)4 Containing the Human Telomeric Repeat." J.Mol.Biol., 334, 25-36. doi: 10.1016/j.jmb.2003.09.018. | NMR structure of the parallel-stranded DNA quadruplex d(ttagggt)4 complexed with the telomerase inhibitor rhps4. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 1o0k | DNA | X-ray (1.17 Å) | Clark GR, Pytel PD, Squire CJ, Neidle S | (2003) "Structure of the First Parallel DNA Quadruplex-drug Complex." J.Am.Chem.Soc., 125, 4066-4067. doi: 10.1021/ja0297988. | Structure of the first parallel DNA quadruplex-drug complex. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 1oz8 | DNA | NMR | Matsugami A, Okuizumi T, Uesugi S, Katahira M | (2003) "Intramolecular Higher Order Packing of Parallel Quadruplexes Comprising a G:G:G:G Tetrad and a G(:A):G(:A):G(:A):G Heptad of GGA Triplet Repeat DNA." J.BIOL.CHEM., 278, 28147-28153. doi: 10.1074/jbc.M303694200. | Intramolecular higher-order packing of parallel quadruplexes comprising a g:g:g:g tetrad and a g(:a):g(:a):g(:a):g heptad of gga triplet repeat DNA. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 1pa6 | DNA binding protein-DNA | X-ray (2.45 Å) | Theobald DL, Schultz SC | (2003) "Nucleotide shuffling and ssDNA recognition in Oxytricha nova telomere end-binding protein complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. | Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgagg. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1ph1 | DNA binding protein-DNA | X-ray (2.51 Å) | Theobald DL, Schultz SC | (2003) "Nucleotide Shuffling and Ssdna Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. | Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttggggt. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1ph2 | DNA binding protein-DNA | X-ray (3.1 Å) | Theobald DL, Schultz SC | (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. | Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttg. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1ph3 | DNA binding protein-DNA | X-ray (2.3 Å) | Theobald DL, Schultz SC | (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. | Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttggtg. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1ph4 | DNA binding protein-DNA | X-ray (2.3 Å) | Theobald DL, Schultz SC | (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. | Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttggcg. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1ph5 | DNA binding protein-DNA | X-ray (2.3 Å) | Theobald DL, Schultz SC | (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. | Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttg(3dr)gg. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1ph6 | DNA binding protein-DNA | X-ray (2.1 Å) | Theobald DL, Schultz SC | (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. | Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgtgg. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1ph7 | DNA binding protein-DNA | X-ray (2.9 Å) | Theobald DL, Schultz SC | (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. | Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgigg. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1ph8 | DNA binding protein-DNA | X-ray (2.36 Å) | Theobald DL, Schultz SC | (2003) "Nucleotide Shuffling and Ssdna Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. | Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgcgg. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1ph9 | DNA binding protein-DNA | X-ray (2.5 Å) | Theobald DL, Schultz SC | (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. | Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA ggggttttgagg. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1phj | DNA binding protein-DNA | X-ray (2.5 Å) | Theobald DL, Schultz SC | (2003) "Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes." Embo J., 22, 4314-4324. doi: 10.1093/emboj/cdg415. | Crystal structure of the oxytricha nova telomere end-binding protein complexed with noncognate ssDNA gg(3dr)gttttgggg. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1qdf | DNA | NMR | Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan S, Bolton PH | (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. doi: 10.1006/jmbi.1996.0408. | The NMR study of DNA quadruplex structure, aptamer (15mer) DNA. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 1qdh | DNA | NMR | Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan S, Bolton PH | (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. doi: 10.1006/jmbi.1996.0408. | The NMR study of DNA quadruplex structure, aptamer (15mer) DNA. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 1qdi | DNA | NMR | Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan S, Bolton PH | (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. doi: 10.1006/jmbi.1996.0408. | The NMR study of DNA quadruplex structure, (12mer) DNA. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1qdk | DNA | NMR | Marathias VM, Wang KY, Kumar S, Pham TQ, Swaminathan S, Bolton PH | (1996) "Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin." J.Mol.Biol., 260, 378-394. doi: 10.1006/jmbi.1996.0408. | The NMR study of DNA quadruplex structure, (12mer) DNA. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 1rau | RNA | NMR | Cheong C, Moore PB | (1992) "Solution structure of an unusually stable RNA tetraplex containing G- and U-quartet structures." Biochemistry, 31, 8406-8414. doi: 10.1021/bi00151a003. | Solution structure of an unusually stable RNA tetraplex containing g-and u-quartet structures. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 1rde | DNA | NMR | Mao X, Marky LA, Gmeiner WH | (2004) "NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+." J.Biomol.Struct.Dyn., 22, 25-33. | NMR structure of the thrombin-binding DNA aptamer stabilized by sr2+. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 1s45 | DNA | X-ray (2.2 Å) | Caceres C, Wright G, Gouyette C, Parkinson G, Subirana JA | (2004) "A Thymine tetrad in d(TGGGGT) quadruplexes stabilized with Tl+1/Na+1 ions." Nucleic Acids Res., 32, 1097-1102. doi: 10.1093/nar/gkh269. | Crystal structure analysis of the DNA quadruplex d(tggggt) s1. ➥ 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 1s47 | DNA | X-ray (2.5 Å) | Caceres C, Wright G, Gouyette C, Parkinson G, Subirana JA | (2004) "A Thymine tetrad in d(TGGGGT) quadruplexes stabilized with Tl+1/Na+1 ions." Nucleic Acids Res., 32, 1097-1102. doi: 10.1093/nar/gkh269. | Crystal structure analysis of the DNA quadruplex d(tggggt)s2. ➥ 12 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 1s9l | RNA | NMR | Randazzo A, Esposito V, Ohlenschlager O, Ramachandran R, Mayola L | (2004) "NMR solution structure of a parallel LNA quadruplex." Nucleic Acids Res., 32, 3083-3092. doi: 10.1093/nar/gkh629. | NMR solution structure of a parallel lna quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 1u64 | DNA | NMR | Sket P, Crnugelj M, Plavec J | (2004) "d(G3T4G4) forms unusual dimeric G-quadruplex structure with the same general fold in the presence of K+, Na+ or NH4+ ions." Bioorg.Med.Chem., 12, 5735-5744. doi: 10.1016/j.bmc.2004.08.009. | The solution structure of d(g3t4g4)2. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, (1+3), UDDD |
| 1v3p | DNA | X-ray (2.3 Å) | Kondo J, Adachi W, Umeda S, Sunami T, Takenaka A | (2004) "Crystal structures of a DNA octaplex with I-motif of G-quartets and its splitting into two quadruplexes suggest a folding mechanism of eight tandem repeats." Nucleic Acids Res., 32, 2541-2549. doi: 10.1093/nar/gkh575. | Crystal structure of d(gcgagagc): the DNA octaplex structure with i-motif of g-quartet. ➥ 2 G-tetrads, 1 G4 helix |
| 1xav | DNA | NMR | Ambrus A, Chen D, Dai J, Jones RA, Yang D | (2005) "Solution structure of the biologically relevant G-Quadruplex element in the human c-MYC promoter. Implications for G-quadruplex stabilization." Biochemistry, 44, 2048-2058. doi: 10.1021/bi048242p. | Major g-quadruplex structure formed in human c-myc promoter, a monomeric parallel-stranded quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 1xce | DNA | NMR | Webba da Silva M | (2005) "Experimental Demonstration of T:(G:G:G):T Hexad and T:A:A:T Tetrad Alignments within a DNA Quadruplex Stem." Biochemistry, 44, 3754-3764. doi: 10.1021/bi0478190. | Helica structure of DNA by design: the t(gggg)t hexad alignment. ➥ 4 G-tetrads, 2 G4 helices, 2 G4 stems, parallel(4+0), UUUU |
| 1y8d | DNA | NMR | Phan AT, Kuryavyi VV, Ma J-B, Faure A, Andreola M-L, Patel DJ | (2005) "An interlocked dimeric parallel-stranded DNA quadruplex: A potent inhibitor of HIV-1 integrase." Proc.Natl.Acad.Sci.USA, 102, 634-639. doi: 10.1073/pnas.0406278102. | Dimeric parallel-stranded tetraplex with 3+1 5' g-tetrad interface, single-residue chain reversal loops and gag triad in the context of a(gggg) pentad. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED |
| 201d | DNA | NMR | Wang Y, Patel DJ | (1995) "Solution structure of the Oxytricha telomeric repeat d[G4(T4G4)3] G-tetraplex." J.Mol.Biol., 251, 76-94. doi: 10.1006/jmbi.1995.0417. | Solution structure of the oxytricha telomeric repeat d[g4(t4g4)3] g-tetraplex. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-LwD+Ln), basket(2+2), UDDU |
| 230d | DNA | NMR | Smith FW, Schultze P, Feigon J | (1995) "Solution structures of unimolecular quadruplexes formed by oligonucleotides containing Oxytricha telomere repeats." Structure, 3, 997-1008. doi: 10.1016/S0969-2126(01)00236-2. | Solution structures of unimolecular quadruplexes formed by oligonucleotides containing oxytricha telomere repeats. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-LwD+Ln), basket(2+2), UDDU |
| 244d | DNA | X-ray (1.2 Å) | Laughlan G, Murchie AI, Norman DG, Moore MH, Moody PC, Lilley DM, Luisi B | (1994) "The high-resolution crystal structure of a parallel-stranded guanine tetraplex." Science, 265, 520-524. | The high-resolution crystal structure of a parallel-stranded guanine tetraplex. ➥ 16 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 2a5p | DNA | NMR | Phan AT, Kuryavyi V, Gaw HY, Patel DJ | (2005) "Small-molecule interaction with a five-guanine-tract G-quadruplex structure from the human MYC promoter." Nat.Chem.Biol., 1, 167-173. doi: 10.1038/nchembio723. | Monomeric parallel-stranded DNA tetraplex with snap-back 3+1 3' g-tetrad, single-residue chain reversal loops, gag triad in the context of gaag diagonal loop, NMR, 8 struct.. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 2a5r | DNA | NMR | Phan AT, Kuryavyi V, Gaw HY, Patel DJ | (2005) "Small-molecule interaction with a five-guanine-tract G-quadruplex structure from the human MYC promoter." Nat.Chem.Biol., 1, 167-173. doi: 10.1038/nchembio723. | Complex of tetra-(4-n-methylpyridyl) porphin with monomeric parallel-stranded DNA tetraplex, snap-back 3+1 3' g-tetrad, single-residue chain reversal loops, gag triad in the context of gaag diagonal loop, c-myc promoter, NMR, 6 struct.. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 2akg | DNA | NMR | Gill ML, Strobel SA, Loria JP | (2005) "(205)Tl NMR methods for the characterization of monovalent cation binding to nucleic acids." J.Am.Chem.Soc., 127, 16723-16732. doi: 10.1021/ja055358f. | Thallium form of the g-quadruplex from oxytricha nova, d(g4t4g4)2. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 2aqy | DNA | NMR | Zhang N, Phan AT, Patel DJ | (2005) "(3 + 1) Assembly of three human telomeric repeats into an asymmetric dimeric G-quadruplex." J.Am.Chem.Soc., 127, 17277-17285. doi: 10.1021/ja0543090. | (3+1) assembly of three human telomeric DNA repeats into an asymmetrical dimeric g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, (3+1), UUUD |
| 2avh | DNA | X-ray (1.5 Å) | Hazel P, Parkinson GN, Neidle S | (2006) "Topology variation and loop structural homology in crystal and simulated structures of a bimolecular DNA quadruplex." J.Am.Chem.Soc., 128, 5480-5487. doi: 10.1021/ja058577+. | G4t3g4 dimeric quadruplex structure. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD |
| 2avj | DNA | X-ray (2.39 Å) | Hazel P, Parkinson GN, Neidle S | (2006) "Topology variation and loop structural homology in crystal and simulated structures of a bimolecular DNA quadruplex." J.Am.Chem.Soc., 128, 5480-5487. doi: 10.1021/ja058577+. | G4(br)uttg4 dimeric quadruplex. ➥ 12 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, (2+2), UDDU; (2+2), UDUD; (2+2), UUDD, coaxial interfaces: mixed |
| 2awe | RNA | X-ray (2.1 Å) | Pan B, Shi K, Sundaralingam M | (2006) "Base-tetrad swapping results in dimerization of RNA quadruplexes: implications for formation of the i-motif RNA octaplex." Proc.Natl.Acad.Sci.Usa, 103, 3130-3134. doi: 10.1073/pnas.0507730103. | Base-tetrad swapping results in dimerization of RNA quadruplexes: implications for formation of i-motif RNA octaplex. ➥ 6 G-tetrads, 2 G4 helices, 2 G4 stems, parallel(4+0), UUUU |
| 2chj | nucleic acid | NMR | Nielsen JT, Arar K, Petersen M | (2006) "NMR Solution Structures of Lna (Locked Nucleic Acid) Modified Quadruplexes." Nucleic Acids Res., 34, 2006. doi: 10.1093/NAR/GKL144. | NMR structure of tglglt quadruplex. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 2chk | nucleic acid | NMR | Nielsen JT, Arar K, Petersen M | (2006) "NMR Solution Structures of Lna (Locked Nucleic Acid) Modified Quadruplexes." Nucleic Acids Res., 34, 2006. doi: 10.1093/NAR/GKL144. | NMR structure of tllllt quadruplex. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 2e4i | DNA | NMR | Matsugami A, Xu Y, Noguchi Y, Sugiyama H, Katahira M | (2007) "Structure of a human telomeric DNA sequence stabilized by 8-bromoguanosine substitutions, as determined by NMR in a K+ solution." Febs J., 274, 3545-3556. doi: 10.1111/j.1742-4658.2007.05881.x. | Human telomeric DNA mixed-parallel-antiparallel quadruplex under physiological ionic conditions stabilized by proper incorporation of 8-bromoguanosines. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 2f8u | DNA | NMR | Dai J, Chen D, Jones RA, Hurley LH, Yang D | (2006) "NMR solution structure of the major G-quadruplex structure formed in the human BCL2 promoter region." Nucleic Acids Res., 34, 5133-5144. doi: 10.1093/nar/gkl610. | G-quadruplex structure formed in human bcl-2 promoter, hybrid form. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 2gku | DNA | NMR | Luu KN, Phan AT, Kuryavyi VV, Lacroix L, Patel DJ | (2006) "Structure of the human telomere in k(+) solution: an intramolecular (3 + 1) g-quadruplex scaffold." J.Am.Chem.Soc., 128, 9963-9970. doi: 10.1021/ja062791w. | Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, NMR, 12 structures. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 2grb | RNA | X-ray (1.4 Å) | Pan B, Shi K, Sundaralingam M | (2006) "Crystal structure of an RNA quadruplex containing inosine tetrad: implications for the roles of NH2 group in purine tetrads." J.Mol.Biol., 363, 451-459. doi: 10.1016/j.jmb.2006.08.022. | Crystal structure of an RNA quadruplex containing inosine-tetrad. ➥ 8 G-tetrads, 2 G4 helices, 2 G4 stems, parallel(4+0), UUUU |
| 2gw0 | DNA | X-ray (1.55 Å) | Lee MP, Parkinson GN, Hazel P, Neidle S | (2007) "Observation of the coexistence of sodium and calcium ions in a DNA G-quadruplex ion channel." J.Am.Chem.Soc., 129, 10106-10107. doi: 10.1021/ja0740869. | A d(tggggt)- sodium and calcium complex.. ➥ 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 2gwe | DNA | X-ray (2.2 Å) | Lee MPH, Haider S, Parkinson GN, Neidle S | "Crystal structure of D(G4T4G4) with four and six quadruplexes in the asymmetric unit." | Crystal structure of d(g4t4g4) with six quadruplexes in the asymmetric unit.. ➥ 24 G-tetrads, 6 G4 helices, 6 G4 stems, (2+2), UDDU |
| 2gwq | DNA | X-ray (2.0 Å) | Lee MPH, Haider S, Parkinson GN, Neidle S | "Crystal structure of D(G4T4G4) with four and six quadruplexes in the asymmetric unit." | Crystal structure of d(g4t4g4) with four quadruplexes in the asymmetric unit.. ➥ 16 G-tetrads, 4 G4 helices, 4 G4 stems, (2+2), UDDU |
| 2hbn | DNA | X-ray (1.55 Å) | Gill ML, Strobel SA, Loria JP | (2006) "Crystallization and characterization of the thallium form of the Oxytricha nova G-quadruplex." Nucleic Acids Res., 34, 4506-4514. doi: 10.1093/nar/gkl616. | Crystallization of the tl+-form of the oxytricha nova g-quadruplex. ➥ 8 G-tetrads, 2 G4 helices, 2 G4 stems, (2+2), UDDU |
| 2hri | DNA | X-ray (2.09 Å) | Parkinson GN, Ghosh R, Neidle S | (2007) "Structural basis for binding of porphyrin to human telomeres." Biochemistry, 46, 2390-2397. doi: 10.1021/bi062244n. | A parallel stranded human telomeric quadruplex in complex with the porphyrin tmpyp4. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 2hy9 | DNA | NMR | Dai J, Punchihewa C, Ambrus A, Chen D, Jones RA, Yang D | (2007) "Structure of the intramolecular human telomeric G-quadruplex in potassium solution: a novel adenine triple formation." Nucleic Acids Res., 35, 2440-2450. doi: 10.1093/nar/gkm009. | Human telomere DNA quadruplex structure in k+ solution hybrid-1 form. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 2idn | DNA | NMR | Martino L, Virno A, Randazzo A, Virgilio A, Esposito V, Giancola C, Bucci M, Cirino G, Mayol L | (2006) "A new modified thrombin binding aptamer containing a 5'-5' inversion of polarity site." Nucleic Acids Res., 34, 6653-6662. doi: 10.1093/nar/gkl915. | NMR structure of a new modified thrombin binding aptamer containing a 5'-5' inversion of polarity site. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Lm+Lw+Ln), UD3(1+3), DDUD |
| 2jpz | DNA | NMR | Dai J, Carver M, Punchihewa C, Jones RA, Yang D | (2007) "Structure of the Hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: insights into structure polymorphism of the human telomeric sequence." Nucleic Acids Res., 35, 4927-4940. doi: 10.1093/nar/gkm522. | Human telomere DNA quadruplex structure in k+ solution hybrid-2 form. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 2jsk | DNA | NMR | Phan AT, Kuryavyi V, Luu KN, Patel DJ | (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. doi: 10.1093/nar/gkm706. | Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, 16 g form 1, NMR, 10 structures. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 2jsl | DNA | NMR | Phan AT, Kuryavyi V, Luu KN, Patel DJ | (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. doi: 10.1093/nar/gkm706. | Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, form 2 natural, NMR, 10 structures. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 2jsm | DNA | NMR | Phan AT, Kuryavyi V, Luu KN, Patel DJ | (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. doi: 10.1093/nar/gkm706. | Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, NMR, 10 structures, form 1 natural. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 2jsq | DNA | NMR | Phan AT, Kuryavyi V, Luu KN, Patel DJ | (2007) "Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution." Nucleic Acids Res., 35, 6517-6525. doi: 10.1093/nar/gkm706. | Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, form 2 15brg, NMR, 10 structures. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 2jt7 | DNA | NMR | Martino L, Virno A, Pagano B, Virgilio A, Di Micco S, Galeone A, Giancola C, Bifulco G, Mayol L, Randazzo A | (2007) "Structural and thermodynamic studies of the interaction of distamycin A with the parallel quadruplex structure [d(TGGGGT)]4." J.Am.Chem.Soc., 129, 16048-16056. doi: 10.1021/ja075710k. | NMR solution structure of the 4:1 distamycin a-[d(tggggt)]4 complex. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 2jwq | DNA | NMR | Hounsou C, Guittat L, Monchaud D, Jourdan M, Saettel N, Mergny JL, Teulade-Fichou M | (2007) "G-Quadruplex Recognition by Quinacridines: a SAR, NMR, and Biological Study." ChemMedChem, 2, 655-666. doi: 10.1002/cmdc.200600286. | G-quadruplex recognition by quinacridines: a sar, NMR and biological study. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 2kaz | DNA | NMR | Balkwill GD, Garner TP, Williams HE, Searle MS | (2009) "Folding topology of a bimolecular DNA quadruplex containing a stable mini-hairpin motif within the diagonal loop." J.Mol.Biol., 385, 1600-1615. doi: 10.1016/j.jmb.2008.11.050. | Folding topology of a bimolecular DNA quadruplex containing a stable mini-hairpin motif within the connecting loop. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UUDD |
| 2kbp | RNA | NMR | Martadinata H, Phan AT | (2009) "Structure of propeller-type parallel-stranded RNA G-quadruplexes, formed by human telomeric RNA sequences in K+ solution." J.Am.Chem.Soc., 131, 2570-2578. doi: 10.1021/ja806592z. | Solution structure of a g-quadruplex of human telomeric RNA. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 2kf7 | DNA | NMR | Lim KW, Amrane S, Bouaziz S, Xu W, Mu Y, Patel DJ, Luu KN, Phan AT | (2009) "Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers." J.Am.Chem.Soc., 131, 4301-4309. doi: 10.1021/ja807503g. | Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by human telomeric repeats in k+ solution (with g7-to-brg substitution). ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU |
| 2kf8 | DNA | NMR | Lim KW, Amrane S, Bouaziz S, Xu W, Mu Y, Patel DJ, Luu KN, Phan AT | (2009) "Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers." J.Am.Chem.Soc., 131, 4301-4309. doi: 10.1021/ja807503g. | Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by human telomeric repeats in k+ solution. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU |
| 2kka | DNA | NMR | Zhang Z, Dai J, Veliath E, Jones RA, Yang D | (2010) "Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution: insights into the interconversion of human telomeric G-quadruplex structures." Nucleic Acids Res., 38, 1009-1021. doi: 10.1093/nar/gkp1029. | Human telomere DNA two-tetrad quadruplex structure in k+ solution. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU |
| 2km3 | DNA | NMR | Lim KW, Alberti P, Guedin A, Lacroix L, Riou JF, Royle NJ, Mergny JL, Phan AT | (2009) "Sequence variant (CTAGGG)n in the human telomere favors a G-quadruplex structure containing a G.C.G.C tetrad." Nucleic Acids Res., 37, 6239-6248. doi: 10.1093/nar/gkp630. | Structure of an intramolecular g-quadruplex containing a g.c.g.c tetrad formed by human telomeric variant ctaggg repeats. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 2kow | DNA | NMR | Hu L, Lim KW, Bouaziz S, Phan AT | (2009) "Giardia Telomeric Sequence d(TAGGG)(4) Forms Two Intramolecular G-Quadruplexes in K(+) Solution: Effect of Loop Length and Sequence on the Folding Topology." J.Am.Chem.Soc., 131, 16824-16831. doi: 10.1021/ja905611c. | Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by giardia telomeric repeat d(taggg)4 in k+ solution (with g18-to-ino substitution). ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+LnD-Lw), basket(2+2), UUDD |
| 2kpr | DNA | NMR | Kuryavyi V, Patel DJ | (2010) "Solution Structure of a Unique G-Quadruplex Scaffold Adopted by a Guanosine-Rich Human Intronic Sequence." Structure, 18, 73-82. doi: 10.1016/j.str.2009.10.015. | Monomeric intronic human chl1 gene quadruplex DNA NMR, 17 structures. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD |
| 2kqg | DNA | NMR | Hsu S-TD, Varnai P, Bugaut A, Reszka AP, Neidle S, Balasubramanian S | (2009) "A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics." J.Am.Chem.Soc., 131, 13399-13409. doi: 10.1021/ja904007p. | A g-rich sequence within the c-kit oncogene promoter forms a parallel g-quadruplex having asymmetric g-tetrad dynamics. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2kqh | DNA | NMR | Hsu S-TD, Varnai P, Bugaut A, Reszka AP, Neidle S, Balasubramanian S | (2009) "A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics." J.Am.Chem.Soc., 131, 13399-13409. doi: 10.1021/ja904007p. | A g-rich sequence within the c-kit oncogene promoter forms a parallel g-quadruplex having asymmetric g-tetrad dynamics. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2kvy | DNA | NMR | Cosconati S, Marinelli L, Trotta R, Virno A, De Tito S, Romagnoli R, Pagano B, Limongelli V, Giancola C, Baraldi PG, Mayol L, Novellino E, Randazzo A | (2010) "Structural and conformational requisites in DNA quadruplex groove binding: another piece to the puzzle." J.Am.Chem.Soc., 132, 6425-6433. doi: 10.1021/ja1003872. | NMR solution structure of the 4:1 complex between an uncharged distamycin a analogue and [d(tggggt)]4. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 2kyo | DNA | NMR | Kuryavyi V, Phan AT, Patel DJ | (2010) "Solution structures of all parallel-stranded monomeric and dimeric G-quadruplex scaffolds of the human c-kit2 promoter." Nucleic Acids Res., 38, 6757-6773. doi: 10.1093/nar/gkq558. | Dimeric human ckit-2 proto-oncogene promoter quadruplex DNA NMR, 10 structures. ➥ 6 G-tetrads, 2 G4 helices, 2 G4 stems, parallel(4+0), UUUU |
| 2kyp | DNA | NMR | Kuryavyi V, Phan AT, Patel DJ | (2010) "Solution structures of all parallel-stranded monomeric and dimeric G-quadruplex scaffolds of the human c-kit2 promoter." Nucleic Acids Res., 38, 6757-6773. doi: 10.1093/nar/gkq558. | Monomeric human ckit-2 proto-oncogene promoter quadruplex DNA NMR, 12 structures. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2kzd | DNA | NMR | Lim KW, Lacroix L, Yue DJE, Lim JKC, Lim JMW, Phan AT | (2010) "Coexistence of two distinct G-quadruplex conformations in the hTERT promoter." J.Am.Chem.Soc., 132, 12331-12342. doi: 10.1021/ja101252n. | Structure of a (3+1) g-quadruplex formed by htert promoter sequence. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 2kze | DNA | NMR | Lim KW, Lacroix L, Yue DJE, Lim JKC, Lim JMW, Phan AT | (2010) "Coexistence of two distinct G-quadruplex conformations in the hTERT promoter." J.Am.Chem.Soc., 132, 12331-12342. doi: 10.1021/ja101252n. | Structure of an all-parallel-stranded g-quadruplex formed by htert promoter sequence. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2l7v | DNA-inhibitor | NMR | Dai J, Carver M, Hurley LH, Yang D | (2011) "Solution Structure of a 2:1 Quindoline-c-MYC G-Quadruplex: Insights into G-Quadruplex-Interactive Small Molecule Drug Design." J.Am.Chem.Soc., 133, 17673-17680. doi: 10.1021/ja205646q. | Quindoline-g-quadruplex complex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2l88 | DNA | NMR | Tong X, Lan W, Zhang X, Wu H, Liu M, Cao C | (2011) "Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence." Nucleic Acids Res., 39, 6753-6763. doi: 10.1093/nar/gkr233. | Solution structure of all parallel g-quadruplex formed by the oncogene ret promoter sequence. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2la5 | RNA binding protein-RNA | NMR | Phan AT, Kuryavyi V, Darnell JC, Serganov A, Majumdar A, Ilin S, Raslin T, Polonskaia A, Chen C, Clain D, Darnell RB, Patel DJ | (2011) "Structure-function studies of FMRP RGG peptide recognition of an RNA duplex-quadruplex junction." Nat.Struct.Mol.Biol., 18, 796-804. doi: 10.1038/nsmb.2064. | RNA duplex-quadruplex junction complex with fmrp rgg peptide. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 2lby | DNA | NMR | Mathad RI, Hatzakis E, Dai J, Yang D | (2011) "c-MYC promoter G-quadruplex formed at the 5'-end of NHE III1 element: insights into biological relevance and parallel-stranded G-quadruplex stability." Nucleic Acids Res., 39, 9023-9033. doi: 10.1093/nar/gkr612. | G-quadruplex structure formed at the 5'-end of nheiii_1 element in human c-myc promoter. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2ld8 | DNA | NMR | Heddi B, Phan AT | (2011) "Structure of Human Telomeric DNA in Crowded Solution." J.Am.Chem.Soc. doi: 10.1021/ja200786q. | Structure of human telomeric DNA in crowded solution. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2le6 | DNA | NMR | Do NQ, Lim KW, Teo MH, Heddi B, Phan AT | (2011) "Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity." Nucleic Acids Res. doi: 10.1093/nar/gkr539. | Structure of a dimeric all-parallel-stranded g-quadruplex stacked via the 5'-to-5' interface. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 2led | DNA | NMR | Trajkovski M, Webba da Silva M, Plavec J | (2012) "Unique Structural Features of Interconverting Monomeric and Dimeric G-Quadruplexes Adopted by a Sequence from the Intron of the N-myc Gene." J.Am.Chem.Soc., 134, 4132-4141. doi: 10.1021/ja208483v. | Unique structural features of interconverting monomeric and dimeric g-quadruplexes adopted by a sequence from intron of n-myc gene. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/5' |
| 2lee | DNA | NMR | Trajkovski M, Webba da Silva M, Plavec J | (2012) "Unique Structural Features of Interconverting Monomeric and Dimeric G-Quadruplexes Adopted by a Sequence from the Intron of the N-myc Gene." J.Am.Chem.Soc., 134, 4132-4141. doi: 10.1021/ja208483v. | Unique structural features of interconverting monomeric and dimeric g-quadruplexes adopted by a sequence from intron of n-myc gene. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2lk7 | DNA | NMR | Do NQ, Phan AT | (2012) "Monomer-Dimer Equilibrium for the 5'-5' Stacking of Propeller-Type Parallel-Stranded G-Quadruplexes: NMR Structural Study." Chemistry. doi: 10.1002/chem.201103295. | Monomer-dimer equilibrium for 5'-5' stacking of propeller-type parallel-stranded g-quadruplexes: NMR structural study. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2lod | DNA | NMR | Marusic M, Sket P, Bauer L, Viglasky V, Plavec J | (2012) "Solution-state structure of an intramolecular G-quadruplex with propeller, diagonal and edgewise loops." Nucleic Acids Res., 40, 6946-6956. doi: 10.1093/nar/gks329. | Solution-state structure of an intramolecular g-quadruplex with propeller, diagonal and edgewise loops. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-PD+Lw), U3D(3+1), UUUD |
| 2lpw | DNA | NMR | Amrane S, Adrian M, Heddi B, Serero A, Nicolas A, Mergny JL, Phan AT | (2012) "Formation of Pearl-Necklace Monomorphic G-Quadruplexes in the Human CEB25 Minisatellite." J.Am.Chem.Soc., 134, 5807-5816. doi: 10.1021/ja208993r. | Human ceb25 minisatellite g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2lxq | DNA | NMR | Kuryavyi V, Cahoon LA, Seifert HS, Patel DJ | (2012) "RecA-Binding pilE G4 Sequence Essential for Pilin Antigenic Variation Forms Monomeric and 5' End-Stacked Dimeric Parallel G-Quadruplexes." Structure, 20, 2090-2102. doi: 10.1016/j.str.2012.09.013. | Monomeric pile g-quadruplex DNA from neisseria gonorrhoeae. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2lxv | DNA | NMR | Kuryavyi V, Cahoon LA, Seifert HS, Patel DJ | (2012) "RecA-Binding pilE G4 Sequence Essential for Pilin Antigenic Variation Forms Monomeric and 5' End-Stacked Dimeric Parallel G-Quadruplexes." Structure, 20, 2090-2102. doi: 10.1016/j.str.2012.09.013. | Dimeric pil-e g-quadruplex DNA from neisseria gonorrhoeae, NMR 11 structures. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 2lyg | DNA | NMR | Gomez-Pinto I, Vengut-Climent E, Lucas R, Avino A, Eritja R, Gonzalez C, Morales JC | (2013) "Carbohydrate-DNA interactions at G-quadruplexes: folding and stability changes by attaching sugars at the 5'-end." Chemistry, 19, 1920-1927. doi: 10.1002/chem.201203902. | Fuc_tba. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 2m18 | RNA | NMR | Martadinata H, Phan AT | (2013) "Structure of Human Telomeric RNA (TERRA): Stacking of Two G-Quadruplex Blocks in K(+) Solution." Biochemistry, 52, 2176-2183. doi: 10.1021/bi301606u. | Structure of stacked g-quadruplex formed by human terra sequence in potassium solution. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 2m1g | DNA | NMR | Martin-Pintado N, Yahyaee-Anzahaee M, Deleavey GF, Portella G, Orozco M, Damha MJ, Gonzalez C | (2013) "Dramatic effect of furanose c2' substitution on structure and stability: directing the folding of the human telomeric quadruplex with a single fluorine atom." J.Am.Chem.Soc., 135, 5344-5347. doi: 10.1021/ja401954t. | Parallel human telomeric quadruplex containing 2'f-ana substitutions. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 2m27 | DNA | NMR | Agrawal P, Hatzakis E, Guo K, Carver M, Yang D | (2013) "Solution structure of the major G-quadruplex formed in the human VEGF promoter in K+: insights into loop interactions of the parallel G-quadruplexes." Nucleic Acids Res., 41, 10584-10592. doi: 10.1093/nar/gkt784. | Major g-quadruplex structure formed in human vegf promoter, a monomeric parallel-stranded quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2m4p | DNA | NMR | Mukundan VT, Phan AT | (2013) "Bulges in G-Quadruplexes: Broadening the Definition of G-Quadruplex-Forming Sequences." J.Am.Chem.Soc., 135, 5017-5028. doi: 10.1021/ja310251r. | Solution structure of an intramolecular propeller-type g-quadruplex containing a single bulge. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2m53 | DNA | NMR | Marusic M, Veedu RN, Wengel J, Plavec J | (2013) "G-rich VEGF aptamer with locked and unlocked nucleic acid modifications exhibits a unique G-quadruplex fold." Nucleic Acids Res., 41, 9524-9536. doi: 10.1093/nar/gkt697. | G-rich vegf aptamer with lna modifications. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 2m6v | DNA | NMR | Dvorkin SA, Karsisiotis AI, Webba da Silva M | (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. | Solution NMR structure of the d(gggttgggttttgggtggg) quadruplex in sodium conditions. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU |
| 2m6w | DNA | NMR | Dvorkin SA, Karsisiotis AI, Webba da Silva M | (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. | Solution NMR structure of the d(ggggttggggttttggggaagggg) quadruplex in sodium conditions. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-LwD+Ln), basket(2+2), UDDU |
| 2m8z | DNA | NMR | Lim KW, Phan AT | (2013) "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995. | Structure of d[ggttggcgcgaagcattcgcgggttgg] quadruplex-duplex hybrid. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 2m90 | DNA | NMR | Lim KW, Phan AT | (2013) "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995. | Structure of d[gcgcgaagcattcgcggggaggtggggaaggg] quadruplex-duplex hybrid. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 2m91 | DNA | NMR | Lim KW, Phan AT | (2013) "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995. | Structure of d[gggaagggcgcgaagcattcgcgaggtagg] quadruplex-duplex hybrid. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU |
| 2m92 | DNA | NMR | Lim KW, Phan AT | (2013) "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995. | Structure of d[agggtgggtgctggggcgcgaagcattcgcgagg] quadruplex-duplex hybrid. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PX+P), parallel(4+0), UUUU |
| 2m93 | DNA | NMR | Lim KW, Phan AT | (2013) "Structural basis of DNA quadruplex-duplex junction formation." Angew.Chem.Int.Ed.Engl., 52, 8566-8569. doi: 10.1002/anie.201302995. | Structure of d[ttgggtgggcgcgaagcattcgcggggtgggt] quadruplex-duplex hybrid. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2may | DNA | NMR | Li Z, Lech C, Adrian M, Heddi B, Phan AT | "Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes." | Structure of a g-quadruplex containing a single lna modification. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 2mb2 | DNA | NMR | Sengar A, Heddi B, Phan AT | (2014) "Formation of g-quadruplexes in poly-g sequences: structure of a propeller-type parallel-stranded g-quadruplex formed by a g15 stretch." Biochemistry, 53, 7718-7723. doi: 10.1021/bi500990v. | Parallel-stranded g-quadruplex in DNA poly-g stretches. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2mb3 | DNA-DNA inhibitor | NMR | Chung WJ, Heddi B, Tera M, Iida K, Nagasawa K, Phan AT | (2013) "Solution structure of an intramolecular (3 + 1) human telomeric g-quadruplex bound to a telomestatin derivative." J.Am.Chem.Soc., 135, 13495-13501. doi: 10.1021/ja405843r. | Solution structure of an intramolecular (3+1) human telomeric g-quadruplex bound to a telomestatin derivative. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 2mb4 | DNA | NMR | Adrian M, Ang DJ, Lech CJ, Heddi B, Nicolas A, Phan AT | (2014) "Structure and Conformational Dynamics of a Stacked Dimeric G-Quadruplex Formed by the Human CEB1 Minisatellite." J.Am.Chem.Soc., 136, 6297-6305. doi: 10.1021/ja4125274. | Solution structure of a stacked dimeric g-quadruplex formed by a segment of the human ceb1 minisatellite. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 2mbj | DNA | NMR | Lim KW, Ng VC, Martin-Pintado N, Heddi B, Phan AT | (2013) "Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity." Nucleic Acids Res., 41, 10556-10562. doi: 10.1093/nar/gkt771. | Structure of an antiparallel (2+2) g-quadruplex formed by human telomeric repeats in na+ solution (with g22-to-brg substitution). ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+Ln+P+Lw), (2+2), UUDD |
| 2mcc | DNA | NMR | Wilson T, Costa PJ, Felix V, Williamson MP, Thomas JA | (2013) "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence." J.Med.Chem., 56, 8674-8683. doi: 10.1021/jm401119b. | Structural studies on dinuclear ruthenium(ii) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-LwD+Ln), basket(2+2), UDDU |
| 2mco | DNA | NMR | Wilson T, Costa PJ, Felix V, Williamson MP, Thomas JA | (2013) "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence." J.Med.Chem., 56, 8674-8683. doi: 10.1021/jm401119b. | Structural studies on dinuclear ruthenium(ii) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-LwD+Ln), basket(2+2), UDDU |
| 2mft | DNA | NMR | Karsisiotis AI, Webba da Silva M | "Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions." | Solution NMR structure of the d(gggttttgggtgggttttggg) quadruplex in sodium conditions. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(D+PD), (2+2), UDDU |
| 2mfu | DNA | NMR | Karsisiotis A, Dillon P, Webba da Silva M | "Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions." | Solution NMR structure of quadruplex d(tgggtttgggttgggtttggg) in sodium conditions. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 2mgn | DNA | NMR | Chung WJ, Heddi B, Hamon F, Teulade-Fichou MP, Phan AT | (2014) "Solution Structure of a G-quadruplex Bound to the Bisquinolinium Compound Phen-DC3." Angew.Chem.Int.Ed.Engl., 53, 999-1002. doi: 10.1002/anie.201308063. | Solution structure of a g-quadruplex bound to the bisquinolinium compound phen-dc3. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 2ms6 | DNA | NMR | Tawani A, Kumar A | (2015) "Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence." Sci Rep, 5, 17574. doi: 10.1038/srep17574. | Human telomeric g-quadruplex DNA sequence (ttagggt)4 complexed with flavonoid quercetin. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 2ms9 | DNA | NMR | Chung WJ, Heddi B, Schmitt E, Lim KW, Mechulam Y, Phan AT | (2015) "Structure of a left-handed DNA G-quadruplex." Proc.Natl.Acad.Sci.USA. | Solution structure of a g-quadruplex. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+P+P+P), parallel(4+0), UUUU, negative twist |
| 2mwz | DNA | NMR | Cheong VV, Heddi B, Lech CJ, Phan AT | (2015) "Xanthine and 8-oxoguanine in G-quadruplexes: formation of a GGXO tetrad." Nucleic Acids Res., 43, 10506-10514. doi: 10.1093/nar/gkv826. | Xanthine and 8-oxoguanine in g-quadruplexes: formation of a g g x o tetrad. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 2n21 | hydrolase-DNA | NMR | Heddi B, Cheong VV, Martadinata H, Phan AT | (2015) "Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex." Proc.Natl.Acad.Sci.USA, 112, 9608-9613. doi: 10.1073/pnas.1422605112. | Solution structure of complex between DNA g-quadruplex and g-quadruplex recognition domain of rhau. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2n2d | DNA | NMR | Brcic J, Plavec J | (2015) "Solution structure of a DNA quadruplex containing ALS and FTD related GGGGCC repeat stabilized by 8-bromodeoxyguanosine substitution." Nucleic Acids Res., 43, 8590-8600. doi: 10.1093/nar/gkv815. | Structure of DNA g-quadruplex adopted by als and ftd related ggggcc repeat with g21 to br-g21 substitution. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(+Ln+Lw+Ln), chair(2+2), UDUD |
| 2n3m | DNA | NMR | Do NQ, Chung WJ, Truong THA, Heddi B, Phan AT | "G-quadruplex structure of an anti-proliferative DNA sequence." | G-quadruplex structure of an anti-proliferative DNA sequence. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 3'/5' |
| 2n4y | DNA | NMR | De Nicola B, Lech CJ, Heddi B, Regmi S, Frasson I, Perrone R, Richter SN, Phan AT | (2016) "Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome." Nucleic Acids Res., 44, 6442-6451. doi: 10.1093/nar/gkw432. | Structure and possible function of a g-quadruplex in the long terminal repeat of the proviral hiv-1 genome. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 2n60 | DNA | NMR | Heddi B, Martin-Pintado N, Serimbetov Z, Kari TM, Phan AT | (2016) "G-quadruplexes with (4n - 1) guanines in the G-tetrad core: formation of a G-triadwater complex and implication for small-molecule binding." Nucleic Acids Res., 44, 910-916. doi: 10.1093/nar/gkv1357. | G-quadruplexes with (4n-1) guanines in the g-tetrad core: formation of a g-triad water complex and implication for small-molecule binding. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 2n6c | DNA | NMR | Kumar A, Tawani A | "Solution structure for quercetin complexed with c-myc G-quadruplex DNA." | Solution structure for quercetin complexed with c-myc g-quadruplex DNA. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 2n9q | DNA | NMR | Thevarpadam J, Bessi I, Binas O, Goncalves DP, Slavov C, Jonker HR, Richter C, Wachtveitl J, Schwalbe H, Heckel A | (2016) "Photoresponsive Formation of an Intermolecular Minimal G-Quadruplex Motif." Angew.Chem.Int.Ed.Engl., 55, 2738-2742. doi: 10.1002/anie.201510269. | Photoswitchable g-quadruplex. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, (2+2), UDUD, coaxial interfaces: mixed |
| 2o3m | DNA | NMR | Phan AT, Kuryavyi VV, Burge S, Neidle S, Patel DJ | (2007) "Structure of an unprecedented G-quadruplex scaffold in the human c-kit promoter." J.Am.Chem.Soc., 129, 4386-4392. doi: 10.1021/ja068739h. | Monomeric g-DNA tetraplex from human c-kit promoter. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PX+P), parallel(4+0), UUUU |
| 2o4f | DNA | X-ray (1.5 Å) | Creze C, Rinaldi B, Haser R, Bouvet P, Gouet P | (2007) "Structure of a d(TGGGGT) quadruplex crystallized in the presence of Li+ ions." Acta Crystallogr.,Sect.D, 63, 682-688. doi: 10.1107/S0907444907013315. | Structure of a parallel-stranded guanine tetraplex crystallised with monovalent ions. ➥ 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 2rqj | RNA | NMR | Mashima T, Matsugami A, Nishikawa F, Nishikawa S, Katahira M | (2009) "Unique quadruplex structure and interaction of an RNA aptamer against bovine prion protein." Nucleic Acids Res., 37, 6249-6258. doi: 10.1093/nar/gkp647. | Quadruplex structure of an RNA aptamer against bovine prion protein. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 2rsk | membrane protein-RNA | NMR | Mashima T, Nishikawa F, Kamatari YO, Fujiwara H, Saimura M, Nagata T, Kodaki T, Nishikawa S, Kuwata K, Katahira M | (2013) "Anti-prion activity of an RNA aptamer and its structural basis." Nucleic Acids Res., 41, 1355-1362. doi: 10.1093/nar/gks1132. | RNA aptamer against prion protein in complex with the partial binding peptide. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 2ru7 | membrane protein-RNA | NMR | Hayashi T, Oshima H, Mashima T, Nagata T, Katahira M, Kinoshita M | (2014) "Binding of an RNA aptamer and a partial peptide of a prion protein: crucial importance of water entropy in molecular recognition." Nucleic Acids Res., 42, 6861-6875. doi: 10.1093/nar/gku382. | Refined structure of RNA aptamer in complex with the partial binding peptide of prion protein. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 2wcn | DNA | NMR | Nielsen JT, Arar K, Petersen M | (2009) "Solution Structure of a Locked Nucleic Acid Modified Quadruplex: Introducing the V4 Folding Topology." Angew.Chem.Int.Ed.Engl., 48, 3099. doi: 10.1002/ANIE.200806244. | Solution structure of an lna-modified quadruplex. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD |
| 352d | DNA | X-ray (0.95 Å) | Phillips K, Dauter Z, Murchie AI, Lilley DM, Luisi B | (1997) "The crystal structure of a parallel-stranded guanine tetraplex at 0.95 A resolution." J.Mol.Biol., 273, 171-182. doi: 10.1006/jmbi.1997.1292. | The crystal structure of a parallel-stranded parallel-stranded guanine tetraplex at 0.95 angstrom resolution. ➥ 16 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 3cco | DNA | X-ray (2.2 Å) | Parkinson GN, Cuenca F, Neidle S | (2008) "Topology conservation and loop flexibility in quadruplex-drug recognition: crystal structures of inter- and intramolecular telomeric DNA quadruplex-drug complexes." J.Mol.Biol., 381, 1145-1156. doi: 10.1016/j.jmb.2008.06.022. | Structural adaptation and conservation in quadruplex-drug recognition. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 3cdm | DNA | X-ray (2.1 Å) | Parkinson GN, Cuenca F, Neidle S | (2008) "Topology conservation and loop flexibility in quadruplex-drug recognition: crystal structures of inter- and intramolecular telomeric DNA quadruplex-drug complexes." J.Mol.Biol., 381, 1145-1156. doi: 10.1016/j.jmb.2008.06.022. | Structural adaptation and conservation in quadruplex-drug recognition. ➥ 6 G-tetrads, 2 G4 helices, 2 G4 stems, 3(-P-P-P), parallel(4+0), UUUU |
| 3ce5 | DNA | X-ray (2.5 Å) | Campbell NH, Parkinson GN, Reszka AP, Neidle S | (2008) "Structural basis of DNA quadruplex recognition by an acridine drug." J.Am.Chem.Soc., 130, 6722-6724. doi: 10.1021/ja8016973. | A bimolecular parallel-stranded human telomeric quadruplex in complex with a 3,6,9-trisubstituted acridine molecule braco19. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 3em2 | DNA | X-ray (2.3 Å) | Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S | (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. | A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6038. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 3eqw | DNA | X-ray (2.2 Å) | Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S | (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. | A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6042 in small unit cell. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 3eru | DNA | X-ray (2.0 Å) | Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S | (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. | A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6045. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 3es0 | DNA | X-ray (2.2 Å) | Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S | (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. | A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6048. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 3et8 | DNA | X-ray (2.45 Å) | Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S | (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. | A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6054. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 3eui | DNA | X-ray (2.2 Å) | Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S | (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. | A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6042 in a large unit cell. ➥ 8 G-tetrads, 2 G4 helices, 2 G4 stems, (2+2), UDDU |
| 3eum | DNA | X-ray (1.78 Å) | Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S | (2009) "Selectivity in Ligand Recognition of G-Quadruplex Loops." Biochemistry, 48, 1675-1680. doi: 10.1021/bi802233v. | A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine bsu-6066. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 3ibk | RNA | X-ray (2.2 Å) | Collie GW, Haider SM, Neidle S, Parkinson GN | (2010) "A crystallographic and modelling study of a human telomeric RNA (TERRA) quadruplex." Nucleic Acids Res., 38, 5569-5580. doi: 10.1093/nar/gkq259. | Crystal structure of a telomeric RNA quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 3mij | RNA | X-ray (2.6 Å) | Collie GW, Sparapani S, Parkinson GN, Neidle S | (2011) "Structural basis of telomeric RNA quadruplex-acridine ligand recognition." J.Am.Chem.Soc., 133, 2721-2728. doi: 10.1021/ja109767y. | Crystal structure of a telomeric RNA g-quadruplex complexed with an acridine-based ligand.. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 3nyp | DNA | X-ray (1.179 Å) | Campbell NH, Smith DL, Reszka AP, Neidle S, O'Hagan D | (2011) "Fluorine in medicinal chemistry: beta-fluorination of peripheral pyrrolidines attached to acridine ligands affects their interactions with G-quadruplex DNA." Org.Biomol.Chem., 9, 1328-1331. doi: 10.1039/c0ob00886a. | A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine ligand containing bis-3-fluoropyrrolidine end side chains. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 3nz7 | DNA | X-ray (1.1 Å) | Campbell NH, Smith DL, Reszka AP, Neidle S, O'Hagan D | (2011) "Fluorine in medicinal chemistry: beta-fluorination of peripheral pyrrolidines attached to acridine ligands affects their interactions with G-quadruplex DNA." Org.Biomol.Chem., 9, 1328-1331. doi: 10.1039/c0ob00886a. | A bimolecular anti-parallel-stranded oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine ligand containing bis-3-fluoropyrrolidine end side chains. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 3qcr | DNA | X-ray (3.2 Å) | Collie GW, Sparapani S, Parkinson GN, Neidle S | (2011) "Structural basis of telomeric RNA quadruplex-acridine ligand recognition." J.Am.Chem.Soc., 133, 2721-2728. doi: 10.1021/ja109767y. | Incomplete structural model of a human telomeric DNA quadruplex-acridine complex.. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 3qlp | hydrolase-hydrolase inhibitor-DNA | X-ray (2.14 Å) | Russo Krauss I, Merlino A, Giancola C, Randazzo A, Mazzarella L, Sica F | (2011) "Thrombin-aptamer recognition: a revealed ambiguity." Nucleic Acids Res., 39, 7858-7867. doi: 10.1093/nar/gkr522. | X-ray structure of the complex between human alpha thrombin and a modified thrombin binding aptamer (mtba). ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Lm+Lw+Ln), UD3(1+3), DDUD |
| 3qsc | DNA | X-ray (2.4 Å) | Campbell NH, Karim NH, Parkinson GN, Gunaratnam M, Petrucci V, Todd AK, Vilar R, Neidle S | (2012) "Molecular basis of structure-activity relationships between salphen metal complexes and human telomeric DNA quadruplexes." J.Med.Chem., 55, 209-222. doi: 10.1021/jm201140v. | The first crystal structure of a human telomeric g-quadruplex DNA bound to a metal-containing ligand (a copper complex). ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 3qsf | DNA | X-ray (2.4 Å) | Campbell NH, Karim NH, Parkinson GN, Gunaratnam M, Petrucci V, Todd AK, Vilar R, Neidle S | (2012) "Molecular basis of structure-activity relationships between salphen metal complexes and human telomeric DNA quadruplexes." J.Med.Chem., 55, 209-222. doi: 10.1021/jm201140v. | The first crystal structure of a human telomeric g-quadruplex DNA bound to a metal-containing ligand (a nickel complex). ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 3qxr | DNA | X-ray (1.62 Å) | Wei D, Parkinson GN, Reszka AP, Neidle S | (2012) "Crystal structure of a c-kit promoter quadruplex reveals the structural role of metal ions and water molecules in maintaining loop conformation." Nucleic Acids Res., 40, 4691-4700. doi: 10.1093/nar/gks023. | Crystal structure of the brominated ckit-1 proto-oncogene promoter quadruplex DNA. ➥ 6 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-PX+P), parallel(4+0), UUUU |
| 3r6r | DNA-antibiotic | X-ray (2.4 Å) | Bazzicalupi C, Ferraroni M, Bilia AR, Scheggi F, Gratteri P | (2013) "The crystal structure of human telomeric DNA complexed with berberine: an interesting case of stacked ligand to G-tetrad ratio higher than 1:1." Nucleic Acids Res., 41, 632-638. doi: 10.1093/nar/gks1001. | Structure of the complex of an intramolecular human telomeric DNA with berberine formed in k+ solution. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 3sc8 | DNA | X-ray (2.302 Å) | Collie GW, Promontorio R, Hampel SM, Micco M, Neidle S, Parkinson GN | (2012) "Structural basis for telomeric g-quadruplex targeting by naphthalene diimide ligands." J.Am.Chem.Soc., 134, 2723-2731. doi: 10.1021/ja2102423. | Crystal structure of an intramolecular human telomeric DNA g-quadruplex bound by the naphthalene diimide bmsg-sh-3. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 3t5e | DNA | X-ray (2.1 Å) | Collie GW, Promontorio R, Hampel SM, Micco M, Neidle S, Parkinson GN | (2012) "Structural basis for telomeric g-quadruplex targeting by naphthalene diimide ligands." J.Am.Chem.Soc., 134, 2723-2731. doi: 10.1021/ja2102423. | Crystal structure of an intramolecular human telomeric DNA g-quadruplex bound by the naphthalene diimide bmsg-sh-4. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 3tvb | DNA-antibiotic | X-ray (1.08 Å) | Clark GR, Pytel PD, Squire CJ | (2012) "The high-resolution crystal structure of a parallel intermolecular DNA G-4 quadruplex/drug complex employing syn glycosyl linkages." Nucleic Acids Res., 40, 5731-5738. doi: 10.1093/nar/gks193. | A highly symmetric DNA g-4 quadruplex-drug complex. ➥ 8 G-tetrads, 2 G4 helices, 2 G4 stems, parallel(4+0), UUUU |
| 3uyh | DNA | X-ray (1.95 Å) | Micco M, Collie GW, Dale AG, Ohnmacht SA, Pazitna I, Gunaratnam M, Reszka AP, Neidle S | (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. doi: 10.1021/jm301899y. | Crystal structure of an intramolecular human telomeric DNA g-quadruplex bound by the naphthalene diimide compound, mm41. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 4da3 | DNA | X-ray (2.4 Å) | Micco M, Collie GW, Dale AG, Ohnmacht SA, Pazitna I, Gunaratnam M, Reszka AP, Neidle S | (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. doi: 10.1021/jm301899y. | Crystal structure of an intramolecular human telomeric DNA g-quadruplex 21-mer bound by the naphthalene diimide compound mm41.. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 4daq | DNA | X-ray (2.754 Å) | Micco M, Collie GW, Dale AG, Ohnmacht SA, Pazitna I, Gunaratnam M, Reszka AP, Neidle S | (2013) "Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells." J.Med.Chem., 56, 2959-2974. doi: 10.1021/jm301899y. | Crystal structure of an intramolecular human telomeric DNA g-quadruplex 21-mer bound by the naphthalene diimide compound bmsg-sh-3. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 4dih | hydrolase-hydrolase inhibitor-DNA | X-ray (1.8 Å) | Russo Krauss I, Merlino A, Randazzo A, Novellino E, Mazzarella L, Sica F | (2012) "High-resolution structures of two complexes between thrombin and thrombin-binding aptamer shed light on the role of cations in the aptamer inhibitory activity." Nucleic Acids Res., 40, 8119-8128. doi: 10.1093/nar/gks512. | X-ray structure of the complex between human alpha thrombin and thrombin binding aptamer in the presence of sodium ions. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 4dii | hydrolase-hydrolase inhibitor-DNA | X-ray (2.05 Å) | Russo Krauss I, Merlino A, Randazzo A, Novellino E, Mazzarella L, Sica F | (2012) "High-resolution structures of two complexes between thrombin and thrombin-binding aptamer shed light on the role of cations in the aptamer inhibitory activity." Nucleic Acids Res., 40, 8119-8128. doi: 10.1093/nar/gks512. | X-ray structure of the complex between human alpha thrombin and thrombin binding aptamer in the presence of potassium ions. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 4fxm | DNA | X-ray (1.651 Å) | Nicoludis JM, Miller ST, Jeffrey PD, Barrett SP, Rablen PR, Lawton TJ, Yatsunyk LA | (2012) "Optimized End-Stacking Provides Specificity of N-Methyl Mesoporphyrin IX for Human Telomeric G-Quadruplex DNA." J.Am.Chem.Soc., 134, 20446-20456. doi: 10.1021/ja3088746. | Crystal structure of the complex of a human telomeric repeat g-quadruplex and n-methyl mesoporphyrin ix (p21212). ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 4g0f | DNA | X-ray (2.15 Å) | Nicoludis JM, Miller ST, Jeffrey PD, Barrett SP, Rablen PR, Lawton TJ, Yatsunyk LA | (2012) "Optimized End-Stacking Provides Specificity of N-Methyl Mesoporphyrin IX for Human Telomeric G-Quadruplex DNA." J.Am.Chem.Soc., 134, 20446-20456. doi: 10.1021/ja3088746. | Crystal structure of the complex of a human telomeric repeat g-quadruplex and n-methyl mesoporphyrin ix (p6). ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 4h29 | DNA | X-ray (1.991 Å) | Wei D, Todd AK, Zloh M, Gunaratnam M, Parkinson GN, Neidle S | (2013) "Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex." J.Am.Chem.Soc., 135, 19319-19329. doi: 10.1021/ja4101358. | B-raf dimer DNA quadruplex. ➥ 7 G-tetrads, 1 G4 helix, 3 G4 stems, 1 G4 coaxial stack, (2+2), UDUD; parallel(4+0), UUUU, coaxial interfaces: mixed; 3'/5' |
| 4i7y | hydrolase-hydrolase inhibitor-DNA | X-ray (2.4 Å) | Russo Krauss I, Pica A, Merlino A, Mazzarella L, Sica F | (2013) "Duplex-quadruplex motifs in a peculiar structural organization cooperatively contribute to thrombin binding of a DNA aptamer." Acta Crystallogr.,Sect.D, 69, 2403-2411. doi: 10.1107/S0907444913022269. | Crystal structure of human alpha thrombin in complex with a 27-mer aptamer bound to exosite ii. ➥ 1 G-tetrad |
| 4kzd | immune system-RNA | X-ray (2.186 Å) | Huang H, Suslov NB, Li NS, Shelke SA, Evans ME, Koldobskaya Y, Rice PA, Piccirilli JA | (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. doi: 10.1038/nchembio.1561. | Crystal structure of an RNA aptamer in complex with fluorophore and fab. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD |
| 4kze | immune system-RNA | X-ray (2.404 Å) | Huang H, Suslov NB, Li NS, Shelke SA, Evans ME, Koldobskaya Y, Rice PA, Piccirilli JA | (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. doi: 10.1038/nchembio.1561. | Crystal structure of an RNA aptamer in complex with fab. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD |
| 4l0a | DNA, RNA | X-ray (1.7 Å) | Russo Krauss I, Parkinson GN, Merlino A, Mattia CA, Randazzo A, Novellino E, Mazzarella L, Sica F | (2014) "A regular thymine tetrad and a peculiar supramolecular assembly in the first crystal structure of an all-LNA G-quadruplex." Acta Crystallogr.,Sect.D, 70, 362-370. doi: 10.1107/S1399004713028095. | X-ray structure of an all lna quadruplex. ➥ 6 G-tetrads, 2 G4 helices, 2 G4 stems, parallel(4+0), UUUU |
| 4lz1 | hydrolase-hydrolase inhibitor-DNA | X-ray (1.65 Å) | Pica A, Russo Krauss I, Merlino A, Nagatoishi S, Sugimoto N, Sica F | (2013) "Dissecting the contribution of thrombin exosite I in the recognition of thrombin binding aptamer." Febs J., 280, 6581-6588. doi: 10.1111/febs.12561. | X-ray structure of the complex between human thrombin and the tba deletion mutant lacking thymine 12 nucleobase. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 4lz4 | hydrolase-hydrolase inhibitor-DNA | X-ray (2.56 Å) | Pica A, Russo Krauss I, Merlino A, Nagatoishi S, Sugimoto N, Sica F | (2013) "Dissecting the contribution of thrombin exosite I in the recognition of thrombin binding aptamer." Febs J., 280, 6581-6588. doi: 10.1111/febs.12561. | X-ray structure of the complex between human thrombin and the tba deletion mutant lacking thymine 3 nucleobase. ➥ 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 4ni7 | cytokine-DNA | X-ray (2.4 Å) | Gelinas AD, Davies DR, Edwards TE, Rohloff JC, Carter JD, Zhang C, Gupta S, Ishikawa Y, Hirota M, Nakaishi Y, Jarvis TC, Janjic N | (2014) "Crystal structure of interleukin-6 in complex with a modified nucleic Acid ligand." J.Biol.Chem., 289, 8720-8734. doi: 10.1074/jbc.M113.532697. | Crystal structure of human interleukin 6 in complex with a modified nucleotide aptamer (somamer sl1025). ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw), chair(2+2), UDUD |
| 4ni9 | cytokine-DNA | X-ray (2.55 Å) | Gelinas AD, Davies DR, Edwards TE, Rohloff JC, Carter JD, Zhang C, Gupta S, Ishikawa Y, Hirota M, Nakaishi Y, Jarvis TC, Janjic N | (2014) "Crystal structure of interleukin-6 in complex with a modified nucleic Acid ligand." J.Biol.Chem., 289, 8720-8734. doi: 10.1074/jbc.M113.532697. | Crystal structure of human interleukin 6 in complex with a modified nucleotide aptamer (somamer sl1025), form 2. ➥ 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 4p1d | DNA | X-ray (1.55 Å) | Ferraroni M, Bazzicalupi C, Gratteri P, Bilia AR, Sissi C | "Crystal Structure of the complex of a bimolecular human telomeric DNA with Coptisine." | Structure of the complex of a bimolecular human telomeric DNA with coptisine. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 4q9q | RNA | X-ray (2.45 Å) | Huang H, Suslov NB, Li NS, Shelke SA, Evans ME, Koldobskaya Y, Rice PA, Piccirilli JA | (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. doi: 10.1038/nchembio.1561. | Crystal structure of an RNA aptamer bound to bromo-ligand analog in complex with fab. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD |
| 4q9r | RNA-immune system | X-ray (3.12 Å) | Huang H, Suslov NB, Li NS, Shelke SA, Evans ME, Koldobskaya Y, Rice PA, Piccirilli JA | (2014) "A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore." Nat.Chem.Biol., 10, 686-691. doi: 10.1038/nchembio.1561. | Crystal structure of an RNA aptamer bound to trifluoroethyl-ligand analog in complex with fab. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD |
| 4r44 | DNA | X-ray (2.695 Å) | Mandal PK, Collie GW, Kauffmann B, Huc I | (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. doi: 10.1002/anie.201409014. | Racemic crystal structure of a tetramolecular DNA g-quadruplex. ➥ 16 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 4r45 | DNA | X-ray (1.9 Å) | Mandal PK, Collie GW, Kauffmann B, Huc I | (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. doi: 10.1002/anie.201409014. | Racemic crystal structure of a bimolecular DNA g-quadruplex (p-1). ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 4r47 | DNA | X-ray (1.85 Å) | Mandal PK, Collie GW, Kauffmann B, Huc I | (2014) "Racemic DNA crystallography." Angew.Chem.Int.Ed.Engl., 53, 14424-14427. doi: 10.1002/anie.201409014. | Racemic crystal structure of a bimolecular DNA g-quadruplex (p21-n). ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 4rj1 | RNA | X-ray (0.92 Å) | Fyfe AC, Dunten PW, Martick MM, Scott WG | (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. doi: 10.1016/j.jmb.2015.03.022. | Structural variations and solvent structure of uggggu quadruplexes stabilized by sr2+ ions. ➥ 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 4rkv | RNA | X-ray (0.88 Å) | Fyfe AC, Dunten PW, Martick MM, Scott WG | (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. doi: 10.1016/j.jmb.2015.03.022. | Structural variations and solvent structure of uggggu quadruplexes stabilized by sr2+ ions. ➥ 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 4rne | RNA | X-ray (1.01 Å) | Fyfe AC, Dunten PW, Martick MM, Scott WG | (2015) "Structural Variations and Solvent Structure of r(UGGGGU) Quadruplexes Stabilized by Sr(2+) Ions." J.Mol.Biol., 427, 2205-2219. doi: 10.1016/j.jmb.2015.03.022. | Structural variations and solvent structure of uggggu quadruplexes stabilized by sr2+ ions. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 4ts0 | RNA | X-ray (2.8 Å) | Warner KD, Chen MC, Song W, Strack RL, Thorn A, Jaffrey SR, Ferre-D'Amare AR | (2014) "Structural basis for activity of highly efficient RNA mimics of green fluorescent protein." Nat.Struct.Mol.Biol., 21, 658-663. doi: 10.1038/nsmb.2865. | Crystal structure of the spinach RNA aptamer in complex with dfhbi, barium ions. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UUDD |
| 4ts2 | RNA | X-ray (2.884 Å) | Warner KD, Chen MC, Song W, Strack RL, Thorn A, Jaffrey SR, Ferre-D'Amare AR | (2014) "Structural basis for activity of highly efficient RNA mimics of green fluorescent protein." Nat.Struct.Mol.Biol., 21, 658-663. doi: 10.1038/nsmb.2865. | Crystal structure of the spinach RNA aptamer in complex with dfhbi, magnesium ions. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UUDD |
| 4u5m | DNA | X-ray (1.5 Å) | Chung WJ, Heddi B, Schmitt E, Lim KW, Mechulam Y, Phan AT | (2015) "Structure of a left-handed DNA G-quadruplex." Proc.Natl.Acad.Sci.USA, 112, 2729-2733. doi: 10.1073/pnas.1418718112. | Structure of a left-handed DNA g-quadruplex. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+P+P+P), parallel(4+0), UUUU, negative twist |
| 4u92 | DNA | X-ray (1.5 Å) | Zhang D, Huang T, Lukeman PS, Paukstelis PJ | (2014) "Crystal structure of a DNA/Ba2+ G-quadruplex containing a water-mediated C-tetrad." Nucleic Acids Res., 42, 13422-13429. doi: 10.1093/nar/gku1122. | Crystal structure of a DNA-ba2+ g-quadruplex containing a water-mediated c-tetrad. ➥ 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/3' |
| 4wb2 | DNA-RNA hybrid | X-ray (1.8 Å) | Yatime L, Maasch C, Hoehlig K, Klussmann S, Andersen GR, Vater A | (2015) "Structural basis for the targeting of complement anaphylatoxin C5a using a mixed L-RNA/L-DNA aptamer." Nat Commun, 6, 6481. doi: 10.1038/ncomms7481. | Crystal structure of the mirror-image l-RNA-l-DNA aptamer nox-d20 in complex with mouse c5a complement anaphylatoxin. ➥ 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU |
| 4wb3 | DNA-RNA hybrid | X-ray (2.0 Å) | Yatime L, Maasch C, Hoehlig K, Klussmann S, Andersen GR, Vater A | (2015) "Structural basis for the targeting of complement anaphylatoxin C5a using a mixed L-RNA/L-DNA aptamer." Nat Commun, 6, 6481. doi: 10.1038/ncomms7481. | Crystal structure of the mirror-image l-RNA-l-DNA aptamer nox-d20 in complex with mouse c5a-desarg complement anaphylatoxin. ➥ 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU |
| 4wo2 | DNA | X-ray (1.82 Å) | Wei D, Parkinson GN, Neidle S | "CRYSTAL STRUCTURE OF HUMAN NATIVE CKIT-1 PROTO-ONCOGENE PROMOTER QUADRUPLEX DNA." | Crystal structure of human native ckit proto-oncogene promoter quadruplex DNA. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-PX+P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED |
| 4wo3 | DNA | X-ray (2.73 Å) | Wei D, Neidle S | "THE SECOND C-KIT1 DNA QUADRUPLEX CRYSTAL STRUCTURE." | The second c-kit DNA quadruplex crystal structure. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-PX+P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED |
| 4xk0 | RNA | X-ray (1.08 Å) | Chen MC, Murat P, Abecassis K, Ferre-D'Amare AR, Balasubramanian S | (2015) "Insights into the mechanism of a G-quadruplex-unwinding DEAH-box helicase." Nucleic Acids Res., 43, 2223-2231. doi: 10.1093/nar/gkv051. | Crystal structure of a tetramolecular RNA g-quadruplex in potassium. ➥ 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 5bjo | RNA | X-ray (2.35 Å) | Warner KD, Sjekloca L, Song W, Filonov GS, Jaffrey SR, Ferre-D'Amare AR | (2017) "A homodimer interface without base pairs in an RNA mimic of red fluorescent protein." Nat. Chem. Biol., 13, 1195-1201. doi: 10.1038/nchembio.2475. | Crystal structure of the corn RNA aptamer in complex with dfho, site-specific 5-iodo-u. ➥ 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU |
| 5bjp | RNA | X-ray (2.51 Å) | Warner KD, Sjekloca L, Song W, Filonov GS, Jaffrey SR, Ferre-D'Amare AR | (2017) "A homodimer interface without base pairs in an RNA mimic of red fluorescent protein." Nat. Chem. Biol., 13, 1195-1201. doi: 10.1038/nchembio.2475. | Crystal structure of the corn RNA aptamer in complex with dfho, iridium hexammine soak. ➥ 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU |
| 5ccw | drug-DNA | X-ray (1.89 Å) | Bazzicalupi C, Ferraroni M, Papi F, Massai L, Bertrand B, Messori L, Gratteri P, Casini A | (2016) "Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation." Angew.Chem.Int.Ed.Engl., 55, 4256-4259. doi: 10.1002/anie.201511999. | Structure of the complex of a human telomeric DNA with au(caffein-2-ylidene)2. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P), parallel(4+0), UUUU |
| 5cdb | DNA | X-ray (1.7 Å) | Ferraroni M, Bazzicalupi C, Papi F, Fiorillo G, Guaman-Ortiz LM, Nocentini A, Scovassi AI, Lombardi P, Gratteri P | (2016) "Solution and Solid-State Analysis of Binding of 13-Substituted Berberine Analogues to Human Telomeric G-quadruplexes." Chem Asian J, 11, 1107-1115. doi: 10.1002/asia.201600116. | Structure of the complex of a bimolecular human telomeric DNA with a 13-diphenylalkyl berberine derivative. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 5cmx | hydrolase | X-ray (2.98 Å) | Russo Krauss I, Spiridonova V, Pica A, Napolitano V, Sica F | (2016) "Different duplex/quadruplex junctions determine the properties of anti-thrombin aptamers with mixed folding." Nucleic Acids Res., 44, 983-991. doi: 10.1093/nar/gkv1384. | X-ray structure of the complex between human alpha thrombin and a duplex-quadruplex 31-mer DNA aptamer. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 5de5 | RNA binding protein-RNA | X-ray (3.0 Å) | Vasilyev N, Polonskaia A, Darnell JC, Darnell RB, Patel DJ, Serganov A | (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. doi: 10.1073/pnas.1515737112. | Crystal structure of the complex between human fmrp rgg motif and g-quadruplex RNA.. ➥ 6 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU |
| 5de8 | RNA binding protein-RNA | X-ray (3.1 Å) | Vasilyev N, Polonskaia A, Darnell JC, Darnell RB, Patel DJ, Serganov A | (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. doi: 10.1073/pnas.1515737112. | Crystal structure of the complex between human fmrp rgg motif and g-quadruplex RNA, iridium hexammine bound form.. ➥ 6 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU |
| 5dea | RNA binding protein-RNA | X-ray (2.8 Å) | Vasilyev N, Polonskaia A, Darnell JC, Darnell RB, Patel DJ, Serganov A | (2015) "Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP." Proc.Natl.Acad.Sci.USA, 112, E5391-E5400. doi: 10.1073/pnas.1515737112. | Crystal structure of the complex between human fmrp rgg motif and g-quadruplex RNA, cesium bound form.. ➥ 6 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU |
| 5dww | DNA | X-ray (2.79 Å) | Russo Krauss I, Ramaswamy S, Neidle S, Haider S, Parkinson GN | (2016) "Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target." J.Am.Chem.Soc., 138, 1226-1233. doi: 10.1021/jacs.5b10492. | Structural insights into the quadruplex-duplex 3' interface formed from a telomeric repeat - ttloop. ➥ 12 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 5dwx | DNA | X-ray (2.71 Å) | Russo Krauss I, Ramaswamy S, Neidle S, Haider S, Parkinson GN | (2016) "Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target." J.Am.Chem.Soc., 138, 1226-1233. doi: 10.1021/jacs.5b10492. | Structural insights into the quadruplex-duplex 3' interface formed from a telomeric repeat - tloop. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 5ew1 | protein-DNA | X-ray (2.95 Å) | Pica A, Russo Krauss I, Parente V, Tateishi-Karimata H, Nagatoishi S, Tsumoto K, Sugimoto N, Sica F | (2017) "Through-bond effects in the ternary complexes of thrombin sandwiched by two DNA aptamers." Nucleic Acids Res., 45, 461-469. doi: 10.1093/nar/gkw1113. | Human thrombin sandwiched between two DNA aptamers: hd22 and hd1-deltat3. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 5ew2 | protein-DNA | X-ray (3.59 Å) | Pica A, Russo Krauss I, Parente V, Tateishi-Karimata H, Nagatoishi S, Tsumoto K, Sugimoto N, Sica F | (2017) "Through-bond effects in the ternary complexes of thrombin sandwiched by two DNA aptamers." Nucleic Acids Res., 45, 461-469. doi: 10.1093/nar/gkw1113. | Human thrombin sandwiched between two DNA aptamers: hd22 and hd1-deltat12. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 5hix | DNA | X-ray (2.48 Å) | Mandal PK, Baptiste B, Langlois d'Estaintot B, Kauffmann B, Huc I | (2016) "Multivalent Interactions between an Aromatic Helical Foldamer and a DNA G-Quadruplex in the Solid State." Chembiochem, 17, 1911-1914. doi: 10.1002/cbic.201600281. | Cocrystal structure of an anti-parallel DNA g-quadruplex and a tetra-quinoline foldamer. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDDU |
| 5i2v | DNA | NMR | Kerkour A, Marquevielle J, Ivashchenko S, Yatsunyk LA, Mergny JL, Salgado GF | (2017) "High-resolution three-dimensional NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation." J. Biol. Chem., 292, 8082-8091. doi: 10.1074/jbc.M117.781906. | NMR structure of a new g-quadruplex forming sequence within the kras proto-oncogene promoter region. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 5j05 | DNA | NMR | Dvorkin SA, Karsisiotis AI, Webba da Silva M | (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. | Diy g-quadruplexes: solution structure of d(gggtttgggttttgggaggg) in sodium. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-LwD+Ln), basket(2+2), UDDU |
| 5j4p | DNA | NMR | Dvorkin SA, Karsisiotis AI, Webba da Silva M | (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. | Diy g-quadruplexes: solution structure of d(ggtttggttttggtttgg) in sodium. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU |
| 5j4w | DNA | NMR | Dvorkin SA, Karsisiotis AI, Webba da Silva M | (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. | Diy g-quadruplexes: solution structure of d(ggtttggttttggttgg) in sodium. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU |
| 5j6u | DNA | NMR | Dvorkin SA, Karsisiotis AI, Webba da Silva M | (2018) "Encoding canonical DNA quadruplex structure." Sci Adv, 4, eaat3007. doi: 10.1126/sciadv.aat3007. | Diy g-quadruplexes: solution structure of d(ggggtttggggttttggggaagggg) in sodium. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-LwD+Ln), basket(2+2), UDDU |
| 5lig | DNA | NMR | Kotar A, Wang B, Shivalingam A, Gonzalez-Garcia J, Vilar R, Plavec J | (2016) "NMR Structure of a Triangulenium-Based Long-Lived Fluorescence Probe Bound to a G-Quadruplex." Angew.Chem.Int.Ed.Engl., 55, 12508-12511. doi: 10.1002/anie.201606877. | G-quadruplex formed at the 5'-end of nheiii_1 element in human c-myc promoter bound to triangulenium based fluorescence probe daota-m2. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 5lqg | DNA | NMR | Galer P, Wang B, Sket P, Plavec J | (2016) "Reversible pH Switch of Two-Quartet G-Quadruplexes Formed by Human Telomere." Angew.Chem.Int.Ed.Engl., 55, 1993-1997. doi: 10.1002/anie.201507569. | A two-quartet g-quadruplex formed by human telomere in kcl solution at neutral ph. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU |
| 5lqh | DNA | NMR | Galer P, Wang B, Sket P, Plavec J | (2016) "Reversible pH Switch of Two-Quartet G-Quadruplexes Formed by Human Telomere." Angew.Chem.Int.Ed.Engl., 55, 1993-1997. doi: 10.1002/anie.201507569. | A two-quartet g-quadruplex formed by human telomere in kcl solution at ph 5.0. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+LnD-Lw), basket(2+2), UUDD |
| 5ls8 | DNA | X-ray (1.78 Å) | McQuaid K, Abell H, Gurung SP, Allan DR, Winter G, Sorensen T, Cardin DJ, Brazier JA, Cardin CJ, Hall JP | (2019) "Structural Studies Reveal Enantiospecific Recognition of a DNA G-Quadruplex by a Ruthenium Polypyridyl Complex." Angew.Chem.Int.Ed.Engl., 58, 9881-9885. doi: 10.1002/anie.201814502. | Light-activated ruthenium complex bound to a DNA quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD |
| 5m2l | DNA | NMR | Kocman V, Plavec J | (2017) "Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions." Nat Commun, 8, 15355. doi: 10.1038/ncomms15355. | Structure of DNA tetrameric agcga-quadruplex adopted by 15-mer d(gcgagggagcgaggg), vk34, oligonucleotide found in regulatory region of the plekhg3 human gene. ➥ 2 G-tetrads |
| 5mbr | DNA | NMR | Dickerhoff J, Haase L, Langel W, Weisz K | (2017) "Tracing Effects of Fluorine Substitutions on G-Quadruplex Conformational Changes." ACS Chem. Biol., 12, 1308-1315. doi: 10.1021/acschembio.6b01096. | Quadruplex with flipped tetrad formed by a human telomeric sequence. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 5mcr | DNA | NMR | Dickerhoff J, Haase L, Langel W, Weisz K | (2017) "Tracing Effects of Fluorine Substitutions on G-Quadruplex Conformational Changes." ACS Chem. Biol., 12, 1308-1315. doi: 10.1021/acschembio.6b01096. | Quadruplex with flipped tetrad formed by an artificial sequence. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-PD+Lw), U3D(3+1), UUUD |
| 5mjx | DNA | NMR | Lietard J, Abou Assi H, Gomez-Pinto I, Gonzalez C, Somoza MM, Damha MJ | (2017) "Mapping the affinity landscape of Thrombin-binding aptamers on 2 F-ANA/DNA chimeric G-Quadruplex microarrays." Nucleic Acids Res., 45, 1619-1632. doi: 10.1093/nar/gkw1357. | 2'f-ana-DNA chimeric tba quadruplex structure. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 5mta | DNA | NMR | Juribasic Kulcsar M, Gabelica V, Plavec J | "Stabilizing interactions in long-loop G-quadruplex formed within promoters of Plasmodium falciparum B var genes." | G-quadruplex formed within promoters of plasmodium falciparum b var genes. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-PD+Lw), U3D(3+1), UUUD |
| 5mtg | DNA | NMR | Juribasic Kulcsar M, Gabelica V, Plavec J | "Stabilizing interactions in long-loop G-quadruplex formed within promoters of Plasmodium falciparum B var genes." | G-quadruplex formed within promoters of plasmodium falciparum b var genes - form i. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-PD+Lw), U3D(3+1), UUUD |
| 5mvb | DNA | NMR | Wirmer-Bartoschek J, Bendel LE, Jonker HRA, Grun JT, Papi F, Bazzicalupi C, Messori L, Gratteri P, Schwalbe H | (2017) "Solution NMR Structure of a Ligand/Hybrid-2-G-Quadruplex Complex Reveals Rearrangements that Affect Ligand Binding." Angew. Chem. Int. Ed. Engl., 56, 7102-7106. doi: 10.1002/anie.201702135. | Solution structure of a human g-quadruplex hybrid-2 form in complex with a gold-ligand.. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 5nys | DNA | NMR | Trajkovski M, Endoh T, Tateishi-Karimata H, Ohyama T, Tanaka S, Plavec J, Sugimoto N | (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. doi: 10.1093/nar/gky250. | M2 g-quadruplex dilute solution. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 5nyt | DNA | NMR | Trajkovski M, Endoh T, Tateishi-Karimata H, Ohyama T, Tanaka S, Plavec J, Sugimoto N | (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. doi: 10.1093/nar/gky250. | M2 g-quadruplex 20 wt% ethylene glycol. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 5nyu | DNA | NMR | Trajkovski M, Endoh T, Tateishi-Karimata H, Ohyama T, Tanaka S, Plavec J, Sugimoto N | (2018) "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations." Nucleic Acids Res., 46, 4301-4315. doi: 10.1093/nar/gky250. | M2 g-quadruplex 10 wt% peg8000. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 5o4d | DNA | NMR | Marusic M, Plavec J | (2019) "Towards Understanding of Polymorphism of the G-rich Region of Human Papillomavirus Type 52." Molecules, 24. doi: 10.3390/molecules24071294. | G-quadruplex of human papillomavirus type 52. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD |
| 5ob3 | RNA | X-ray (2.004 Å) | Fernandez-Millan P, Autour A, Ennifar E, Westhof E, Ryckelynck M | (2017) "Crystal structure and fluorescence properties of the iSpinach aptamer in complex with DFHBI." RNA, 23, 1788-1795. doi: 10.1261/rna.063008.117. | Ispinach aptamer. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD |
| 5oph | DNA | NMR | Brcic J, Plavec J | (2018) "NMR structure of a G-quadruplex formed by four d(G4C2) repeats: insights into structural polymorphism." Nucleic Acids Res., 46, 11605-11617. doi: 10.1093/nar/gky886. | G-quadruplex structure of DNA oligonucleotide containing ggggcc repeats linked to als and ftd. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-Lw-Ln-Lw), chair(2+2), UDUD |
| 5ov2 | DNA | NMR | Dickerhoff J, Weisz K | (2017) "Nonconventional C-HF Hydrogen Bonds Support a Tetrad Flip in Modified G-Quadruplexes." J Phys Chem Lett, 8, 5148-5152. doi: 10.1021/acs.jpclett.7b02428. | 2'f-ana-g modified quadruplex with a flipped tetrad. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-PD+Lw), U3D(3+1), UUUD |
| 5ua3 | DNA | X-ray (1.88 Å) | Meier M, Moya-Torres A, Krahn NJ, McDougall MD, Orriss GL, McRae EKS, Booy EP, McEleney K, Patel TR, McKenna SA, Stetefeld J | (2018) "Structure and hydrodynamics of a DNA G-quadruplex with a cytosine bulge." Nucleic Acids Res., 46, 5319-5331. doi: 10.1093/nar/gky307. | Crystal structure of a DNA g-quadruplex with a cytosine bulge. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 5v3f | RNA | X-ray (1.7 Å) | Trachman RJ, Demeshkina NA, Lau MWL, Panchapakesan SSS, Jeng SCY, Unrau PJ, Ferre-D'Amare AR | (2017) "Structural basis for high-affinity fluorophore binding and activation by RNA Mango." Nat. Chem. Biol., 13, 807-813. doi: 10.1038/nchembio.2392. | Co-crystal structure of the fluorogenic RNA mango. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 5vhe | hydrolase | X-ray (3.793 Å) | Chen MC, Tippana R, Demeshkina NA, Murat P, Balasubramanian S, Myong S, Ferre-D'Amare AR | (2018) "Structural basis of G-quadruplex unfolding by the DEAH/RHA helicase DHX36." Nature, 558, 465-469. doi: 10.1038/s41586-018-0209-9. | Dhx36 in complex with the c-myc g-quadruplex. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 5w77 | DNA-inhibitor | NMR | Calabrese DR, Chen X, Leon EC, Gaikwad SM, Phyo Z, Hewitt WM, Alden S, Hilimire TA, He F, Michalowski AM, Simmons JK, Saunders LB, Zhang S, Connors D, Walters KJ, Mock BA, Schneekloth Jr JS | (2018) "Chemical and structural studies provide a mechanistic basis for recognition of the MYC G-quadruplex." Nat Commun, 9, 4229. doi: 10.1038/s41467-018-06315-w. | Solution structure of the myc g-quadruplex bound to small molecule dc-34. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 5yey | DNA | NMR | Liu C, Zhou B, Geng Y, Yan Tam D, Feng R, Miao H, Xu N, Shi X, You Y, Hong Y, Tang BZ, Kwan Lo P, Kuryavyi V, Zhu G | (2019) "A chair-type G-quadruplex structure formed by a human telomeric variant DNA in K+solution." Chem Sci, 10, 218-226. doi: 10.1039/c8sc03813a. | The structure of a chair-type g-quadruplex of the human telomeric variant in k+ solution. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+Ln+Lw+Ln), chair(2+2), UDUD |
| 5z80 | DNA | NMR | Liu W, Zhong YF, Liu LY, Shen CT, Zeng W, Wang F, Yang D, Mao ZW | (2018) "Solution structures of multiple G-quadruplex complexes induced by a platinum(II)-based tripod reveal dynamic binding." Nat Commun, 9, 3496. doi: 10.1038/s41467-018-05810-4. | Solution structure for the 1:1 complex of a platinum(ii)-based tripod bound to a hybrid-1 human telomeric g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 5z8f | DNA | NMR | Liu W, Zhong YF, Liu LY, Shen CT, Zeng W, Wang F, Yang D, Mao ZW | (2018) "Solution structures of multiple G-quadruplex complexes induced by a platinum(II)-based tripod reveal dynamic binding." Nat Commun, 9, 3496. doi: 10.1038/s41467-018-05810-4. | Solution structure for the unique dimeric 4:2 complex of a platinum(ii)-based tripod bound to a hybrid-1 human telomeric g-quadruplex. ➥ 6 G-tetrads, 2 G4 helices, 2 G4 stems, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 5zev | DNA | NMR | Liu Y, Lan W, Wang C, Cao C | (2018) "A putative G-quadruplex structure in the proximal promoter ofVEGFR-2has implications for drug design to inhibit tumor angiogenesis." J. Biol. Chem., 293, 8947-8955. doi: 10.1074/jbc.RA118.002666. | Solution structure of g-quadruplex formed in vegfr-2 proximal promoter sequence. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(D+PX), UD3(1+3), UDDD |
| 6a7y | DNA | NMR | Wan C, Fu W, Jing H, Zhang N | (2019) "NMR solution structure of an asymmetric intermolecular leaped V-shape G-quadruplex: selective recognition of the d(G2NG3NG4) sequence motif by a short linear G-rich DNA probe." Nucleic Acids Res., 47, 1544-1556. doi: 10.1093/nar/gky1167. | Solution structure of an intermolecular leaped v-shape g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, (1+3), UDDD |
| 6a85 | DNA | X-ray (1.45 Å) | Liu HH, Wang R, Yu X, Shen FS, Lan WX, Haruehanroengra P, Yao QQ, Zhang J, Chen YQ, Li SH, Wu BX, Zheng LN, Ma JB, Lin JZ, Cao CY, Li JX, Sheng J, Gan JH | (2018) "High-resolution DNA quadruplex structure containing all the A-, G-, C-, T-tetrads." Nucleic Acids Res., 46, 11627-11638. doi: 10.1093/nar/gky902. | Crystal structure of a novel DNA quadruplex. ➥ 8 G-tetrads, 2 G4 helices, 1 G4 stem, parallel(4+0), UUUU |
| 6ac7 | DNA | NMR | Sengar A, Vandana JJ, Chambers VS, Di Antonio M, Winnerdy FR, Balasubramanian S, Phan AT | (2019) "Structure of a (3+1) hybrid G-quadruplex in the PARP1 promoter." Nucleic Acids Res., 47, 1564-1572. doi: 10.1093/nar/gky1179. | Structure of a (3+1) hybrid g-quadruplex in the parp1 promoter. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 6au4 | DNA | X-ray (2.35 Å) | Stump S, Mou TC, Sprang SR, Natale NR, Beall HD | (2018) "Crystal structure of the major quadruplex formed in the promoter region of the human c-MYC oncogene." PLoS ONE, 13, e0205584. doi: 10.1371/journal.pone.0205584. | Crystal structure of the major quadruplex formed in the human c-myc promoter. ➥ 6 G-tetrads, 2 G4 helices, 2 G4 stems, 3(-P-P-P), parallel(4+0), UUUU |
| 6b14 | immune system-RNA | X-ray (1.64 Å) | Koirala D, Shelke SA, Dupont M, Ruiz S, DasGupta S, Bailey LJ, Benner SA, Piccirilli JA | (2018) "Affinity maturation of a portable Fab-RNA module for chaperone-assisted RNA crystallography." Nucleic Acids Res., 46, 2624-2635. doi: 10.1093/nar/gkx1292. | Crystal structure of spinach RNA aptamer in complex with fab bl3-6s97n. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD |
| 6b3k | immune system-RNA | X-ray (2.09 Å) | Koirala D, Shelke SA, Dupont M, Ruiz S, DasGupta S, Bailey LJ, Benner SA, Piccirilli JA | (2018) "Affinity maturation of a portable Fab-RNA module for chaperone-assisted RNA crystallography." Nucleic Acids Res., 46, 2624-2635. doi: 10.1093/nar/gkx1292. | Crystal structure of mutant spinach RNA aptamer in complex with fab bl3-6. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD |
| 6c63 | RNA | X-ray (2.9 Å) | Trachman 3rd RJ, Abdolahzadeh A, Andreoni A, Cojocaru R, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR | (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. doi: 10.1021/acs.biochem.8b00399. | Crystal structure of the mango-ii fluorescent aptamer bound to to1-biotin. ➥ 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 6c64 | RNA | X-ray (3.0 Å) | Trachman 3rd RJ, Abdolahzadeh A, Andreoni A, Cojocaru R, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR | (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. doi: 10.1021/acs.biochem.8b00399. | Crystal structure of the mango-ii fluorescent aptamer bound to to3-biotin. ➥ 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 6c65 | RNA | X-ray (2.8 Å) | Trachman 3rd RJ, Abdolahzadeh A, Andreoni A, Cojocaru R, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR | (2018) "Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness." Biochemistry, 57, 3544-3548. doi: 10.1021/acs.biochem.8b00399. | Crystal structure of the mango-ii-a22u fluorescent aptamer bound to to1-biotin. ➥ 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 6ccw | DNA | NMR | Lin C, Wu G, Wang K, Onel B, Sakai S, Shao Y, Yang D | (2018) "Molecular Recognition of the Hybrid-2 Human Telomeric G-Quadruplex by Epiberberine: Insights into Conversion of Telomeric G-Quadruplex Structures." Angew. Chem. Int. Ed. Engl., 57, 10888-10893. doi: 10.1002/anie.201804667. | Hybrid-2 form human telomeric g quadruplex in complex with epiberberine. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 6e80 | RNA | X-ray (2.901 Å) | Sjekloca L, Ferre-D'Amare AR | (2019) "Binding between G Quadruplexes at the Homodimer Interface of the Corn RNA Aptamer Strongly Activates Thioflavin T Fluorescence." Cell Chem Biol, 26, 1159. doi: 10.1016/j.chembiol.2019.04.012. | Crystal structure of the corn aptamer in unliganded state. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 6e81 | RNA | X-ray (2.721 Å) | Sjekloca L, Ferre-D'Amare AR | (2019) "Binding between G Quadruplexes at the Homodimer Interface of the Corn RNA Aptamer Strongly Activates Thioflavin T Fluorescence." Cell Chem Biol, 26, 1159. doi: 10.1016/j.chembiol.2019.04.012. | Crystal structure of the corn aptamer in complex with tht. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 6e82 | RNA | X-ray (3.101 Å) | Sjekloca L, Ferre-D'Amare AR | (2019) "Binding between G Quadruplexes at the Homodimer Interface of the Corn RNA Aptamer Strongly Activates Thioflavin T Fluorescence." Cell Chem Biol, 26, 1159. doi: 10.1016/j.chembiol.2019.04.012. | Crystal structure of the corn aptamer mutant a14u in complex with tht. ➥ 1 G-tetrad |
| 6e84 | RNA | X-ray (2.901 Å) | Sjekloca L, Ferre-D'Amare AR | (2019) "Binding between G Quadruplexes at the Homodimer Interface of the Corn RNA Aptamer Strongly Activates Thioflavin T Fluorescence." Cell Chem Biol, 26, 1159. doi: 10.1016/j.chembiol.2019.04.012. | Crystal structure of the corn aptamer in complex with to. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 6e8s | RNA | X-ray (2.35 Å) | Trachman 3rd RJ, Autour A, Jeng SCY, Abdolahzadeh A, Andreoni A, Cojocaru R, Garipov R, Dolgosheina EV, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR | (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. doi: 10.1038/s41589-019-0267-9. | Structure of the imango-iii aptamer bound to to1-biotin. ➥ 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-Lw), hybrid-2R(3+1), UUUD |
| 6e8t | RNA | X-ray (2.9 Å) | Trachman 3rd RJ, Autour A, Jeng SCY, Abdolahzadeh A, Andreoni A, Cojocaru R, Garipov R, Dolgosheina EV, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR | (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. doi: 10.1038/s41589-019-0267-9. | Structure of the mango-iii (a10u) aptamer bound to to1-biotin. ➥ 8 G-tetrads, 4 G4 helices, 4 G4 stems, 2(-P-Lw), hybrid-1(3+1), UUUD; 2(-P-P-Lw), hybrid-2R(3+1), UUUD |
| 6e8u | RNA | X-ray (1.55 Å) | Trachman 3rd RJ, Autour A, Jeng SCY, Abdolahzadeh A, Andreoni A, Cojocaru R, Garipov R, Dolgosheina EV, Knutson JR, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR | (2019) "Structure and functional reselection of the Mango-III fluorogenic RNA aptamer." Nat. Chem. Biol., 15, 472-479. doi: 10.1038/s41589-019-0267-9. | Structure of the mango-iii (a10u) aptamer bound to to1-biotin. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-Lw), hybrid-2R(3+1), UUUD |
| 6eo6 | hydrolase-DNA | X-ray (1.69 Å) | Dolot R, Lam CH, Sierant M, Zhao Q, Liu FW, Nawrot B, Egli M, Yang X | (2018) "Crystal structures of thrombin in complex with chemically modified thrombin DNA aptamers reveal the origins of enhanced affinity." Nucleic Acids Res., 46, 4819-4830. doi: 10.1093/nar/gky268. | X-ray structure of the complex between human alpha-thrombin and modified 15-mer DNA aptamer containing 5-(3-(2-(1h-indol-3-yl)acetamide-n-yl)-1-propen-1-yl)-2'-deoxyuridine residue. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 6eo7 | hydrolase-DNA | X-ray (2.24 Å) | Dolot R, Lam CH, Sierant M, Zhao Q, Liu FW, Nawrot B, Egli M, Yang X | (2018) "Crystal structures of thrombin in complex with chemically modified thrombin DNA aptamers reveal the origins of enhanced affinity." Nucleic Acids Res., 46, 4819-4830. doi: 10.1093/nar/gky268. | X-ray structure of the complex between human alpha-thrombin and modified 15-mer DNA aptamer containing 5-(3-(acetamide-n-yl)-1-propen-1-yl)-2'-deoxyuridine residue. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 6erl | DNA | NMR | Karg B, Weisz K | (2018) "Loop Length Affects Syn-Anti Conformational Rearrangements in Parallel G-Quadruplexes." Chemistry. doi: 10.1002/chem.201801851. | Quadruplex with flipped tetrad formed by the c-myc promoter sequence. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6evv | hydrolase | X-ray (2.5 Å) | Troisi R, Napolitano V, Spiridonova V, Russo Krauss I, Sica F | (2018) "Several structural motifs cooperate in determining the highly effective anti-thrombin activity of NU172 aptamer." Nucleic Acids Res., 46, 12177-12185. doi: 10.1093/nar/gky990. | X-ray structure of the complex between human alpha thrombin and nu172, a duplex-quadruplex 26-mer DNA aptamer, in the presence of potassium ions.. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 6f4z | DNA | NMR | Dickerhoff J, Weisz K | (2018) "Fluorine-Mediated Editing of a G-Quadruplex Folding Pathway." Chembiochem, 19, 927-930. doi: 10.1002/cbic.201800099. | 2'f-arag modified quadruplex with flipped g-tract and central tetrad. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+LnD-Lw), basket(2+2), UUDD |
| 6fc9 | DNA | NMR | Diaz-Casado L, Serrano-Chacon I, Montalvillo-Jimenez L, Corzana F, Bastida A, Santana AG, Gonzalez C, Asensio JL | (2020) "De Novo Design of Selective Quadruplex-Duplex Junction Ligands and Structural Characterisation of Their Binding Mode: Targeting the G4 Hot-Spot." Chemistry. doi: 10.1002/chem.202005026. | The 1,8-bis(aminomethyl)anthracene and quadruplex-duplex junction complex. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 6ffr | DNA-RNA hybrid | NMR | Haase L, Dickerhoff J, Weisz K | (2018) "DNA-RNA Hybrid Quadruplexes Reveal Interactions that Favor RNA Parallel Topologies." Chemistry, 24, 15365-15371. doi: 10.1002/chem.201803367. | DNA-RNA hybrid quadruplex with flipped tetrad. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-PD+Lw), U3D(3+1), UUUD |
| 6fq2 | DNA | X-ray (2.31 Å) | Bakalar B, Heddi B, Schmitt E, Mechulam Y, Phan AT | (2019) "A Minimal Sequence for Left-Handed G-Quadruplex Formation." Angew. Chem. Int. Ed. Engl., 58, 2331-2335. doi: 10.1002/anie.201812628. | Structure of minimal sequence for left -handed g-quadruplex formation. ➥ 4 G-tetrads, 1 G4 helix |
| 6ftu | DNA | X-ray (2.95 Å) | Guedin A, Lin LY, Armane S, Lacroix L, Mergny JL, Thore S, Yatsunyk LA | (2018) "Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome." Nucleic Acids Res., 46, 5297-5307. doi: 10.1093/nar/gky290. | Structure of a quadruplex forming sequence from d. discoideum. ➥ 28 G-tetrads, 7 G4 helices, 7 G4 stems, 4(+Ln-Lw), (2+2), UUDD; 4(+LnD), basket(2+2), UUDD; 4(+LnD-Lw), basket(2+2), UUDD |
| 6ge1 | RNA | NMR | Andralojc W, Malgowska M, Sarzynska J, Pasternak K, Szpotkowski K, Kierzek R, Gdaniec Z | (2019) "Unraveling the structural basis for the exceptional stability of RNA G-quadruplexes capped by a uridine tetrad at the 3' terminus." RNA, 25, 121-134. doi: 10.1261/rna.068163.118. | Solution structure of the r(ugguggu)4 RNA quadruplex. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/5' |
| 6gh0 | DNA | NMR | Kotar A, Rigo R, Sissi C, Plavec J | (2019) "Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure." Nucleic Acids Res., 47, 2641-2653. doi: 10.1093/nar/gky1269. | Two-quartet kit* g-quadruplex is formed via double-stranded pre-folded structure. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-Lw-Ln-Lw), chair(2+2), UDUD |
| 6gn7 | hydrolase | X-ray (2.8 Å) | Troisi R, Napolitano V, Spiridonova V, Russo Krauss I, Sica F | (2018) "Several structural motifs cooperate in determining the highly effective anti-thrombin activity of NU172 aptamer." Nucleic Acids Res., 46, 12177-12185. doi: 10.1093/nar/gky990. | X-ray structure of the complex between human alpha thrombin and nu172, a duplex-quadruplex 26-mer DNA aptamer, in the presence of sodium ions.. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 6gz6 | DNA | X-ray (2.006 Å) | Bakalar B, Heddi B, Schmitt E, Mechulam Y, Phan AT | (2019) "A Minimal Sequence for Left-Handed G-Quadruplex Formation." Angew.Chem.Int.Ed.Engl., 58, 2331-2335. doi: 10.1002/anie.201812628. | Structure of a left-handed g-quadruplex. ➥ 4 G-tetrads, 1 G4 helix |
| 6gzn | DNA | NMR | Lenarcic Zivkovic M, Rozman J, Plavec J | (2018) "Adenine-Driven Structural Switch from a Two- to Three-Quartet DNA G-Quadruplex." Angew. Chem. Int. Ed. Engl., 57, 15395-15399. doi: 10.1002/anie.201809328. | Adenine-driven structural switch from two- to three-quartet DNA g-quadruplex. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU |
| 6h1k | DNA | NMR | Butovskaya E, Heddi B, Bakalar B, Richter SN, Phan AT | (2018) "Major G-Quadruplex Form of HIV-1 LTR Reveals a (3 + 1) Folding Topology Containing a Stem-Loop." J. Am. Chem. Soc., 140, 13654-13662. doi: 10.1021/jacs.8b05332. | The major g-quadruplex form of hiv-1 ltr. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(D+PX), UD3(1+3), UDDD |
| 6h5r | DNA | X-ray (2.0 Å) | Guarra F, Marzo T, Ferraroni M, Papi F, Bazzicalupi C, Gratteri P, Pescitelli G, Messori L, Biver T, Gabbiani C | (2018) "Interaction of a gold(i) dicarbene anticancer drug with human telomeric DNA G-quadruplex: solution and computationally aided X-ray diffraction analysis." Dalton Trans, 47, 16132-16138. doi: 10.1039/c8dt03607a. | Structure of the complex of a human telomeric DNA with bis(1-butyl-3-methyl-imidazole-2-ylidene) gold(i). ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6ia0 | DNA | NMR | Bielskute S, Plavec J, Podbevsek P | (2019) "Impact of Oxidative Lesions on the Human Telomeric G-Quadruplex." J. Am. Chem. Soc., 141, 2594-2603. doi: 10.1021/jacs.8b12748. | Human telomeric g-quadruplex with 8-oxo-g substitution in the central g-quartet. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 6ia4 | DNA | NMR | Bielskute S, Plavec J, Podbevsek P | (2019) "Impact of Oxidative Lesions on the Human Telomeric G-Quadruplex." J. Am. Chem. Soc., 141, 2594-2603. doi: 10.1021/jacs.8b12748. | Human telomeric g-quadruplex with 8-oxo-g substitution in the outer g-quartet. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 6ip3 | DNA | X-ray (1.4 Å) | Nuthanakanti A, Ahmed I, Khatik SY, Saikrishnan K, Srivatsan SG | (2019) "Probing G-quadruplex topologies and recognition concurrently in real time and 3D using a dual-app nucleoside probe." Nucleic Acids Res., 47, 6059-6072. doi: 10.1093/nar/gkz419. | Structure of human telomeric DNA at 1.4 angstroms resolution. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6ip7 | DNA | X-ray (1.55 Å) | Nuthanakanti A, Ahmed I, Khatik SY, Saikrishnan K, Srivatsan SG | (2019) "Probing G-quadruplex topologies and recognition concurrently in real time and 3D using a dual-app nucleoside probe." Nucleic Acids Res., 47, 6059-6072. doi: 10.1093/nar/gkz419. | Structure of human telomeric DNA with 5-selenophene-modified deoxyuridine at residue 11. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P), parallel(4+0), UUUU |
| 6isw | DNA | X-ray (2.3 Å) | Nuthanakanti A, Ahmed I, Khatik SY, Saikrishnan K, Srivatsan SG | (2019) "Probing G-quadruplex topologies and recognition concurrently in real time and 3D using a dual-app nucleoside probe." Nucleic Acids Res., 47, 6059-6072. doi: 10.1093/nar/gkz419. | Structure of human telomeric DNA with 5-selenophene-modified deoxyuridine at residue 12. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P), parallel(4+0), UUUU |
| 6jcd | DNA | NMR | Truong THA, Winnerdy FR, Phan AT | (2019) "An Unprecedented Knot-like G-Quadruplex Peripheral Motif." Angew.Chem.Int.Ed.Engl., 58, 13834-13839. doi: 10.1002/anie.201907740. | G-quadruplex peripheral knot. ➥ 2 G-tetrads, 1 G4 helix |
| 6jce | DNA | NMR | Winnerdy FR, Bakalar B, Maity A, Vandana JJ, Mechulam Y, Schmitt E, Phan AT | (2019) "NMR solution and X-ray crystal structures of a DNA molecule containing both right- and left-handed parallel-stranded G-quadruplexes." Nucleic Acids Res., 47, 8272-8281. doi: 10.1093/nar/gkz349. | NMR solution and x-ray crystal structures of a DNA containing both right-and left-handed parallel-stranded g-quadruplexes. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 6jj0 | DNA | NMR | Liu W, Lin C, Wu G, Dai J, Chang TC, Yang D | (2019) "Structures of 1:1 and 2:1 complexes of BMVC and MYC promoter G-quadruplex reveal a mechanism of ligand conformation adjustment for G4-recognition." Nucleic Acids Res., 47, 11931-11942. doi: 10.1093/nar/gkz1015. | NMR structure of the 1:1 complex of a carbazole derivative bmvc bound to c-myc g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6jje | DNA | X-ray (1.378 Å) | Zhang YS, Parkinson GN, Wagner A, Wei DG | "Crystal structure of a two-quartet DNA mixed-parallel/antiparallel G-quadruplex (BrU)." | Crystal structure of a two-quartet DNA mixed-parallel-antiparallel g-quadruplex (bru). ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, (2+2), UDUD; parallel(4+0), UUUU, coaxial interfaces: mixed |
| 6jjf | DNA | X-ray (1.47 Å) | Zhang Y, El Omari K, Duman R, Liu S, Haider S, Wagner A, Parkinson GN, Wei D | (2020) "Native de novo structural determinations of non-canonical nucleic acid motifs by X-ray crystallography at long wavelengths." Nucleic Acids Res., 48, 9886-9898. doi: 10.1093/nar/gkaa439. | Crystal structure of a two-quartet DNA mixed-parallel-antiparallel g-quadruplex. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, (2+2), UDUD; parallel(4+0), UUUU, coaxial interfaces: mixed |
| 6jjg | DNA | X-ray (1.969 Å) | Zhang YS, Parkinson GN, Wagner A, Wei DG | "Crystal structure of a two-quartet DNA mixed-parallel/antiparallel G-quadruplex." | Crystal structure of a two-quartet DNA mixed-parallel-antiparallel g-quadruplex. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, (2+2), UDUD; parallel(4+0), UUUU, coaxial interfaces: mixed |
| 6jjh | RNA | X-ray (1.74 Å) | Zhang Y, El Omari K, Duman R, Liu S, Haider S, Wagner A, Parkinson GN, Wei D | (2020) "Native de novo structural determinations of non-canonical nucleic acid motifs by X-ray crystallography at long wavelengths." Nucleic Acids Res., 48, 9886-9898. doi: 10.1093/nar/gkaa439. | Crystal structure of a two-quartet RNA parallel g-quadruplex complexed with the porphyrin tmpyp4. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/5' |
| 6jji | RNA | X-ray (3.1 Å) | Zhang Y, El Omari K, Duman R, Liu S, Haider S, Wagner A, Parkinson GN, Wei D | (2020) "Native de novo structural determinations of non-canonical nucleic acid motifs by X-ray crystallography at long wavelengths." Nucleic Acids Res., 48, 9886-9898. doi: 10.1093/nar/gkaa439. | Crystal structure of a two-quartet RNA parallel g-quadruplex complexed with the porphyrin tmpyp4 (1:1). ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/5' |
| 6jkn | DNA | X-ray (1.401 Å) | Geng Y, Liu C, Zhou B, Cai Q, Miao H, Shi X, Xu N, You Y, Fung CP, Din RU, Zhu G | (2019) "The crystal structure of an antiparallel chair-type G-quadruplex formed by Bromo-substituted human telomeric DNA." Nucleic Acids Res., 47, 5395-5404. doi: 10.1093/nar/gkz221. | Crystal structure of g-quadruplex formed by bromo-substituted human telomeric DNA. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-Lw), chair(2+2), UDUD |
| 6jwd | DNA | NMR | Wang F, Wang C, Liu Y, Lan W, Han H, Wang R, Huang S, Cao C | (2020) "Colchicine selective interaction with oncogene RET G-quadruplex revealed by NMR." Chem.Commun.(Camb.), 56, 2099-2102. doi: 10.1039/d0cc00221f. | Structure of ret g-quadruplex in complex with berberine. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6jwe | DNA | NMR | Wang F, Wang C, Liu Y, Lan W, Han H, Wang R, Huang S, Cao C | (2020) "Colchicine selective interaction with oncogene RET G-quadruplex revealed by NMR." Chem.Commun.(Camb.), 56, 2099-2102. doi: 10.1039/d0cc00221f. | Structure of ret g-quadruplex in complex with colchicine. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6k3x | DNA | NMR | Winnerdy FR, Das P, Heddi B, Phan AT | (2019) "Solution Structures of a G-Quadruplex Bound to Linear- and Cyclic-Dinucleotides." J.Am.Chem.Soc., 141, 18038-18047. doi: 10.1021/jacs.9b05642. | G-quadruplex complex with linear dinucleotide d(ag). ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 6k3y | DNA | NMR | Winnerdy FR, Das P, Heddi B, Phan AT | (2019) "Solution Structures of a G-Quadruplex Bound to Linear- and Cyclic-Dinucleotides." J.Am.Chem.Soc., 141, 18038-18047. doi: 10.1021/jacs.9b05642. | G-quadruplex complex with cyclic dinucleotide 3'-3' cgamp. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 6k84 | RNA | NMR | Mashima T, Lee JH, Kamatari YO, Hayashi T, Nagata T, Nishikawa F, Nishikawa S, Kinoshita M, Kuwata K, Katahira M | (2020) "Development and structural determination of an anti-PrPCaptamer that blocks pathological conformational conversion of prion protein." Sci Rep, 10, 4934. doi: 10.1038/s41598-020-61966-4. | Structure of anti-prion RNA aptamer. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 6kfi | DNA | NMR | Liu LY, Liu W, Wang KN, Zhu BC, Xia XY, Ji LN, Mao ZW | (2020) "Quantitative Detection of G-Quadruplex DNA in Live Cells Based on Photon Counts and Complex Structure Discrimination." Angew.Chem.Int.Ed.Engl., 59, 9719-9726. doi: 10.1002/anie.202002422. | NMR solution structure of the 1:1 complex of tel26 g-quadruplex and a tripodal cationic fluorescent probe nbte. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 6kfj | DNA | NMR | Liu LY, Liu W, Wang KN, Zhu BC, Xia XY, Ji LN, Mao ZW | (2020) "Quantitative Detection of G-Quadruplex DNA in Live Cells Based on Photon Counts and Complex Structure Discrimination." Angew.Chem.Int.Ed.Engl., 59, 9719-9726. doi: 10.1002/anie.202002422. | NMR solution structure of the 1:1 complex of wttel26 g-quadruplex and a tripodal cationic fluorescent probe nbte. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 6kfl | DNA | X-ray (1.92 Å) | Zhang YS, Parkinson GN, Wei DG | "Crystal structure of a two-quartet DNA G-quadruplex complexed with the porphyrin TMPyP4." | Crystal structure of a two-quartet DNA g-quadruplex complexed with the porphyrin tmpyp4. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, (2+2), UDUD; parallel(4+0), UUUU, coaxial interfaces: mixed |
| 6kn4 | DNA | NMR | Barthwal R, Raje S, Pandav K | (2021) "Structural basis for stabilization of human telomeric G-quadruplex [d-(TTAGGGT)] 4 by anticancer drug adriamycin." J.Biomol.Struct.Dyn., 39, 795-815. doi: 10.1080/07391102.2020.1730969. | Human parallel stranded 7-mer g-quadruplex complexed with 2 adriamycin (dm2) molecules. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 6kvb | DNA | NMR | Maity A, Winnerdy FR, Chang WD, Chen G, Phan AT | (2020) "Intra-locked G-quadruplex structures formed by irregular DNA G-rich motifs." Nucleic Acids Res., 48, 3315-3327. doi: 10.1093/nar/gkaa008. | Structure of an intra-locked g-quadruplex. ➥ 4 G-tetrads, 1 G4 helix |
| 6kxz | DNA | NMR | Barthwal R, Raje S, Pandav K | (2020) "Structural basis for stabilization of human telomeric G-quadruplex [d-(TTAGGGT)] 4 by anticancer drug epirubicin." Bioorg.Med.Chem., 28, 115761. doi: 10.1016/j.bmc.2020.115761. | Human parallel stranded 7-mer g-quadruplex complexed with 2 epirubicin (epi) molecules. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 6l8m | DNA | NMR | Wang ZF, Li MH, Chu IT, Winnerdy FR, Phan AT, Chang TC | (2020) "Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter." Nucleic Acids Res., 48, 1120-1130. doi: 10.1093/nar/gkz1207. | Wnt DNA promoter mutant g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD |
| 6l92 | DNA | NMR | Wang ZF, Li MH, Chu IT, Winnerdy FR, Phan AT, Chang TC | (2020) "Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter." Nucleic Acids Res., 48, 1120-1130. doi: 10.1093/nar/gkz1207. | A basket type g-quadruplex in wnt DNA promoter. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+LnD-P), (3+1), UUUD |
| 6ldm | DNA binding protein-DNA | X-ray (2.4 Å) | Traczyk A, Liew CW, Gill DJ, Rhodes D | (2020) "Structural basis of G-quadruplex DNA recognition by the yeast telomeric protein Rap1." Nucleic Acids Res., 48, 4562-4571. doi: 10.1093/nar/gkaa171. | Structural basis of g-quadruplex DNA recognition by the yeast telomeric protein rap1. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6lnz | DNA | NMR | Zhu BC, He J, Liu W, Xia XY, Liu LY, Liang BB, Yao HG, Liu B, Ji LN, Mao ZW | (2021) "Selectivity and Targeting of G-Quadruplex Binders Activated by Adaptive Binding and Controlled by Chemical Kinetics." Angew.Chem.Int.Ed.Engl., 60, 15340-15343. doi: 10.1002/anie.202104624. | NMR solution structure of vegf g-quadruplex bound a non-planar cyclometalated-carbene platinum(ii) complex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6m05 | DNA | NMR | Jing H, Fu W, Hu W, Xu S, Xu X, He M, Liu Y, Zhang N | (2021) "NMR structural study on the self-trimerization of d(GTTAGG) into a dynamic trimolecular G-quadruplex assembly preferentially in Na+ solution with a moderate K+ tolerance." Nucleic Acids Res., 49, 2306-2316. doi: 10.1093/nar/gkab028. | Trimolecular g-quadruplex. ➥ 2 G-tetrads, 1 G4 helix |
| 6n65 | DNA | X-ray (1.6 Å) | Ou A, Schmidberger JW, Wilson KA, Evans CW, Hargreaves JA, Grigg M, O'Mara ML, Iyer KS, Bond CS, Smith NM | (2020) "High resolution crystal structure of a KRAS promoter G-quadruplex reveals a dimer with extensive poly-A pi-stacking interactions for small-molecule recognition." Nucleic Acids Res., 48, 5766-5776. doi: 10.1093/nar/gkaa262. | Kras g-quadruplex g16t mutant.. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 6neb | DNA | NMR | Dickerhoff J, Onel B, Chen L, Chen Y, Yang D | (2019) "Solution Structure of a MYC Promoter G-Quadruplex with 1:6:1 Loop Length." Acs Omega, 4, 2533-2539. doi: 10.1021/acsomega.8b03580. | Myc promoter g-quadruplex with 1:6:1 loop length. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6o2l | DNA | NMR | Liu W, Lin C, Wu G, Dai J, Chang TC, Yang D | (2019) "Structures of 1:1 and 2:1 complexes of BMVC and MYC promoter G-quadruplex reveal a mechanism of ligand conformation adjustment for G4-recognition." Nucleic Acids Res., 47, 11931-11942. doi: 10.1093/nar/gkz1015. | NMR structure of the 2:1 complex of a carbazole derivative bmvc bound to c-myc g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6p45 | DNA | X-ray (2.339 Å) | Lin LY, McCarthy S, Powell BM, Manurung Y, Xiang IM, Dean WL, Chaires B, Yatsunyk LA | (2020) "Biophysical and X-ray structural studies of the (GGGTT)3GGG G-quadruplex in complex with N-methyl mesoporphyrin IX." Plos One, 15, e0241513. doi: 10.1371/journal.pone.0241513. | Crystal structure of the g-quadruplex formed by (tgggt)4 in complex with n-methylmesoporphryin ix. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 6pnk | DNA | X-ray (2.39 Å) | Lin LY, McCarthy S, Powell BM, Manurung Y, Xiang IM, Dean WL, Chaires B, Yatsunyk LA | (2020) "Biophysical and X-ray structural studies of the (GGGTT)3GGG G-quadruplex in complex with N-methyl mesoporphyrin IX." Plos One, 15, e0241513. doi: 10.1371/journal.pone.0241513. | Crystal structure of the g-quadruplex formed by (gggtt)3ggg in complex with n-methylmesoporphryin ix. ➥ 6 G-tetrads, 2 G4 helices, 2 G4 stems, 3(-P-P), parallel(4+0), UUUU; 3(-P-P-P), parallel(4+0), UUUU |
| 6pq7 | RNA | X-ray (3.0 Å) | Trachman III RJ, Stagno JR, Conrad C, Jones CP, Fischer P, Meents A, Wang YX, Ferre-D'Amare AR | (2019) "Co-crystal structure of the iMango-III fluorescent RNA aptamer using an X-ray free-electron laser." Acta Crystallogr.,Sect.F, 75, 547-551. doi: 10.1107/S2053230X19010136. | Structure of the imango-iii fluorescent aptamer at room temperature.. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-Lw), hybrid-2R(3+1), UUUD |
| 6q6r | DNA binding protein | X-ray (1.5 Å) | Heddi B, Cheong VV, Schmitt E, Mechulam Y, Phan AT | (2020) "Recognition of different base tetrads by RHAU (DHX36): X-ray crystal structure of the G4 recognition motif bound to the 3'-end tetrad of a DNA G-quadruplex." J.Struct.Biol., 209, 107399. doi: 10.1016/j.jsb.2019.10.001. | Recognition of different base tetrads by rhau: x-ray crystal structure of g4 recognition motif bound to the 3-end tetrad of a DNA g-quadruplex. ➥ 12 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 6qjo | DNA | X-ray (1.8 Å) | Winnerdy FR, Bakalar B, Maity A, Vandana JJ, Mechulam Y, Schmitt E, Phan AT | (2019) "NMR solution and X-ray crystal structures of a DNA molecule containing both right- and left-handed parallel-stranded G-quadruplexes." Nucleic Acids Res., 47, 8272-8281. doi: 10.1093/nar/gkz349. | DNA containing both right- and left-handed parallel-stranded g-quadruplexes. ➥ 16 G-tetrads, 4 G4 helices, 4 G4 stems, 2(-P-P-P), parallel(4+0), UUUU |
| 6r9k | DNA | NMR | Karg B, Mohr S, Weisz K | (2019) "Duplex-Guided Refolding into Novel G-Quadruplex (3+1) Hybrid Conformations." Angew.Chem.Int.Ed.Engl., 58, 11068-11071. doi: 10.1002/anie.201905372. | A quadruplex hybrid structure with lpp loop orientation and 3 syn residues. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+Ln+P+P), hybrid-1R(1+3), UDDD |
| 6r9l | DNA | NMR | Karg B, Mohr S, Weisz K | (2019) "Duplex-Guided Refolding into Novel G-Quadruplex (3+1) Hybrid Conformations." Angew.Chem.Int.Ed.Engl., 58, 11068-11071. doi: 10.1002/anie.201905372. | A quadruplex hybrid structure with lpp loop orientation and 5 syn residues. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+Ln+P+P), hybrid-1R(1+3), UDDD |
| 6rnl | DNA | X-ray (1.88 Å) | McQuaid K, Hall JP, Baumgaertner L, Cardin DJ, Cardin CJ | (2019) "Three thymine/adenine binding modes of the ruthenium complex Lambda-[Ru(TAP)2(dppz)]2+to the G-quadruplex forming sequence d(TAGGGTT) shown by X-ray crystallography." Chem.Commun.(Camb.), 55, 9116-9119. doi: 10.1039/c9cc04316k. | L-[ru(tap)2(dppz)]2+ bound to the g-quadruplex forming sequence d(tagggtt). ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 6rs3 | DNA | NMR | Haase L, Dickerhoff J, Weisz K | (2020) "Sugar Puckering Drives G-Quadruplex Refolding: Implications for V-Shaped Loops." Chemistry, 26, 524-533. doi: 10.1002/chem.201904044. | 2'-f-riboguanosine modified g-quadruplex with v-loop. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD |
| 6s15 | DNA | X-ray (1.7 Å) | Papi F, Bazzicalupi C, Ferraroni M, Ciolli G, Lombardi P, Khan AY, Kumar GS, Gratteri P | (2020) "Pyridine Derivative of the Natural Alkaloid Berberine as Human Telomeric G4-DNA Binder: A Solution and Solid-State Study." Acs Med.Chem.Lett., 11, 645-650. doi: 10.1021/acsmedchemlett.9b00516. | Pyridine derivative of the natural alkaloid berberine as human telomeric g-quadruplex binder. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 6suu | DNA | NMR | Marquevielle J, Robert C, Lagrabette O, Wahid M, Bourdoncle A, Xodo LE, Mergny JL, Salgado GF | (2020) "Structure of two G-quadruplexes in equilibrium in the KRAS promoter." Nucleic Acids Res., 48, 9336-9345. doi: 10.1093/nar/gkaa387. | NMR structure of kras32r g9t conformer g-quadruplex within kras promoter region. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 6sx6 | DNA | NMR | Pavc D, Wang B, Spindler L, Drevensek-Olenik I, Plavec J, Sket P | (2020) "GC ends control topology of DNA G-quadruplexes and their cation-dependent assembly." Nucleic Acids Res., 48, 2749-2761. doi: 10.1093/nar/gkaa058. | Guanine-rich oligonucleotide with 5'-gc end form g-quadruplex with a(gggg)a hexad, gcgc- and g-quartets and two symmetric gg and aa base pairs. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 6syk | DNA | NMR | Pavc D, Wang B, Spindler L, Drevensek-Olenik I, Plavec J, Sket P | (2020) "GC ends control topology of DNA G-quadruplexes and their cation-dependent assembly." Nucleic Acids Res., 48, 2749-2761. doi: 10.1093/nar/gkaa058. | Guanine-rich oligonucleotide with 5'- and 3'-gc ends form g-quadruplex with a(gggg)a hexad, gcgc- and g-quartets and two symmetric gg and aa base pair. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 6t2g | DNA | NMR | Marquevielle J, Robert C, Lagrabette O, Wahid M, Bourdoncle A, Xodo LE, Mergny JL, Salgado GF | (2020) "Structure of two G-quadruplexes in equilibrium in the KRAS promoter." Nucleic Acids Res., 48, 9336-9345. doi: 10.1093/nar/gkaa387. | NMR structure of kras32r g25t conformer g-quadruplex within kras promoter region. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6t51 | DNA | NMR | Marquevielle J, Kumar MVV, Mergny JL, Salgado GF | (2018) "1H,13C, and15N chemical shift assignments of a G-quadruplex forming sequence within the KRAS proto-oncogene promoter region." Biomol.Nmr Assign., 12, 123-127. doi: 10.1007/s12104-017-9793-0. | NMR structure of kras22rt g-quadruplex forming within kras promoter region at physological temperature. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6tc8 | DNA | NMR | Haase L, Weisz K | (2020) "Switching the type of V-loop in sugar-modified G-quadruplexes through altered fluorine interactions." Chem.Commun.(Camb.), 56, 4539-4542. doi: 10.1039/d0cc01285h. | 2'-f-arabinoguanosine and 2'-f-riboguanosine modified hybrid type g-quadruplex with v-loop. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD |
| 6tcg | DNA | NMR | Haase L, Weisz K | (2020) "Switching the type of V-loop in sugar-modified G-quadruplexes through altered fluorine interactions." Chem.Commun.(Camb.), 56, 4539-4542. doi: 10.1039/d0cc01285h. | 2'-f-riboguanosine and 2'-f-arabinoguanosine modified g-quadruplex with v-loop and all-syn g-tract. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD |
| 6tzq | DNA | X-ray (2.29 Å) | Chu B, Zhang D, Paukstelis PJ | (2019) "A DNA G-quadruplex/i-motif hybrid." Nucleic Acids Res., 47, 11921-11930. doi: 10.1093/nar/gkz1008. | A DNA g-quadruplex-i-motif hybrid. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD |
| 6tzr | DNA | X-ray (2.4 Å) | Chu B, Zhang D, Paukstelis PJ | (2019) "A DNA G-quadruplex/i-motif hybrid." Nucleic Acids Res., 47, 11921-11930. doi: 10.1093/nar/gkz1008. | A DNA g-quadruplex-i-motif hybrid. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD |
| 6up0 | RNA | X-ray (2.8 Å) | Jeng SCY, Trachman III RJ, Weissenboeck F, Truong L, Link KA, Jepsen MDE, Knutson JR, Andersen ES, Ferre-D'Amare AR, Unrau PJ | (2021) "Fluorogenic aptamers resolve the flexibility of RNA junctions using orientation-dependent FRET." Rna, 27, 433-444. doi: 10.1261/rna.078220.120. | Structure of the mango-iii fluorescent aptamer bound to yo3-biotin. ➥ 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-Lw), hybrid-2R(3+1), UUUD |
| 6v0l | DNA | NMR | Wang KB, Dickerhoff J, Wu G, Yang D | (2020) "PDGFR-beta Promoter Forms a Vacancy G-Quadruplex that Can Be Filled in by dGMP: Solution Structure and Molecular Recognition of Guanine Metabolites and Drugs." J.Am.Chem.Soc., 142, 5204-5211. doi: 10.1021/jacs.9b12770. | Pdgfr-b promoter forms a g-vacancy quadruplex that can be complemented by dgmp: molecular structure and recognition of guanine derivatives and metabolites. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 6v9b | RNA | X-ray (2.4 Å) | Trachman 3rd RJ, Cojocaru R, Wu D, Piszczek G, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR | (2020) "Structure-Guided Engineering of the Homodimeric Mango-IV Fluorescence Turn-on Aptamer Yields an RNA FRET Pair." Structure, 28, 776-785.e3. doi: 10.1016/j.str.2020.04.007. | Co-crystal structure of the fluorogenic mango-iv homodimer bound to to1-biotin. ➥ 6 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU |
| 6v9d | RNA | X-ray (2.8 Å) | Trachman 3rd RJ, Cojocaru R, Wu D, Piszczek G, Ryckelynck M, Unrau PJ, Ferre-D'Amare AR | (2020) "Structure-Guided Engineering of the Homodimeric Mango-IV Fluorescence Turn-on Aptamer Yields an RNA FRET Pair." Structure, 28, 776-785.e3. doi: 10.1016/j.str.2020.04.007. | Co-crystal structure of the fluorogenic mango-iv homodimer bound to to1-biotin. ➥ 6 G-tetrads, 2 G4 helices, 2 G4 stems, 2(-P-P-P), parallel(4+0), UUUU |
| 6w9p | DNA | X-ray (1.99 Å) | Beseiso D, Chen EV, McCarthy SE, Martin KN, Gallagher EP, Miao J, Yatsunyk LA | (2022) "The first crystal structures of hybrid and parallel four-tetrad intramolecular G-quadruplexes." Nucleic Acids Res., 50, 2959-2972. doi: 10.1093/nar/gkac091. | Tel26 parallel four-quartet g-quadruplex with k+. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-P-P-P), parallel(4+0), UUUU |
| 6wck | DNA | X-ray (1.801 Å) | Ou A, Schmidberger JW, Wilson KA, Evans CW, Hargreaves JA, Grigg M, O'Mara ML, Iyer KS, Bond CS, Smith NM | (2020) "High resolution crystal structure of a KRAS promoter G-quadruplex reveals a dimer with extensive poly-A pi-stacking interactions for small-molecule recognition." Nucleic Acids Res., 48, 5766-5776. doi: 10.1093/nar/gkaa262. | Kras g-quadruplex g16t mutant with bromo uracil replacing t8 and t16.. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 6xcl | DNA | X-ray (2.7 Å) | Miron CE, van Staalduinen L, Rangaswamy AM, Chen M, Liang Y, Jia Z, Mergny JL, Petitjean A | (2021) "Going Platinum to the Tune of a Remarkable Guanine Quadruplex Binder: Solution- and Solid-State Investigations." Angew.Chem.Int.Ed.Engl., 60, 2500-2507. doi: 10.1002/anie.202012520. | Crystal structure of human telomeric DNA g-quadruplex in complex with a novel platinum(ii) complex.. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 6xrq | RNA | X-ray (1.21 Å) | Zhang Y, Bux K, Attana F, Wei D, Haider S, Parkinson GN | (2024) "Structural descriptions of ligand interactions to RNA quadruplexes folded from the non-coding region of Pseudorabies virus." Biochimie. doi: 10.1016/j.biochi.2024.06.003. | Structural descriptions of ligand interactions to DNA and RNA quadruplexes folded from the non-coding region of pseudorabies virus. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 3'/5' |
| 6xt7 | DNA | X-ray (1.56 Å) | Beseiso D, Chen EV, McCarthy SE, Martin KN, Gallagher EP, Miao J, Yatsunyk LA | (2022) "The first crystal structures of hybrid and parallel four-tetrad intramolecular G-quadruplexes." Nucleic Acids Res., 50, 2959-2972. doi: 10.1093/nar/gkac091. | Tel25 hybrid four-quartet g-quadruplex with k+. ➥ 16 G-tetrads, 4 G4 helices, 4 G4 stems, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 6ycv | DNA | NMR | Haase L, Weisz K | (2020) "Locked nucleic acid building blocks as versatile tools for advanced G-quadruplex design." Nucleic Acids Res., 48, 10555-10566. doi: 10.1093/nar/gkaa720. | 2'-f-riboguanosine and lna modified hybrid type g-quadruplex with v-loop. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD |
| 6yep | DNA | NMR | Haase L, Weisz K | (2020) "Locked nucleic acid building blocks as versatile tools for advanced G-quadruplex design." Nucleic Acids Res., 48, 10555-10566. doi: 10.1093/nar/gkaa720. | Lna modified g-quadruplex with flipped g-tract and central tetrad. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+LnD-Lw), basket(2+2), UUDD |
| 6yy4 | DNA | NMR | Volek M, Kolesnikova S, Svehlova K, Srb P, Sgallova R, Streckerova T, Redondo JA, Veverka V, Curtis EA | (2021) "Overlapping but distinct: a new model for G-quadruplex biochemical specificity." Nucleic Acids Res., 49, 1816-1827. doi: 10.1093/nar/gkab037. | Parallel 17-mer DNA g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6z8v | hydrolase | X-ray (1.58 Å) | Smirnov I, Kolganova N, Troisi R, Sica F, Timofeev E | (2021) "Expanding the recognition interface of the thrombin-binding aptamer HD1 through modification of residues T3 and T12." Mol Ther Nucleic Acids, 23, 863-871. doi: 10.1016/j.omtn.2021.01.004. | X-ray structure of the complex between human alpha thrombin and a thrombin binding aptamer variant (tba-3l), which contains 1-beta-d-lactopyranosyl residue in the side chain of thy3 at n3.. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 6z8w | hydrolase | X-ray (1.73 Å) | Smirnov I, Kolganova N, Troisi R, Sica F, Timofeev E | (2021) "Expanding the recognition interface of the thrombin-binding aptamer HD1 through modification of residues T3 and T12." Mol Ther Nucleic Acids, 23, 863-871. doi: 10.1016/j.omtn.2021.01.004. | X-ray structure of the complex between human alpha thrombin and a thrombin binding aptamer variant (tba-3g), which contains 1-beta-d-glucopyranosyl residue in the side chain of thy3 at n3.. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 6z8x | hydrolase | X-ray (2.53 Å) | Smirnov I, Kolganova N, Troisi R, Sica F, Timofeev E | (2021) "Expanding the recognition interface of the thrombin-binding aptamer HD1 through modification of residues T3 and T12." Mol Ther Nucleic Acids, 23, 863-871. doi: 10.1016/j.omtn.2021.01.004. | X-ray structure of the complex between human alpha thrombin and a thrombin binding aptamer variant (tba-3leu), which contains leucyl amide in the side chain of thy3 at n3.. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Ln), (2+2), UDUD |
| 6zl2 | DNA | NMR | Vianney YM, Preckwinkel P, Mohr S, Weisz K | (2020) "Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands." Chemistry, 26, 16910-16922. doi: 10.1002/chem.202003540. | Structure of a parallel c-myc modified with 3' duplex stem-loop overhang. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6zl9 | DNA | NMR | Vianney YM, Preckwinkel P, Mohr S, Weisz K | (2020) "Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands." Chemistry, 26, 16910-16922. doi: 10.1002/chem.202003540. | Structure of a parallel c-myc modified with 5' duplex stem-loop overhang. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6zrm | DNA | NMR | Lenarcic Zivkovic M, Rozman J, Plavec J | (2020) "Structure of a DNA G-Quadruplex Related to Osteoporosis with a G-A Bulge Forming a Pseudo-loop ." Molecules, 25. doi: 10.3390/molecules25204867. | G-quadruplex with a g-a bulge. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 6zte | DNA | NMR | Vianney YM, Preckwinkel P, Mohr S, Weisz K | (2020) "Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands." Chemistry, 26, 16910-16922. doi: 10.1002/chem.202003540. | Structure of a parallel c-myc modified with 5' duplex stem-loop and 3' diagonal snap-back loop. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 6zx6 | DNA | NMR | Bielskute S, Plavec J, Podbevsek P | (2021) "Oxidative lesions modulate G-quadruplex stability and structure in the human BCL2 promoter." Nucleic Acids Res., 49, 2346-2356. doi: 10.1093/nar/gkab057. | Antiparallel basket-type g-quadruplex DNA structure formed in human bcl-2 promoter containing 8-oxog. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-LwD+Ln), basket(2+2), UDDU |
| 6zx7 | DNA | NMR | Bielskute S, Plavec J, Podbevsek P | (2021) "Oxidative lesions modulate G-quadruplex stability and structure in the human BCL2 promoter." Nucleic Acids Res., 49, 2346-2356. doi: 10.1093/nar/gkab057. | Antiparallel basket-type g-quadruplex DNA structure formed in human bcl-2 promoter. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-LwD+Ln), basket(2+2), UDDU |
| 7alu | DNA | NMR | De Rache A, Marquevielle J, Bouaziz S, Vialet B, Andreola ML, Mergny JL, Amrane S | (2023) "Structure of a DNA G-quadruplex that modulates SP1 binding sites architecture in HIV-1 promoter." J.Mol.Biol., 168359. doi: 10.1016/j.jmb.2023.168359. | NMR structure of a DNA g-quadruplex containing two sp1 binding sites from hiv-1 promoter. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lm-Ln-P), (3+1), UDUU |
| 7atz | DNA | NMR | Vianney YM, Weisz K | (2021) "First Tandem Repeat of a Potassium Channel KCNN4 Minisatellite Folds into a V-Loop G-Quadruplex Structure." Biochemistry, 60, 1337-1346. doi: 10.1021/acs.biochem.1c00043. | G-quadruplex with v-shaped loop from the first repeat of kcnn4 minisatellite. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+P), UD3(1+3), UDDD |
| 7cls | DNA | NMR | Ngoc Nguyen TQ, Lim KW, Phan AT | (2020) "Duplex formation in a G-quadruplex bulge." Nucleic Acids Res., 48, 10567-10575. doi: 10.1093/nar/gkaa738. | Solution structure of an intramolecular g-quadruplex containing a duplex bulge. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7cps | DNA | NMR | Barthwal R, Tariq Z, Pandav K | "A 2:1 stoichiometric complex of anticancer drug 4'-Epiadriamycin bound to parallel G-quadruplex DNA [d-(TTGGGGT)]4." | A 2:1 stoichiometric complex of anticancer drug 4'-epiadriamycin bound to parallel g-quadruplex DNA [d-(ttggggt)]4.. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 7csk | DNA | NMR | Barthwal R, Tariq Z, Pandav K | "A 2:1 stoichiometric complex of anticancer drug Adriamycin bound to parallel G-quadruplex DNA [d-(TTGGGGT)]4." | A 2:1 stoichiometric complex of anticancer drug adriamycin bound to parallel g-quadruplex DNA [d-(ttggggt)]4.. ➥ 2 G-tetrads |
| 7cv3 | DNA | NMR | Tan DJY, Winnerdy FR, Lim KW, Phan AT | (2020) "Coexistence of two quadruplex-duplex hybrids in the PIM1 gene." Nucleic Acids Res., 48, 11162-11171. doi: 10.1093/nar/gkaa752. | Quadruplex-duplex hybrid structure in the pim1 gene, form 1. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-Lw-Ln), hybrid-1(3+1), UUDU |
| 7cv4 | DNA | NMR | Tan DJY, Winnerdy FR, Lim KW, Phan AT | (2020) "Coexistence of two quadruplex-duplex hybrids in the PIM1 gene." Nucleic Acids Res., 48, 11162-11171. doi: 10.1093/nar/gkaa752. | Quadruplex-duplex hybrid structure in the pim1 gene, form 2. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 7d31 | DNA | X-ray (1.396 Å) | Liu H, Gao Y, Mathivanan J, Shen F, Chen X, Li Y, Shao Z, Zhang Y, Shao Q, Sheng J, Gan J | (2022) "Structure-guided development of Pb 2+ -binding DNA aptamers." Sci Rep, 12, 460. doi: 10.1038/s41598-021-04243-2. | The tba-pb2+ complex in p41212 space group. ➥ 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 7d32 | DNA | X-ray (1.707 Å) | Liu H, Gao Y, Mathivanan J, Shen F, Chen X, Li Y, Shao Z, Zhang Y, Shao Q, Sheng J, Gan J | (2022) "Structure-guided development of Pb 2+ -binding DNA aptamers." Sci Rep, 12, 460. doi: 10.1038/s41598-021-04243-2. | The tba-pb2+ complex in p41212 space group. ➥ 12 G-tetrads, 6 G4 helices, 6 G4 stems, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 7d33 | DNA | X-ray (2.117 Å) | Liu H, Gao Y, Mathivanan J, Shen F, Chen X, Li Y, Shao Z, Zhang Y, Shao Q, Sheng J, Gan J | (2022) "Structure-guided development of Pb 2+ -binding DNA aptamers." Sci Rep, 12, 460. doi: 10.1038/s41598-021-04243-2. | The pb2+ complexed structure of tba g8c mutant. ➥ 10 G-tetrads, 5 G4 helices, 5 G4 stems, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 7d5d | DNA | X-ray (1.18 Å) | Das P, Ngo KH, Winnerdy FR, Maity A, Bakalar B, Mechulam Y, Schmitt E, Phan AT | (2021) "Bulges in left-handed G-quadruplexes." Nucleic Acids Res., 49, 1724-1736. doi: 10.1093/nar/gkaa1259. | Left-handed g-quadruplex containing one bulge. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+P+P+P), parallel(4+0), UUUU, negative twist |
| 7d5e | DNA | X-ray (1.296 Å) | Das P, Ngo KH, Winnerdy FR, Maity A, Bakalar B, Mechulam Y, Schmitt E, Phan AT | (2021) "Bulges in left-handed G-quadruplexes." Nucleic Acids Res., 49, 1724-1736. doi: 10.1093/nar/gkaa1259. | Left-handed g-quadruplex containing two bulges. ➥ 8 G-tetrads, 2 G4 helices, 2 G4 stems, 2(+P+P+P), parallel(4+0), UUUU, negative twist |
| 7d5f | DNA | NMR | Das P, Ngo KH, Winnerdy FR, Maity A, Bakalar B, Mechulam Y, Schmitt E, Phan AT | (2021) "Bulges in left-handed G-quadruplexes." Nucleic Acids Res., 49, 1724-1736. doi: 10.1093/nar/gkaa1259. | Left-handed g-quadruplex containing 3 bulges. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+P+P+P), parallel(4+0), UUUU, negative twist |
| 7dfy | DNA | X-ray (1.69 Å) | Das P, Winnerdy FR, Maity A, Mechulam Y, Phan AT | (2021) "A novel minimal motif for left-handed G-quadruplex formation." Chem.Commun.(Camb.), 57, 2527-2530. doi: 10.1039/d0cc08146a. | Novel motif for left-handed g-quadruplex formation. ➥ 8 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, 2(+P+P+P), parallel(4+0), UUUU, coaxial interfaces: 3'/3', negative twist |
| 7do1 | DNA | NMR | Fu W, Jing H, Xu X, Xu S, Wang T, Hu W, Li H, Zhang N | (2021) "Two coexisting pseudo-mirror heteromolecular telomeric G-quadruplexes in opposite loop progressions differentially recognized by a low equivalent of Thioflavin T." Nucleic Acids Res., 49, 10717-10734. doi: 10.1093/nar/gkab755. | Solution structure of a heteromolecular telomeric (3+1) g-quadruplex containing right loop progression. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, (3+1), UDUU |
| 7e5p | DNA | NMR | Tsukakoshi K, Yamagishi Y, Kanazashi M, Nakama K, Oshikawa D, Savory N, Matsugami A, Hayashi F, Lee J, Saito T, Sode K, Khunathai K, Kuno H, Ikebukuro K | (2021) "G-quadruplex-forming aptamer enhances the peroxidase activity of myoglobin against luminol." Nucleic Acids Res., 49, 6069-6081. doi: 10.1093/nar/gkab388. | Aptamer enhancing peroxidase activity of myoglobin. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7ecf | DNA | X-ray (1.6 Å) | Geng Y, Liu C, Cai Q, Luo Z, Miao H, Shi X, Xu N, Fung CP, Choy TT, Yan B, Li N, Qian P, Zhou B, Zhu G | (2021) "Crystal structure of parallel G-quadruplex formed by the two-repeat ALS- and FTD-related GGGGCC sequence." Nucleic Acids Res., 49, 5881-5890. doi: 10.1093/nar/gkab302. | Crystal structure of d(g4c2)2-ba in c2221 space group. ➥ 12 G-tetrads, 3 G4 helices, 3 G4 stems, parallel(4+0), UUUU |
| 7ecg | DNA | X-ray (1.97 Å) | Geng Y, Liu C, Cai Q, Luo Z, Miao H, Shi X, Xu N, Fung CP, Choy TT, Yan B, Li N, Qian P, Zhou B, Zhu G | (2021) "Crystal structure of parallel G-quadruplex formed by the two-repeat ALS- and FTD-related GGGGCC sequence." Nucleic Acids Res., 49, 5881-5890. doi: 10.1093/nar/gkab302. | Crystal structure of d(g4c2)2-ba in f222 space group. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 7ech | DNA | X-ray (2.38 Å) | Geng Y, Liu C, Cai Q, Luo Z, Miao H, Shi X, Xu N, Fung CP, Choy TT, Yan B, Li N, Qian P, Zhou B, Zhu G | (2021) "Crystal structure of parallel G-quadruplex formed by the two-repeat ALS- and FTD-related GGGGCC sequence." Nucleic Acids Res., 49, 5881-5890. doi: 10.1093/nar/gkab302. | Crystal structure of d(g4c2)2-k in f222 space group. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 7el7 | DNA | NMR | Liu LY, Wang KN, Liu W, Zeng YL, Hou MX, Yang J, Mao ZW | (2021) "Spatial Matching Selectivity and Solution Structure of Organic-Metal Hybrid to Quadruplex-Duplex Hybrid." Angew.Chem.Int.Ed.Engl., 60, 20833-20839. doi: 10.1002/anie.202106256. | NMR solution structure of the 1:1 complex of a quadruplex-duplex hybrid myt1l and a platinum(ii) ligand l1pt(dien). ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 7euc | DNA | NMR | Devi G, Winnerdy FR, Ang JCY, Lim KW, Phan AT | (2022) "Four-Layered Intramolecular Parallel G-Quadruplex with Non-Nucleotide Loops: An Ultra-Stable Self-Folded DNA Nano-Scaffold." Acs Nano, 16, 533-540. doi: 10.1021/acsnano.1c07630. | Parallel g-quadruplex structure. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 7jku | DNA | X-ray (1.97 Å) | Beseiso D, Chen EV, McCarthy SE, Martin KN, Gallagher EP, Miao J, Yatsunyk LA | (2022) "The first crystal structures of hybrid and parallel four-tetrad intramolecular G-quadruplexes." Nucleic Acids Res., 50, 2959-2972. doi: 10.1093/nar/gkac091. | Crystal structure of a four-tetrad, parallel, and k+ stabilized tetrahymena thermophila telomeric g-quadruplex. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-P-P-P), parallel(4+0), UUUU |
| 7kbv | DNA | NMR | Dickerhoff J, Dai J, Yang D | (2021) "Structural recognition of the MYC promoter G-quadruplex by a quinoline derivative: insights into molecular targeting of parallel G-quadruplexes." Nucleic Acids Res., 49, 5905-5915. doi: 10.1093/nar/gkab330. | Solution structure of the major myc promoter g-quadruplex with a wild-type flanking sequence. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7kbw | DNA | NMR | Dickerhoff J, Dai J, Yang D | (2021) "Structural recognition of the MYC promoter G-quadruplex by a quinoline derivative: insights into molecular targeting of parallel G-quadruplexes." Nucleic Acids Res., 49, 5905-5915. doi: 10.1093/nar/gkab330. | Solution structure of the major myc promoter g-quadruplex with a wild-type flanking in complex with nsc85697, a quinoline derivative. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7kbx | DNA | NMR | Dickerhoff J, Dai J, Yang D | (2021) "Structural recognition of the MYC promoter G-quadruplex by a quinoline derivative: insights into molecular targeting of parallel G-quadruplexes." Nucleic Acids Res., 49, 5905-5915. doi: 10.1093/nar/gkab330. | Solution structure of the major myc promoter g-quadruplex in complex with nsc85697, a quinoline derivative. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7klp | DNA | X-ray (1.35 Å) | Li K, Yatsunyk L, Neidle S | (2021) "Water spines and networks in G-quadruplex structures." Nucleic Acids Res., 49, 519-528. doi: 10.1093/nar/gkaa1177. | Crystal structure of a three-tetrad, parallel, k+ stabilized human telomeric g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7l0z | RNA | X-ray (2.1 Å) | Jeng SCY, Trachman III RJ, Weissenboeck F, Truong L, Link KA, Jepsen MDE, Knutson JR, Andersen ES, Ferre-D'Amare AR, Unrau PJ | (2021) "Fluorogenic aptamers resolve the flexibility of RNA junctions using orientation-dependent FRET." Rna, 27, 433-444. doi: 10.1261/rna.078220.120. | Spinach variant bound to dfhbi-1t. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD |
| 7ll0 | DNA | X-ray (2.0 Å) | Beseiso D, Chen EV, McCarthy SE, Martin KN, Gallagher EP, Miao J, Yatsunyk LA | (2022) "The first crystal structures of hybrid and parallel four-tetrad intramolecular G-quadruplexes." Nucleic Acids Res., 50, 2959-2972. doi: 10.1093/nar/gkac091. | Crystal structure of a four-tetrad, parallel, and k+ stabilized tetrahymena thermophila telomeric g-quadruplex. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-P-P-P), parallel(4+0), UUUU |
| 7mkt | RNA | X-ray (1.97 Å) | Roschdi S, Yan J, Nomura Y, Escobar CA, Petersen RJ, Bingman CA, Tonelli M, Vivek R, Montemayor EJ, Wickens M, Kennedy SG, Butcher SE | (2022) "An atypical RNA quadruplex marks RNAs as vectors for gene silencing." Nat.Struct.Mol.Biol., 29, 1113-1121. doi: 10.1038/s41594-022-00854-z. | Crystal structure of r(gu)11g-nmm complex. ➥ 3 G-tetrads, 1 G4 helix |
| 7msv | DNA | NMR | Wang KB, Dickerhoff J, Yang D | (2021) "Solution Structure of Ternary Complex of Berberine Bound to a dGMP-Fill-In Vacancy G-Quadruplex Formed in the PDGFR-beta Promoter." J.Am.Chem.Soc., 143, 16549-16555. doi: 10.1021/jacs.1c06200. | Solution structure of berberine bound to a dgmp fill-in g-quadruplex in the pdgfr-b promoter. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 7n7d | DNA | NMR | Dickerhoff J, Brundridge N, McLuckey SA, Yang D | (2021) "Berberine Molecular Recognition of the Parallel MYC G-Quadruplex in Solution." J.Med.Chem., 64, 16205-16212. doi: 10.1021/acs.jmedchem.1c01508. | Solution structure of the myc promoter g-quadruplex in complex with berberine: conformer a. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7n7e | DNA | NMR | Dickerhoff J, Brundridge N, McLuckey SA, Yang D | (2021) "Berberine Molecular Recognition of the Parallel MYC G-Quadruplex in Solution." J.Med.Chem., 64, 16205-16212. doi: 10.1021/acs.jmedchem.1c01508. | Solution structure of the myc promoter g-quadruplex in complex with berberine: conformer b. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7ntu | hydrolase | X-ray (3.1 Å) | Troisi R, Balasco N, Santamaria A, Vitagliano L, Sica F | (2021) "Structural and functional analysis of the simultaneous binding of two duplex/quadruplex aptamers to human alpha-thrombin." Int.J.Biol.Macromol., 181, 858-867. doi: 10.1016/j.ijbiomac.2021.04.076. | X-ray structure of the complex between human alpha thrombin and two duplex-quadruplex aptamers: nu172 and hd22_27mer. ➥ 6 G-tetrads, 2 G4 helices, 2 G4 stems, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 7nwd | DNA | NMR | Peterkova K, Durnik I, Marek R, Plavec J, Podbevsek P | (2021) "c-kit2 G-quadruplex stabilized via a covalent probe: exploring G-quartet asymmetry." Nucleic Acids Res., 49, 8947-8960. doi: 10.1093/nar/gkab659. | Three-quartet c-kit2 g-quadruplex stabilized by a pyrene conjugate. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7o1h | DNA | NMR | Mohr S, Jana J, Vianney YM, Weisz K | (2021) "Expanding the Topological Landscape by a G-Column Flip of a Parallel G-Quadruplex." Chemistry, 27, 10437-10447. doi: 10.1002/chem.202101181. | Hybrid-2r quadruplex-duplex with (-p-p-l) topology and 3 syn residues. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-Lw), hybrid-2R(3+1), UUUD |
| 7oa3 | RNA | X-ray (2.8 Å) | Mieczkowski M, Steinmetzger C, Bessi I, Lenz AK, Schmiedel A, Holzapfel M, Lambert C, Pena V, Hobartner C | (2021) "Large Stokes shift fluorescence activation in an RNA aptamer by intermolecular proton transfer to guanine." Nat Commun, 12, 3549. doi: 10.1038/s41467-021-23932-0. | Crystal structure of chili RNA aptamer in complex with dmhbo+ (iridium hexammine co-crystallized form). ➥ 4 G-tetrads, 2 G4 helices |
| 7oar | hydrolase | X-ray (2.58 Å) | Dai YX, Guo HL, Liu NN, Chen WF, Ai X, Li HH, Sun B, Hou XM, Rety S, Xi XG | (2022) "Structural mechanism underpinning Thermus oshimai Pif1-mediated G-quadruplex unfolding." Embo Rep., 23, e53874. doi: 10.15252/embr.202153874. | Crystal structure of helicase pif1 from thermus oshimai in complex with parallel g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7oav | RNA | X-ray (2.99 Å) | Mieczkowski M, Steinmetzger C, Bessi I, Lenz AK, Schmiedel A, Holzapfel M, Lambert C, Pena V, Hobartner C | (2021) "Large Stokes shift fluorescence activation in an RNA aptamer by intermolecular proton transfer to guanine." Nat Commun, 12, 3549. doi: 10.1038/s41467-021-23932-0. | Crystal structure of chili RNA aptamer in complex with dmhbo+ (iridium iii hexammine soaking crystal form). ➥ 8 G-tetrads, 4 G4 helices |
| 7oaw | RNA | X-ray (2.95 Å) | Mieczkowski M, Steinmetzger C, Bessi I, Lenz AK, Schmiedel A, Holzapfel M, Lambert C, Pena V, Hobartner C | (2021) "Large Stokes shift fluorescence activation in an RNA aptamer by intermolecular proton transfer to guanine." Nat Commun, 12, 3549. doi: 10.1038/s41467-021-23932-0. | Crystal structure of the chili RNA aptamer in complex with dmhbi+. ➥ 8 G-tetrads, 4 G4 helices |
| 7oax | RNA | X-ray (2.24 Å) | Mieczkowski M, Steinmetzger C, Bessi I, Lenz AK, Schmiedel A, Holzapfel M, Lambert C, Pena V, Hobartner C | (2021) "Large Stokes shift fluorescence activation in an RNA aptamer by intermolecular proton transfer to guanine." Nat Commun, 12, 3549. doi: 10.1038/s41467-021-23932-0. | Crystal structure of the chili RNA aptamer in complex with dmhbo+. ➥ 8 G-tetrads, 4 G4 helices |
| 7oqt | DNA | NMR | Marquevielle J, De Rache A, Vialet B, Morvan E, Mergny JL, Amrane S | (2022) "G-quadruplex structure of the C. elegans telomeric repeat: a two tetrads basket type conformation stabilized by a non-canonical C-T base-pair." Nucleic Acids Res., 50, 7134-7146. doi: 10.1093/nar/gkac523. | G-quadruplex structure of the c. elegans telomeric repeat: a two tetrads basket type conformation stabilised by a hoogsteen c-t base-pair. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU |
| 7otb | DNA | X-ray (1.6 Å) | McQuaid KT, Takahashi S, Baumgaertner L, Cardin DJ, Paterson NG, Hall JP, Sugimoto N, Cardin CJ | (2022) "Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex." J.Am.Chem.Soc., 144, 5956-5964. doi: 10.1021/jacs.2c00178. | Ruthenium polypridyl complex bound to a unimolecular chair-form g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-Lw), chair(2+2), UDUD |
| 7pne | DNA | NMR | Vianney YM, Weisz K | (2022) "Indoloquinoline Ligands Favor Intercalation at Quadruplex-Duplex Interfaces." Chemistry, 28, e202103718. doi: 10.1002/chem.202103718. | Parallel q-d hybrid with 3' duplex stem-loop as a lateral snapback loop. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 7png | DNA | NMR | Vianney YM, Weisz K | (2022) "Indoloquinoline Ligands Favor Intercalation at Quadruplex-Duplex Interfaces." Chemistry, 28, e202103718. doi: 10.1002/chem.202103718. | Solution structure of 1:1 complex of an indoloquinoline derivative syuiq-5 to parallel quadruplex-duplex (q-d) hybrid. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 7pnl | DNA | X-ray (1.83 Å) | Nocentini A, Di Porzio A, Bonardi A, Bazzicalupi C, Petreni A, Biver T, Bua S, Marzano S, Amato J, Pagano B, Iaccarino N, De Tito S, Amente S, Supuran CT, Randazzo A, Gratteri P | (2024) "Development of a multi-targeted chemotherapeutic approach based on G-quadruplex stabilisation and carbonic anhydrase inhibition." J Enzyme Inhib Med Chem, 39, 2366236. doi: 10.1080/14756366.2024.2366236. | Complex between monomolecular human telomeric g-quadruplex and a sulfonamide derivative of the natural alkaloid berberine. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7ps8 | virus | NMR | Marquevielle J, Amrane S | "NMR Structure of the U3 RNA G-quadruplex." | NMR structure of the u3 RNA g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7q48 | RNA | NMR | Wang Z, Jurt S, Dominguez-Martin A, Johannsen S, Sigel RKO | "Solution structure of an intramolecular RNA G-quadruplex formed by the 6A8U17U mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto onco-gene." | Solution structure of an intramolecular RNA g-quadruplex formed by the 6a8u17u mutant from a 22mer guanine-rich sequence within the 5'utr of bcl-2 proto onco-gene. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7q6l | RNA | NMR | Wang Z, Jurt S, Dominguez-Martin A, Johannsen S, Sigel RKO | "Solution structure of an intramolecular RNA G-quadruplex formed by the 6A8A17U mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto-oncogene." | Solution structure of an intramolecular RNA g-quadruplex formed by the 6a8a17u mutant from a 22mer guanine-rich sequence within the 5'utr of bcl-2 proto-oncogene. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7qa2 | RNA | NMR | Wang Z, Falk T, Jurt S, Johannsen S, Sigel RKO | "Solution structure of an intramolecular RNA G-quadruplex formed by the 6A mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto-oncogene." | Solution structure of an intramolecular RNA g-quadruplex formed by the 6a mutant from a 22mer guanine-rich sequence within the 5'utr of bcl-2 proto-oncogene. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7qvq | DNA | X-ray (2.4 Å) | Bazzicalupi C, Bonardi A, Biver T, Ferraroni M, Papi F, Savastano M, Lombardi P, Gratteri P | (2022) "Probing the Efficiency of 13-Pyridylalkyl Berberine Derivatives to Human Telomeric G-Quadruplexes Binding: Spectroscopic, Solid State and In Silico Analysis." Int J Mol Sci, 23. doi: 10.3390/ijms232214061. | Human telomeric DNA g-quadruplex of a gold(iii) complex containing the 2,4,6-tris (2-pyrimidyl)-1,3,5-triazine ligand. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7sxp | RNA | X-ray (2.9 Å) | Balaratnam S, Torrey ZR, Calabrese DR, Banco MT, Yazdani K, Liang X, Fullenkamp CR, Seshadri S, Holewinski RJ, Andresson T, Ferre-D'Amare AR, Incarnato D, Schneekloth Jr JS | (2023) "Investigating the NRAS 5' UTR as a target for small molecules." Cell Chem Biol, 30, 643-657.e8. doi: 10.1016/j.chembiol.2023.05.004. | G-quadruplex structure formed in the nras mrna with a g8u substitution. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P), parallel(4+0), UUUU |
| 7v3t | DNA | NMR | Zhu BC, He J, Xia XY, Jiang J, Liu W, Liu LY, Liang BB, Yao HG, Ke Z, Xia W, Mao ZW | (2022) "Solution structure of a thrombin binding aptamer complex with a non-planar platinum(ii) compound." Chem Sci, 13, 8371-8379. doi: 10.1039/d2sc01196d. | Solution structure of thrombin binding aptamer g-quadruplex bound a self-adaptive small molecule with rotated ligands. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 7v6v | DNA | NMR | Hu W, Jing H, Fu W, Wang Z, Zhou J, Zhang N | (2023) "Conversion to Trimolecular G-Quadruplex by Spontaneous Hoogsteen Pairing-Based Strand Displacement Reaction between Bimolecular G-Quadruplex and Double G-Rich Probes." J.Am.Chem.Soc. doi: 10.1021/jacs.3c05617. | Trimolecular g-quadruplexes consists of a hairpin motif and two short chains. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 7vf1 | DNA | NMR | Maity A, Lim KW, Shneider NA, Chen G, Phan AT | "A duplex-quadruplex hybrid formed by d[G4C2] repeats." | Solution structure of a duplex-quadruplex hybrid formed by d[g4c2] repeats. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UUDD |
| 7w0x | DNA | NMR | Zhang N, Jing HT, Fu WQ | "NMR structure of an alternating antiparallel tetrameric G-quadruplex assembled by the single-repeat of human telomeric DNA d(GGGTTA)." | Tetrameric antiparallel g-quadruplex formed by natural human telomeric sequence. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, (2+2), UDUD |
| 7w9n | DNA | NMR | Xu G, Zhao J, Yu H, Wang C, Huang Y, Zhao Q, Zhou X, Li C, Liu M | (2022) "Structural Insights into the Mechanism of High-Affinity Binding of Ochratoxin A by a DNA Aptamer." J.Am.Chem.Soc., 144, 7731-7740. doi: 10.1021/jacs.2c00478. | The structure of oba33-ota complex. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-Lw-Ln-Lw), chair(2+2), UDUD |
| 7wgw | DNA | NMR | Wang KB, Liu Y, Li Y, Dickerhoff J, Li J, Yang MH, Yang D, Kong LY | (2022) "Oxidative Damage Induces a Vacancy G-Quadruplex That Binds Guanine Metabolites: Solution Structure of a cGMP Fill-in Vacancy G-Quadruplex in the Oxidized BLM Gene Promoter." J.Am.Chem.Soc., 144, 6361-6372. doi: 10.1021/jacs.2c00435. | NMR solution structure of a cgmp fill-in vacancy g-quadruplex formed in the oxidized blm gene promoter. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 7x2z | DNA | NMR | Liu L-Y, Ma TZ, Zeng YL, Liu W, Mao Z-W | (2022) "Structural Basis of Pyridostatin and Its Derivatives Specifically Binding to G-Quadruplexes." J.Am.Chem.Soc., 144, 11878-11887. doi: 10.1021/jacs.2c04775. | NMR solution structure of the 1:1 complex of a pyridostatin derivative (pypds) bound to a g-quadruplex myt1l. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 7x3a | DNA | NMR | Liu L-Y, Ma TZ, Zeng YL, Liu W, Mao Z-W | (2022) "Structural Basis of Pyridostatin and Its Derivatives Specifically Binding to G-Quadruplexes." J.Am.Chem.Soc., 144, 11878-11887. doi: 10.1021/jacs.2c04775. | NMR solution structure of the 1:1 complex of a pyridostatin (pds) bound to a g-quadruplex myt1l. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 7x7g | DNA | X-ray (2.19 Å) | Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan AT | (2022) "Crystal structures of an HIV-1 integrase aptamer: Formation of a water-mediated A.G.G.G.G pentad in an interlocked G-quadruplex." Biochem.Biophys.Res.Commun., 613, 153-158. doi: 10.1016/j.bbrc.2022.04.020. | Crystal structure of a dimeric interlocked parallel g-quadruplex. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED |
| 7x8m | DNA | NMR | Wang KB, Liu Y, Li J, Xiao C, Wang Y, Gu W, Li Y, Xia YZ, Yan T, Yang MH, Kong LY | (2022) "Structural insight into the bulge-containing KRAS oncogene promoter G-quadruplex bound to berberine and coptisine." Nat Commun, 13, 6016. doi: 10.1038/s41467-022-33761-4. | NMR solution structure of the 2:1 berberine-kras-g4 complex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7x8n | DNA | NMR | Wang KB, Liu Y, Li J, Xiao C, Wang Y, Gu W, Li Y, Xia YZ, Yan T, Yang MH, Kong LY | (2022) "Structural insight into the bulge-containing KRAS oncogene promoter G-quadruplex bound to berberine and coptisine." Nat Commun, 13, 6016. doi: 10.1038/s41467-022-33761-4. | NMR solution structure of the wild-type bulge-containing kras-g4. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7x8o | DNA | NMR | Wang KB, Liu Y, Li J, Xiao C, Wang Y, Gu W, Li Y, Xia YZ, Yan T, Yang MH, Kong LY | (2022) "Structural insight into the bulge-containing KRAS oncogene promoter G-quadruplex bound to berberine and coptisine." Nat Commun, 13, 6016. doi: 10.1038/s41467-022-33761-4. | NMR solution structure of the 2:1 coptisine-kras-g4 complex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 7xdh | DNA | X-ray (1.83 Å) | Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan AT | (2022) "Crystal structures of an HIV-1 integrase aptamer: Formation of a water-mediated A.G.G.G.G pentad in an interlocked G-quadruplex." Biochem.Biophys.Res.Commun., 613, 153-158. doi: 10.1016/j.bbrc.2022.04.020. | Crystal structure of a dimeric interlocked parallel g-quadruplex. ➥ 12 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED |
| 7xfv | DNA | NMR | Zhang Y, Lan W, Wang C, Xue H, Cao C | (2023) "Dimeric G-quadruplex DNA Structure in the Proximal Promoter of VEGFR-2 Reveals a New Drug Target to Inhibit Tumor Angiogenesis." Chin.J.Chem., 40, 2179-2187. doi: 10.1002/cjoc.202200260. | Dimeric g-quadruplex DNA formed in the proximal promoter of vegfr-2. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 7xh9 | DNA | X-ray (1.63 Å) | Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan AT | (2022) "Crystal structures of an HIV-1 integrase aptamer: Formation of a water-mediated A.G.G.G.G pentad in an interlocked G-quadruplex." Biochem.Biophys.Res.Commun., 613, 153-158. doi: 10.1016/j.bbrc.2022.04.020. | Crystal structure of a dimeric interlocked parallel g-quadruplex. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED |
| 7xhd | DNA | X-ray (1.66 Å) | Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan AT | (2022) "Crystal structures of an HIV-1 integrase aptamer: Formation of a water-mediated A•G•G•G•G pentad in an interlocked G-quadruplex." Biochem.Biophys.Res.Commun., 613, 153-158. doi: 10.1016/j.bbrc.2022.04.020. | Crystal structure of a dimeric interlocked parallel g-quadruplex. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED |
| 7xie | DNA | X-ray (1.97 Å) | Ngo KH, Liew CW, Lattmann S, Winnerdy FR, Phan AT | (2022) "Crystal structures of an HIV-1 integrase aptamer: Formation of a water-mediated A•G•G•G•G pentad in an interlocked G-quadruplex." Biochem.Biophys.Res.Commun., 613, 153-158. doi: 10.1016/j.bbrc.2022.04.020. | Crystal structure of a dimeric interlocked parallel g-quadruplex. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5'-SEPARATED |
| 7ys5 | DNA | NMR | Yin S, Cao C | "RET G-quadruplex in 10mM Na+." | Ret g-quadruplex in 10mm na+. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(D+PX), UD3(1+3), UDDD |
| 7ys7 | DNA | NMR | Yin S, Cao C | "RET oncogene primer G-quadruplex in Na+." | Ret oncogene primer g4-DNA in 100mmna+. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(D+PX), UD3(1+3), UDDD |
| 7z9l | DNA | NMR | Ghosh A, Trajkovski M, Teulade-Fichou MP, Gabelica V, Plavec J | (2022) "Phen-DC 3 Induces Refolding of Human Telomeric DNA into a Chair-Type Antiparallel G-Quadruplex through Ligand Intercalation." Angew.Chem.Int.Ed.Engl., 61, e202207384. doi: 10.1002/anie.202207384. | Phen-dc3 intercalation causes hybrid-to-antiparallel transformation of human telomeric DNA g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+Ln+Lw+Ln), chair(2+2), UDUD |
| 7zek | DNA | NMR | Jana J, Vianney YM, Schroder N, Weisz K | (2022) "Guiding the folding of G-quadruplexes through loop residue interactions." Nucleic Acids Res., 50, 7161-7175. doi: 10.1093/nar/gkac549. | Structure of a hybrid-type g-quadruplex with a snapback loop (hybrid 1r'). ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+P+P), hybrid-1R(1+3), UDDD |
| 7zem | DNA | NMR | Jana J, Vianney YM, Schroder N, Weisz K | (2022) "Guiding the folding of G-quadruplexes through loop residue interactions." Nucleic Acids Res., 50, 7161-7175. doi: 10.1093/nar/gkac549. | Structure of a parallel g-quadruplex with a snapback loop. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 7zeo | DNA | NMR | Jana J, Vianney YM, Schroder N, Weisz K | (2022) "Guiding the folding of G-quadruplexes through loop residue interactions." Nucleic Acids Res., 50, 7161-7175. doi: 10.1093/nar/gkac549. | Structure of a hybrid-type g-quadruplex with a snapback loop and an all-syn g-column (hybrid-1r). ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+P+P), hybrid-1R(1+3), UDDD |
| 7zj4 | RNA | cryo-EM (4.43 Å) | McRae EKS, Vallina NS, Hansen BK, Boussebayle A, Andersen ES | "Structure determination of Pepper-Broccoli FRET pair by RNA origami scaffolding." | Ligand bound state of a brocolli-pepper aptamer fret tile. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD |
| 7zj5 | RNA | cryo-EM (4.55 Å) | McRae EKS, Vallina NS, Hansen BK, Boussebayle A, Andersen ES | "Structure determination of Pepper-Broccoli FRET pair by RNA origami scaffolding." | Unbound state of a brocolli-pepper aptamer fret tile.. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-PD+P), (2+2), UUDD |
| 7zkl | hydrolase | X-ray (3.18 Å) | Troisi R, Riccardi C, Perez de Carvasal K, Smietana M, Morvan F, Del Vecchio P, Montesarchio D, Sica F | (2022) "A terminal functionalization strategy reveals unusual binding abilities of anti-thrombin anticoagulant aptamers." Mol Ther Nucleic Acids, 30, 585-594. doi: 10.1016/j.omtn.2022.11.007. | X-ray structure of the complex between human alpha thrombin and a pseudo-cyclic thrombin binding aptamer (tba-nnp-ddp) - crystal form alpha. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 7zkm | hydrolase | X-ray (2.0 Å) | Troisi R, Riccardi C, Perez de Carvasal K, Smietana M, Morvan F, Del Vecchio P, Montesarchio D, Sica F | (2022) "A terminal functionalization strategy reveals unusual binding abilities of anti-thrombin anticoagulant aptamers." Mol Ther Nucleic Acids, 30, 585-594. doi: 10.1016/j.omtn.2022.11.007. | X-ray structure of the complex between human alpha thrombin and a pseudo-cyclic thrombin binding aptamer (tba-nnp-ddp) - crystal form beta. ➥ 4 G-tetrads, 2 G4 helices, 2 G4 stems, 2(+Ln+Ln), (2+2), UDUD; 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 7zkn | hydrolase | X-ray (3.03 Å) | Troisi R, Riccardi C, Perez de Carvasal K, Smietana M, Morvan F, Del Vecchio P, Montesarchio D, Sica F | (2022) "A terminal functionalization strategy reveals unusual binding abilities of anti-thrombin anticoagulant aptamers." Mol Ther Nucleic Acids, 30, 585-594. doi: 10.1016/j.omtn.2022.11.007. | X-ray structure of the complex between human alpha thrombin and a pseudo-cyclic thrombin binding aptamer (tba-nnp-ddp) - crystal form gamma. ➥ 8 G-tetrads, 4 G4 helices, 4 G4 stems, 2(+Ln+Ln), (2+2), UDUD; 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 7zko | hydrolase | X-ray (2.5 Å) | Troisi R, Riccardi C, Perez de Carvasal K, Smietana M, Morvan F, Del Vecchio P, Montesarchio D, Sica F | (2022) "A terminal functionalization strategy reveals unusual binding abilities of anti-thrombin anticoagulant aptamers." Mol Ther Nucleic Acids, 30, 585-594. doi: 10.1016/j.omtn.2022.11.007. | X-ray structure of the complex between human alpha thrombin and a pseudo-cyclic thrombin binding aptamer (tba-nnp-ddp) - crystal form delta. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Ln), (2+2), UDUD |
| 7zqs | membrane protein | cryo-EM (2.54 Å) | Cheng EL, Cardle II, Kacherovsky N, Bansia H, Wang T, Zhou Y, Raman J, Yen A, Gutierrez D, Salipante SJ, des Georges A, Jensen MC, Pun SH | (2022) "Discovery of a Transferrin Receptor 1-Binding Aptamer and Its Application in Cancer Cell Depletion for Adoptive T-Cell Therapy Manufacturing." J.Am.Chem.Soc., 144, 13851-13864. doi: 10.1021/jacs.2c05349. | cryo-EM structure of human transferrin receptor 1 bound to DNA aptamer. ➥ 2 G-tetrads |
| 7zur | DNA | X-ray (1.6 Å) | Bazzicalupi C, Bonardi A, Biver T, Ferraroni M, Papi F, Savastano M, Lombardi P, Gratteri P | (2022) "Probing the Efficiency of 13-Pyridylalkyl Berberine Derivatives to Human Telomeric G-Quadruplexes Binding: Spectroscopic, Solid State and In Silico Analysis." Int J Mol Sci, 23. doi: 10.3390/ijms232214061. | Four carbons pendant pyridine derivative of the natural alkaloid berberine as human telomeric g-quadruplex binder. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 8aad | DNA | X-ray (2.04 Å) | Bazzicalupi C, Bonardi A, Biver T, Ferraroni M, Papi F, Savastano M, Lombardi P, Gratteri P | (2022) "Probing the Efficiency of 13-Pyridylalkyl Berberine Derivatives to Human Telomeric G-Quadruplexes Binding: Spectroscopic, Solid State and In Silico Analysis." Int J Mol Sci, 23. doi: 10.3390/ijms232214061. | Two carbons pendant pyridine derivative of the natural alkaloid berberine as human telomeric g-quadruplex binder. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 8abd | DNA | NMR | Vianney YM, Weisz K | (2022) "High-affinity binding at quadruplex-duplex junctions: rather the rule than the exception." Nucleic Acids Res., 50, 11948-11964. doi: 10.1093/nar/gkac1088. | Solution structure of phen-dc3 intercalating into a quadruplex-duplex hybrid. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 8abn | DNA | NMR | Vianney YM, Weisz K | (2022) "High-affinity binding at quadruplex-duplex junctions: rather the rule than the exception." Nucleic Acids Res., 50, 11948-11964. doi: 10.1093/nar/gkac1088. | Solution structure of a phenyl-indoloquinoline intercalating into a quadruplex-duplex hybrid. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 8bw5 | hydrolase | X-ray (2.8 Å) | Troisi R, Napolitano V, Rossitto E, Osman W, Nagano M, Wakui K, Popowicz GM, Yoshimoto K, Sica F | (2023) "Steric hindrance and structural flexibility shape the functional properties of a guanine-rich oligonucleotide." Nucleic Acids Res., 51, 8880-8890. doi: 10.1093/nar/gkad634. | X-ray structure of the complex between human alpha thrombin and the duplex-quadruplex aptamer m08s-1_41mer. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 8bzu | DNA | NMR | Gajarsky M, Stadlbauer P, Sponer J, Cucchiarini A, Dobrovolna M, Brazda V, Mergny JL, Trantirek L, Lenarcic Zivkovic M | (2024) "DNA Quadruplex Structure with a Unique Cation Dependency." Angew.Chem.Int.Ed.Engl., 63, e202313226. doi: 10.1002/anie.202313226. | Double-ion dependent DNA quadruplex structure formed by c.elegans telomeric sequence. ➥ 1 G-tetrad |
| 8c7a | DNA | NMR | Zalar M, Wang B, Plavec J, Sket P | (2023) "Insight into Tetramolecular DNA G-Quadruplexes Associated with ALS and FTLD: Cation Interactions and Formation of Higher-Ordered Structure." Int J Mol Sci, 24. doi: 10.3390/ijms241713437. | Slow cation movements within tetramolecular g-quadruplex: vacant cation binding sites in addition to all syn g-quartet. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 8c7b | DNA | NMR | Zalar M, Wang B, Plavec J, Sket P | (2023) "Insight into Tetramolecular DNA G-Quadruplexes Associated with ALS and FTLD: Cation Interactions and Formation of Higher-Ordered Structure." Int J Mol Sci, 24. doi: 10.3390/ijms241713437. | Slow cation movements within tetramolecular g-quadruplex: vacant cation binding sites in addition to all syn g-quartet. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 8d78 | DNA | X-ray (2.12 Å) | Beseiso D, Chen EV, Yatsunyk LA | "Biophysical and structural characterization of telomeric G-quadruplexes from Tetrahymena thermophila in complex with N-Methyl Mesoporphyrin IX." | Crystal structure of a ba stabilized four-tetrad, parallel tetrahymena thermophila telomeric g-quadruplex in complex with n-methyl mesoporphyrin ix. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-P-P-P), parallel(4+0), UUUU |
| 8d79 | DNA | X-ray (1.99 Å) | Beseiso D, Chen EV, Yatsunyk LA | "Biophysical and structural characterization of telomeric G-quadruplexes from Tetrahymena thermophila in complex with N-Methyl Mesoporphyrin IX." | Crystal structure of a four-tetrad, parallel, and na+ stabilized tetrahymena thermophila telomeric g-quadruplex in complex with n-methyl mesoporphyrin ix. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(-P-P-P), parallel(4+0), UUUU |
| 8dut | DNA | cryo-EM (7.4 Å) | Monsen RC, Chua EYD, Hopkins JB, Chaires JB, Trent JO | (2023) "Structure of a 28.5 kDa duplex-embedded G-quadruplex system resolved to 7.4 angstrom resolution with cryo-EM." Nucleic Acids Res., 51, 1943-1959. doi: 10.1093/nar/gkad014. | Duplex-g-quadruplex-duplex (dgd) class_1. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 8ebo | DNA | X-ray (1.98 Å) | Ye M, Chen EV, Pfeil SH, Martin KN, Atrafi T, Yun S, Martinez Z, Yatsunyk LA | (2022) "Homopurine guanine-rich sequences in complex with N-methyl mesoporphyrin IX form parallel G-quadruplex dimers and display a unique symmetry tetrad." Bioorg.Med.Chem., 77, 117112. doi: 10.1016/j.bmc.2022.117112. | Homopurine parallel g-quadruplex from human chromosome 7 stabilized by k+ ions. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 8edp | DNA | X-ray (2.01 Å) | Ye M, Chen EV, Pfeil SH, Martin KN, Atrafi T, Yun S, Martinez Z, Yatsunyk LA | (2022) "Homopurine guanine-rich sequences in complex with N-methyl mesoporphyrin IX form parallel G-quadruplex dimers and display a unique symmetry tetrad." Bioorg.Med.Chem., 77, 117112. doi: 10.1016/j.bmc.2022.117112. | Crystal structure of a three-tetrad, parallel, and k+ stabilized homopurine g-quadruplex from human chromosome 7. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 8eyu | RNA | X-ray (1.95 Å) | Passalacqua LFM, Starich MR, Link KA, Wu J, Knutson JR, Tjandra N, Jaffrey SR, Ferre-D'Amare AR | (2023) "Co-crystal structures of the fluorogenic aptamer Beetroot show that close homology may not predict similar RNA architecture." Nat Commun, 14, 2969. doi: 10.1038/s41467-023-38683-3. | Structure of beetroot dimer bound to dfame. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 8eyv | RNA | X-ray (2.55 Å) | Passalacqua LFM, Starich MR, Link KA, Wu J, Knutson JR, Tjandra N, Jaffrey SR, Ferre-D'Amare AR | (2023) "Co-crystal structures of the fluorogenic aptamer Beetroot show that close homology may not predict similar RNA architecture." Nat Commun, 14, 2969. doi: 10.1038/s41467-023-38683-3. | Structure of beetroot dimer bound to dfho. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 8eyw | RNA | X-ray (2.1 Å) | Passalacqua LFM, Starich MR, Link KA, Wu J, Knutson JR, Tjandra N, Jaffrey SR, Ferre-D'Amare AR | (2023) "Co-crystal structures of the fluorogenic aptamer Beetroot show that close homology may not predict similar RNA architecture." Nat Commun, 14, 2969. doi: 10.1038/s41467-023-38683-3. | Beetroot dimer bound to tht. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 8f0n | RNA | X-ray (2.85 Å) | Passalacqua LFM, Starich MR, Link KA, Wu J, Knutson JR, Tjandra N, Jaffrey SR, Ferre-D'Amare AR | (2023) "Co-crystal structures of the fluorogenic aptamer Beetroot show that close homology may not predict similar RNA architecture." Nat Commun, 14, 2969. doi: 10.1038/s41467-023-38683-3. | Wobble beetroot (a16u-u38g) dimer bound to dfho. ➥ 6 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 8fhv | DNA | X-ray (2.5 Å) | Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR | (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. | Structure of lettuce aptamer bound to dfhbi-1t with thallium i ions. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 8fhx | DNA | X-ray (2.5 Å) | Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR | (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. | Structure of lettuce aptamer bound to dfhbi-1t. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 8fhz | DNA | X-ray (2.6 Å) | Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR | (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. | Structure of lettuce aptamer bound to dfho. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 8fi0 | DNA | X-ray (3.0 Å) | Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR | (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. | Structure of lettuce aptamer bound to dfame. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 8fi1 | DNA | X-ray (2.6 Å) | Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR | (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. | Structure of lettuce c20g bound to dfho. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 8fi2 | DNA | X-ray (3.0 Å) | Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR | (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. | Structure of lettuce c20t bound to dfhbi-1t. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 8fi7 | DNA | X-ray (2.9 Å) | Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR | (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. | Structure of lettuce c20t bound to dfho. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 8fi8 | DNA | X-ray (2.8 Å) | Passalacqua LFM, Banco MT, Moon JD, Li X, Jaffrey SR, Ferre-D'Amare AR | (2023) "Intricate 3D architecture of a DNA mimic of GFP." Nature, 618, 1078-1084. doi: 10.1038/s41586-023-06229-8. | Structure of lettuce c20t bound to dfame. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+Ln+Lw+Ln), chair(2+2), UDUD |
| 8fyh | gene regulation | cryo-EM (3.4 Å) | Song J, Gooding AR, Hemphill WO, Love BD, Robertson A, Yao L, Zon LI, North TE, Kasinath V, Cech TR | (2023) "Structural basis for inactivation of PRC2 by G-quadruplex RNA." Science, 381, 1331-1337. doi: 10.1126/science.adh0059. | G4 RNA-mediated prc2 dimer. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, , parallel(4+0), UUUU |
| 8g2n | DNA | X-ray (1.33 Å) | Martin KN, Yatsunyk LA | "Crystal structure of Tetrahymena thermophila G-rich DNA with novel ligand PyDH2." | Crystal structure of tetrahymena thermophila g-rich DNA with novel ligand pydh2. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 4(+Ln+Lw+Ln), chair(2+2), UDUD |
| 8gp7 | DNA | NMR | Yin S, Lan W, Hou X, Liu Z, Xue H, Wang C, Tang GL, Cao C | (2023) "Trioxacarcin A Interactions with G-Quadruplex DNA Reveal Its Potential New Targets as an Anticancer Agent." J.Med.Chem., 66, 6798-6810. doi: 10.1021/acs.jmedchem.3c00178. | Structure of trioxacarcin a covalently bound to ret g4-DNA. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 8ht7 | DNA binding protein | NMR | Geng Y, Liu C, Xu N, Shi X, Suen MC, Zhou B, Yan B, Wu C, Li H, Song Y, Chen X, Wang Z, Cai Q, Zhu G | (2024) "The N-terminal region of Cdc6 specifically recognizes human DNA G-quadruplex." Int.J.Biol.Macromol., 260, 129487. doi: 10.1016/j.ijbiomac.2024.129487. | The n-terminal region of cdc6 specifically recognizes human DNA g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+Ln+Lw+Ln), chair(2+2), UDUD |
| 8ijc | DNA | NMR | Liu LY, Ma TZ, Zeng YL, Liu W, Zhang H, Mao ZW | (2023) "Organic-Platinum Hybrids for Covalent Binding of G-Quadruplexes: Structural Basis and Application to Cancer Immunotherapy." Angew.Chem.Int.Ed.Engl., 62, e202305645. doi: 10.1002/anie.202305645. | NMR solution structure of the 1:1 complex of a platinum(ii) ligand l1-transpt covalently bound to a g-quadruplex myt1l. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 8ipp | DNA binding protein-DNA | X-ray (2.007 Å) | Ngo KH, Liew CW, Heddi B, Phan AT | (2024) "Structural Basis for Parallel G-Quadruplex Recognition by an Ankyrin Protein." J.Am.Chem.Soc., 146, 13709-13713. doi: 10.1021/jacs.4c01971. | Crystal structure of the complex between an ankyrin and a parallel g-quadruplex. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 8jfq | DNA | NMR | Liu Y, Li J, Zhang Y, Wang Y, Chen J, Bian Y, Xia Y, Yang MH, Zheng K, Wang KB, Kong LY | (2023) "Structure of the Major G-Quadruplex in the Human EGFR Oncogene Promoter Adopts a Unique Folding Topology with a Distinctive Snap-Back Loop." J.Am.Chem.Soc., 145, 16228-16237. doi: 10.1021/jacs.3c05214. | Structure of the major g-quadruplex in the human egfr oncogene promoter adopts a unique folding topology with a distinctive snap-back loop. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 8jic | DNA | NMR | Galer P, Wang B, Plavec J, Sket P | (2023) "Unveiling the structural mechanism of a G-quadruplex pH-Driven switch." Biochimie, 214, 73-82. doi: 10.1016/j.biochi.2023.08.002. | Human telomere two-quartet g-quadruplex at ph 7.0. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwD+Ln), basket(2+2), UDDU |
| 8jih | DNA | NMR | Galer P, Wang B, Plavec J, Sket P | (2023) "Unveiling the structural mechanism of a G-quadruplex pH-Driven switch." Biochimie, 214, 73-82. doi: 10.1016/j.biochi.2023.08.002. | Human telomere two-quartet g-quadruplex at ph 5.0. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(+LnD-Lw), basket(2+2), UUDD |
| 8kf9 | DNA | NMR | Zhang YP, Lan WX, Yin SW, Liu ZJ, Xue HJ, Cao CY | "Stable G-quadruplex Conformation Formed in Promoter Region of Oncogene RET Indicates New Target for Anti-cancer Drug Screening." | Stable g-quadruplex conformation formed in promoter region of oncogene ret in 50 mm k+ solution. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(D+PX), UD3(1+3), UDDD |
| 8kfl | DNA | NMR | Zhang YP, Lan WX, Yin SW, Liu ZJ, Xue HJ, Cao CY | "Stable G-quadruplex Conformation Formed in Promoter Region of Oncogene RET Indicates New Target for Anti-cancer Drug Screening." | Stable g-quadruplex conformation formed in promoter region of oncogene ret in 100 mm na+. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(D+PX), UD3(1+3), UDDD |
| 8p6b | DNA | X-ray (2.5 Å) | McQuaid KT, Cardin CJ | "Ruthenium complex bound to an antiparallel G-quadruplex." | Ruthenium complex bound to an antiparallel g-quadruplex. ➥ 2 G-tetrads, 1 G4 helix |
| 8psb | DNA | NMR | Vianney YM, Schroder N, Jana J, Chojetzki G, Weisz K | (2023) "Showcasing Different G-Quadruplex Folds of a G-Rich Sequence: Between Rule-Based Prediction and Butterfly Effect." J.Am.Chem.Soc., 145, 22194-22205. doi: 10.1021/jacs.3c08336. | Three-layered parallel g-quadruplex with snapback loop from a g-rich sequence with five g-runs. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 8psc | DNA | NMR | Vianney YM, Schroder N, Jana J, Chojetzki G, Weisz K | (2023) "Showcasing Different G-Quadruplex Folds of a G-Rich Sequence: Between Rule-Based Prediction and Butterfly Effect." J.Am.Chem.Soc., 145, 22194-22205. doi: 10.1021/jacs.3c08336. | Three-layered basket-type g-quadruplex from a g-rich sequence with five g-runs. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-LwD+Ln), basket(2+2), UDDU |
| 8pse | DNA | NMR | Vianney YM, Schroder N, Jana J, Chojetzki G, Weisz K | (2023) "Showcasing Different G-Quadruplex Folds of a G-Rich Sequence: Between Rule-Based Prediction and Butterfly Effect." J.Am.Chem.Soc., 145, 22194-22205. doi: 10.1021/jacs.3c08336. | (3+1) hybrid g-quadruplex from a g-rich sequence with five g-runs. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-PD+Lw), U3D(3+1), UUUD |
| 8psi | DNA | NMR | Vianney YM, Schroder N, Jana J, Chojetzki G, Weisz K | (2023) "Showcasing Different G-Quadruplex Folds of a G-Rich Sequence: Between Rule-Based Prediction and Butterfly Effect." J.Am.Chem.Soc., 145, 22194-22205. doi: 10.1021/jacs.3c08336. | G-quadruplex with a 1-nt v-shaped loop from a g-rich sequence with five g-runs. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-LwX+Lw), (2+2), UDUD |
| 8q4o | RNA | NMR | Orehova M, Plavec J, Kocman V | (2024) "High-Resolution Structure of RNA G-Quadruplex Containing Unique Structural Motifs Originating from the 5'-UTR of Human Tyrosine Kinase 2 (TYK2)." Acs Omega, 9, 7215-7229. doi: 10.1021/acsomega.3c09592. | RNA g-quadruplex from the 5'-utr of human tyrosine kinase 2 (tyk2). ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 8qkx | DNA | NMR | Agustin DF, Vianney YM, Weisz K, Wahjudi M | (2024) "Structural Aspects of Split G-Quadruplexes in Quadruplex-Duplex Hybrid Systems." Chemistryselect. doi: 10.1002/slct.202304286. | Solution structure of a bimolecular quadruplex-duplex hybrid containing a v-shaped loop. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, (3+1), UDUU |
| 8r4e | DNA | NMR | Jana J, Vianney YM, Weisz K | (2024) "Impact of loop length and duplex extensions on the design of hybrid-type G-quadruplexes." Chem.Commun.(Camb.), 60, 854-857. doi: 10.1039/d3cc05625b. | Hybrid-1r g-quadruplex with a +(lpp) loop progression. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(+Ln+P+P), hybrid-1R(1+3), UDDD |
| 8r4w | DNA | NMR | Jana J, Vianney YM, Weisz K | (2024) "Impact of loop length and duplex extensions on the design of hybrid-type G-quadruplexes." Chem.Commun.(Camb.), 60, 854-857. doi: 10.1039/d3cc05625b. | (3+1) hybrid-2 g-quadruplex with a -(llp) loop progression. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 8r6d | DNA | NMR | Vianney YM, Dierks D, Weisz K | (2024) "Structural Differences at Quadruplex-Duplex Interfaces Enable Ligand-Induced Topological Transitions." Adv Sci, 11, e2309891. doi: 10.1002/advs.202309891. | A quadruplex-duplex hybrid with a three-layered hybrid-2 g-quadruplex topology. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 8r6g | DNA | NMR | Vianney YM, Dierks D, Weisz K | (2024) "Structural Differences at Quadruplex-Duplex Interfaces Enable Ligand-Induced Topological Transitions." Adv Sci, 11, e2309891. doi: 10.1002/advs.202309891. | A quadruplex-duplex hybrid with a three-layered chair g-quadruplex topology. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-Lw), chair(2+2), UDUD |
| 8r6h | DNA | NMR | Vianney YM, Dierks D, Weisz K | (2024) "Structural Differences at Quadruplex-Duplex Interfaces Enable Ligand-Induced Topological Transitions." Adv Sci, 11, e2309891. doi: 10.1002/advs.202309891. | A quadruplex-duplex hybrid with a three-layered hybrid-2 g-quadruplex topology complexed with phen-dc3. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-P), hybrid-2(3+1), UDUU |
| 8rw2 | DNA | NMR | Vianney YM, Jana J, Weisz K | (2024) "A pH-Responsive Topological Switch Based on a DNA Quadruplex-Duplex Hybrid." Chemistry, 30, e202400722. doi: 10.1002/chem.202400722. | Structure of a chair-type antiparallel quadruplex-duplex hybrid at ph 6. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-Lw-Ln-Lw), chair(2+2), UDUD |
| 8rzx | DNA | NMR | Chatterjee O, Jana J, Panda S, Dutta A, Sharma A, Saurav S, Motiani RK, Weisz K, Chatterjee S | (2024) "Remodeling Ca 2+ dynamics by targeting a promising E-box containing G-quadruplex at ORAI1 promoter in triple-negative breast cancer." Cell Calcium, 123, 102944. doi: 10.1016/j.ceca.2024.102944. | Solution structure of a parallel stranded g-quadruplex formed in orai1 promoter. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 8s1w | DNA | NMR | Vianney YM, Jana J, Weisz K | (2024) "A pH-Responsive Topological Switch Based on a DNA Quadruplex-Duplex Hybrid." Chemistry, 30, e202400722. doi: 10.1002/chem.202400722. | Structure of a quadruplex-duplex hybrid with a (-pd+l) loop progression. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-PD+Lw), U3D(3+1), UUUD |
| 8t8t | DNA | X-ray (1.62 Å) | Lam G, Yatunsyk LA | "Crystal structure of TET25 in complex with PyDH2 ligand in P212121 space group." | Crystal structure of tet25 in complex with pydh2 ligand in p212121 space group. ➥ 8 G-tetrads, 2 G4 helices, 2 G4 stems, 4(+Ln+Lw+Ln), chair(2+2), UDUD |
| 8taa | DNA | X-ray (1.45 Å) | Seth PC, Yatsunyk LA | "Right-left hybrid parallel G-quadruplex in complex with N-methyl mesoporphyrin." | Right-left hybrid parallel g-quadruplex in complex with n-methyl mesoporphyrin. ➥ 4 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-P), parallel(4+0), UUUU |
| 8tns | RNA | multiple methods: solution nmr, solution scattering | Escobar CA, Petersen RJ, Tonelli M, Fan L, Henzler-Wildman KA, Butcher SE | (2023) "Solution Structure of Poly(UG) RNA." J.Mol.Biol., 435, 168340. doi: 10.1016/j.jmb.2023.168340. | Solution structure of poly(ug) RNA (gu)12 g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix |
| 8tqs | blood clotting | X-ray (2.207 Å) | Yu H, Kumar S, Frederiksen JW, Kolyadko VN, Pitoc G, Layzer J, Yan A, Rempel R, Francis S, Krishnaswamy S, Sullenger BA | (2024) "Aptameric hirudins as selective and reversible EXosite-ACTive site (EXACT) inhibitors." Nat Commun, 15, 3977. doi: 10.1038/s41467-024-48211-6. | Complex of human thrombin (s195a) bound to a bivalent inhibitor comprised of DNA aptamer hd22 conjugated to dabigatran with a linker.. ➥ 1 G-tetrad |
| 8tvz | RNA | cryo-EM (5.94 Å) | Vallina NS, McRae EKS, Geary C, Andersen ES | (2024) "An RNA origami robot that traps and releases a fluorescent aptamer." Sci Adv, 10, eadk1250. doi: 10.1126/sciadv.adk1250. | RNA origami 3-helix tile traptamer. ➥ 1 G-tetrad |
| 8twh | DNA | X-ray (2.47 Å) | Lam G, Martin KN, Yatsunyk LA | "Crystal structure of (GGGTT)3GGG G-quadruplex in complex with small molecule ligand RHPS4." | Crystal structure of (gggtt)3ggg g-quadruplex in complex with small molecule ligand rhps4. ➥ 30 G-tetrads, 5 G4 helices, 10 G4 stems, 5 G4 coaxial stacks, 3(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 8u5j | RNA | X-ray (1.7 Å) | Passalacqua LFM, Ferre-D'Amare AR | "Structure of Mango III variant aptamer bound to T01-07M-B." | Structure of mango iii variant aptamer bound to t01-07m-b. ➥ 2 G-tetrads, 1 G4 helix, 1 G4 stem, 2(-P-P-Lw), hybrid-2R(3+1), UUUD |
| 8u5k | RNA | X-ray (2.8 Å) | Passalacqua LFM, Ferre-D'Amare AR | "Structure of Mango II aptamer bound to T01-6A." | Structure of mango ii aptamer bound to t01-6a. ➥ 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 8u5p | RNA | X-ray (2.9 Å) | Passalacqua LFM, Ferre-D'Amare AR | "Structure of Mango II aptamer bound to T01-6A-B." | Structure of mango ii aptamer bound to t01-6a-b. ➥ 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 8u5r | RNA | X-ray (2.6 Å) | Passalacqua LFM, Ferre-D'Amare AR | "Structure of Mango II variant aptamer bound to T01-6A." | Structure of mango ii variant aptamer bound to t01-6a. ➥ 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 8u5t | RNA | X-ray (2.2 Å) | Passalacqua LFM, Ferre-D'Amare AR | "Structure of Mango II variant aptamer bound to T01-6A-B." | Structure of mango ii variant aptamer bound to t01-6a-b. ➥ 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 8u5z | RNA | X-ray (2.5 Å) | Passalacqua LFM, Ferre-D'Amare AR | "Structure of Mango II variant aptamer bound to T01-7M-B." | Structure of mango ii variant aptamer bound to t01-7m-b. ➥ 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 8u60 | RNA | X-ray (3.3 Å) | Passalacqua LFM, Ferre-D'Amare AR | "Structure of Mango II variant2 aptamer bound to T01-6A." | Structure of mango ii variant2 aptamer bound to t01-6a. ➥ 9 G-tetrads, 2 G4 helices, 3 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 8utg | RNA | X-ray (1.97 Å) | Terrell JR, Le TT, Paul A, Brinton MA, Wilson WD, Poon GMK, Germann MW, Siemer JL | (2024) "Structure of an RNA G-quadruplex from the West Nile virus genome." Nat Commun, 15, 5428. doi: 10.1038/s41467-024-49761-5. | An RNA g-quadruplex from the ns5 gene in the west nile virus genome. ➥ 4 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 8vjt | RNA | X-ray (1.052 Å) | Roschdi S, Montemayor EJ, Vivek R, Bingman CA, Butcher SE | (2024) "Self-assembly and condensation of intermolecular poly(UG) RNA quadruplexes." Nucleic Acids Res. doi: 10.1093/nar/gkae870. | Structure of the poly-ug quadruplex (gugugu)4. ➥ 3 G-tetrads, 1 G4 helix |
| 8wa4 | DNA | NMR | Xiao CM, Li YP, Liu YS, Dong RF, He XY, Lin Q, Zang X, Wang KB, Xia YZ, Kong LY | "Stabilizing ATF4 promoter G-quadruplex overcomes the resistance of glutamine-restricted cancer therapy." | Solution structure of free atf4 promoter g-quadruplex. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, 3(-P-P-P), parallel(4+0), UUUU |
| 8x0s | RNA | X-ray (2.956 Å) | Geng Y, Liu C, Xu N, Suen MC, Miao H, Xie Y, Zhang B, Chen X, Song Y, Wang Z, Cai Q, Zhu G | (2024) "Crystal structure of a tetrameric RNA G-quadruplex formed by hexanucleotide repeat expansions of C9orf72 in ALS/FTD." Nucleic Acids Res., 52, 7961-7970. doi: 10.1093/nar/gkae473. | Crystal structure of r(g4c2)2. ➥ 8 G-tetrads, 1 G4 helix, 2 G4 stems, 1 G4 coaxial stack, parallel(4+0), UUUU, coaxial interfaces: 5'/5' |
| 8x1v | DNA | NMR | Wang Y, Wang J, Yan Z, Hou J, Wan L, Yang Y, Liu Y, Yi J, Guo P, Han D | (2024) "Structural investigation of pathogenic RFC1 AAGGG pentanucleotide repeats reveals a role of G-quadruplex in dysregulated gene expression in CANVAS." Nucleic Acids Res., 52, 2698-2710. doi: 10.1093/nar/gkae032. | NMR structure of a bimolecular parallel g-quadruplex formed by aaggg repeats from pathogenic rfc1 gene. ➥ 3 G-tetrads, 1 G4 helix, 1 G4 stem, parallel(4+0), UUUU |
| 8xak | hydrolase-DNA | X-ray (3.5 Å) | Hong Z, Byrd AK, Gao J, Das P, Tan VQ, Malone EG, Osei B, Marecki JC, Protacio RU, Wahls WP, Raney KD, Song H | (2024) "Eukaryotic Pif1 helicase unwinds G-quadruplex and dsDNA using a conserved wedge." Nat Commun, 15, 6104. doi: 10.1038/s41467-024-50575-8. | Structure of pif1-g4 complex. ➥ 8 G-tetrads, 2 G4 helices, 4 G4 stems, 2 G4 coaxial stacks, 2(-P-P-P), parallel(4+0), UUUU, coaxial interfaces: 3'/5' |
| 9eoq | DNA | cryo-EM (7.5 Å) | Khoshouei A, Kempf G, Mykhailiuk V, Griessing JM, Honemann MN, Kater L, Cavadini S, Dietz H | (2024) "Designing Rigid DNA Origami Templates for Molecular Visualization Using Cryo-EM." Nano Lett., 24, 5031-5038. doi: 10.1021/acs.nanolett.4c00915. | cryo-EM structure of a 1033 scaffold base DNA origami nanostructure v4 and tba. ➥ 1 G-tetrad |
| pdb id | class | method | authors | reference | annotation |